ID: 929615180

View in Genome Browser
Species Human (GRCh38)
Location 2:43301135-43301157
Sequence GCTGAGAACCACACTCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929615180 Original CRISPR GCTGAGAACCACACTCCTCA GGG Intronic
900233512 1:1574825-1574847 GCAGAGACCCGCACTCCACAAGG + Exonic
900519576 1:3099080-3099102 GCTGAGAAGCAAGCTCCTCTGGG + Intronic
903534771 1:24059761-24059783 GTTGACAACCACACTCTTCCTGG - Intronic
904941852 1:34169288-34169310 GCTGAGACCCACACTCTCCTAGG - Intronic
906550351 1:46661045-46661067 ACTGATAACAACACTGCTCATGG + Intronic
908223799 1:62035965-62035987 GCTGAGATCTACCCGCCTCAGGG - Intronic
908569505 1:65393890-65393912 TCTGAGACCCACACTCATGAAGG - Intronic
913287806 1:117242914-117242936 ACTCAGAACTCCACTCCTCAAGG + Intergenic
913659590 1:120994484-120994506 GATGACATCCACACTCCTCCAGG + Intergenic
914010951 1:143777608-143777630 GATGACATCCACACTCCTCCAGG + Intergenic
914166880 1:145183504-145183526 GATGACATCCACACTCCTCCAGG - Intergenic
914649572 1:149686268-149686290 GATGACATCCACACTCCTCCAGG + Intergenic
915029141 1:152861124-152861146 GCTGAGAACCTCAGGCCTCTTGG + Intergenic
916126958 1:161580347-161580369 GCTGAGAACCACAGTACTACAGG - Intergenic
916136878 1:161662151-161662173 GCTGAGAACCACAGTACTACAGG - Intronic
917743353 1:177983337-177983359 GCTGGGCAGCAGACTCCTCAGGG + Intronic
920058883 1:203213920-203213942 TTTGAGATCCACAGTCCTCAGGG - Intronic
920976577 1:210791432-210791454 GTTGAGAACCACTGGCCTCATGG + Intronic
923000449 1:230002667-230002689 GCTGGGAACCAAACTCATCCTGG + Intergenic
923047998 1:230369459-230369481 CCTGAGAAACACACTGCACAGGG + Intronic
923625433 1:235610096-235610118 GCTGAGAATCACACGCCACATGG + Intronic
923928105 1:238659044-238659066 ACTGACAAACACACTCCTTATGG - Intergenic
1063843924 10:10103940-10103962 ACTGAAAGCCACACTCCTAAAGG - Intergenic
1065672035 10:28129865-28129887 TCTGAGAACCACTGTTCTCAAGG + Intronic
1070674053 10:78399782-78399804 GCTGAGACACAGACTCCCCAGGG - Intergenic
1070750455 10:78961089-78961111 GCTGGGAACCATACCCCTCAGGG - Intergenic
1072232055 10:93422355-93422377 GCTGTGAGCCAGACTCCTAAGGG + Intronic
1073483294 10:103800424-103800446 GCTGACAGCCATATTCCTCAGGG + Intronic
1073784996 10:106879224-106879246 ACTGATGACCACACTGCTCACGG + Intronic
1074069662 10:110053690-110053712 GATGAGAACAATAATCCTCAAGG - Intronic
1074794263 10:116925239-116925261 GCTGAGGGCCACCCACCTCAGGG - Intronic
1076789992 10:132771818-132771840 GCTGAGTGCCCCACTCTTCACGG - Intronic
1083923872 11:65794424-65794446 GGTGGGCACCACCCTCCTCAGGG + Intronic
1089094418 11:115906845-115906867 TCTGAGCTCCACACTGCTCAGGG + Intergenic
1090333306 11:125947422-125947444 GCAGACATCCCCACTCCTCATGG - Intergenic
1095332041 12:40977716-40977738 GCTGAGAACTACATTCTTTAAGG + Intronic
1103156542 12:118689913-118689935 TCTGCTAACCACACTCCCCATGG - Intergenic
1103703057 12:122857981-122858003 GCTGAGACCCTCACTGGTCAGGG - Intronic
1104211729 12:126695277-126695299 GCTGACAATGACACTCTTCAGGG + Intergenic
1107086819 13:36433860-36433882 GCTGAAAACCGAACCCCTCAAGG - Intronic
1109788564 13:67216114-67216136 ACTGGGAGCAACACTCCTCAGGG - Intronic
1113514250 13:110879855-110879877 GCAGAGAACCGCACAACTCAGGG + Exonic
1117718595 14:58606114-58606136 GTGGAGAATCACACTTCTCAGGG - Intergenic
1118874796 14:69774574-69774596 GATTACATCCACACTCCTCATGG - Intergenic
1124558464 15:30748783-30748805 CCTGAGACCCTCAGTCCTCAGGG + Intronic
1124672789 15:31656847-31656869 CCTGAGACCCTCAGTCCTCAGGG - Intronic
1124844682 15:33279046-33279068 GCAGAGTGCCACACTCCCCAGGG - Intergenic
1129795190 15:78370840-78370862 GCTGAGAACCTCTCTACTGAAGG - Intergenic
1131538213 15:93254766-93254788 GTTGAGAACCACTCTCCTGAAGG + Intergenic
1131565954 15:93485676-93485698 GCTGACAACCACACTGCCAAGGG + Intergenic
1131622241 15:94080550-94080572 GCTCTGAACCACACCCTTCAGGG + Intergenic
1132779088 16:1613086-1613108 GCTGAGAACCCCGCTGCCCAGGG - Intronic
1134231794 16:12435635-12435657 GCTGAGAACTATGCTCATCAAGG - Intronic
1140112178 16:72013712-72013734 GCTGAGAACCACGGTCCTGGAGG + Intronic
1141091526 16:81133599-81133621 GATGAAAACCACCCACCTCAAGG - Intergenic
1142857130 17:2737374-2737396 CCTGAGAACTCCAATCCTCAGGG + Intergenic
1145999792 17:29124380-29124402 GCTGAGAACCACATGCCACATGG + Intronic
1148196228 17:45715368-45715390 GATCAGAGCCACACCCCTCAGGG + Intergenic
1151513060 17:74573552-74573574 ACTGAGAACCACAGCCCTTATGG - Intergenic
1151994102 17:77597801-77597823 CCAGAGAATCACACTCCACAGGG - Intergenic
1156405470 18:36778833-36778855 GCTAAGACCCACAGTACTCATGG + Intronic
1156506248 18:37596221-37596243 GCTGAGAACCACTATCTTCTGGG - Intergenic
1156977846 18:43246611-43246633 CCTGAGCTCCACACTCCACATGG + Intergenic
1157473546 18:48007695-48007717 ACTCAGCACCACCCTCCTCATGG - Intergenic
1157578192 18:48758023-48758045 GCTCAGCACCCCACCCCTCAGGG + Exonic
1158190948 18:54828309-54828331 AGTGAGAAACACACTCCTCTCGG - Exonic
1158672158 18:59486112-59486134 GCTGAGCTTCAGACTCCTCATGG + Intronic
1161794491 19:6378605-6378627 GCTGAGAACCACACACAAAATGG + Intronic
1163390101 19:17025684-17025706 GCTGAGAACCACTATTCTAAGGG + Intronic
1164063470 19:21694822-21694844 GTTGGGATCCAAACTCCTCATGG - Intergenic
1164142704 19:22487243-22487265 GCTCAGAACAACCCTCATCAAGG - Intronic
1166830314 19:45635469-45635491 GCTGAGGACCAGACTCAACAAGG + Intronic
925506636 2:4572904-4572926 CCTGAGGACCACAGTCTTCAGGG - Intergenic
927185584 2:20479883-20479905 GCTGAGACCCACACTCGGGATGG + Intergenic
927885826 2:26717958-26717980 GATGAGAACCCCTGTCCTCATGG + Intronic
928393521 2:30927119-30927141 TTTGGGAACCACACTCCTTAGGG - Intronic
929615180 2:43301135-43301157 GCTGAGAACCACACTCCTCAGGG + Intronic
937376707 2:121341322-121341344 GGTGAGAACCCCGCTCCACAGGG + Intronic
939808873 2:146807768-146807790 GCTGAGAACCACACAGGGCAGGG + Intergenic
941200809 2:162507155-162507177 ACTTAGAGCTACACTCCTCATGG + Intronic
941846880 2:170142290-170142312 GCTCAGACCCACACCCCTAAGGG + Intergenic
941918975 2:170830487-170830509 GCCAAGGACCACCCTCCTCAGGG + Intronic
942606540 2:177697892-177697914 GCTGAGAACCACTGTTCTAATGG - Intronic
944964348 2:204913431-204913453 GCTTAGAACCACAGTTCTCATGG + Intronic
946386261 2:219386223-219386245 ACTGACTGCCACACTCCTCAGGG - Intronic
946974853 2:225137022-225137044 GCTGACCACCATATTCCTCAAGG + Intergenic
947972250 2:234333940-234333962 GCTGAGTCACACACTCCACAGGG + Intergenic
1170467128 20:16632413-16632435 GCTGAGCCCCACACCCTTCATGG + Intergenic
1170979253 20:21195797-21195819 ACTGGGACACACACTCCTCAGGG + Intronic
1171091064 20:22286136-22286158 CCTGAGAAAGACACGCCTCAGGG + Intergenic
1172153923 20:32810493-32810515 GCTGAGAATCACACTCCAAAGGG - Intergenic
1174432058 20:50477483-50477505 GCATAGAACCTCCCTCCTCAAGG - Intergenic
1175543054 20:59760172-59760194 CCTGACACCCACACTCATCATGG - Intronic
1177972312 21:27805732-27805754 GATGAGACCCACACTTCTGAGGG + Intergenic
1179432009 21:41328104-41328126 GCTGAGAACAGCACTGCCCACGG + Intronic
1181504902 22:23346896-23346918 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1181709890 22:24677143-24677165 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1182221870 22:28765050-28765072 TCTGACAACCCCACCCCTCATGG + Intergenic
1182717227 22:32366995-32367017 GCACATAACCACACTCCACAAGG + Intronic
1183079813 22:35449160-35449182 CCTGAGAAGCAGACGCCTCAGGG - Intergenic
1184229082 22:43148710-43148732 TCTGAGCACCCTACTCCTCAGGG + Intergenic
1184606776 22:45578916-45578938 GCTGAGATGCAAAGTCCTCAGGG - Intronic
1184925536 22:47633981-47634003 GCTGAGAAAGACACTTTTCATGG + Intergenic
951502819 3:23409023-23409045 GATGAGAACCACCCTTGTCATGG - Intronic
951770087 3:26245434-26245456 GCTGAGAAATATACCCCTCAGGG - Intergenic
952305138 3:32138706-32138728 GCTGGGAATCACCCTCATCAAGG + Exonic
954131694 3:48564352-48564374 GCTGAGACCCCGACTCCTCCAGG + Exonic
954816299 3:53283896-53283918 GCTGAAAAACAGGCTCCTCAAGG + Exonic
954837410 3:53481724-53481746 GCTGAGAACTACTGTTCTCATGG + Intergenic
956751661 3:72348339-72348361 GCGGAGATCAAGACTCCTCAAGG + Intergenic
959708838 3:109364196-109364218 GGTGAGAGCCACACACCTCTTGG + Intergenic
961752996 3:129108199-129108221 GCTTTAATCCACACTCCTCAGGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
966865645 3:184257873-184257895 TCAGAGAGCCACACTCCTGAGGG - Intronic
968217152 3:196902628-196902650 TCTGAGAACCACAGTGCTAAGGG + Intronic
968578283 4:1377986-1378008 GTTGAGGGCCACACTCCTCCTGG + Intronic
969869189 4:10094274-10094296 GCTGTGAGCCACACTCCAGAGGG + Intronic
974914349 4:68161365-68161387 GCTGAGAACAGCACTCCACAGGG + Intergenic
978146283 4:105375944-105375966 GCTTAGAACCACACTCTTAGAGG - Intronic
979483002 4:121239524-121239546 ACTCAGAACCACCTTCCTCAGGG - Intergenic
982778224 4:159464011-159464033 GCAGAGAACCACCTTGCTCAAGG - Intergenic
985010922 4:185581206-185581228 GCTGAGAGTCACAGTCCTAATGG - Intergenic
985479067 5:95904-95926 GGTGATGACCCCACTCCTCAAGG + Intergenic
985574781 5:669088-669110 GCTCAGACCCTCACGCCTCATGG + Intronic
996388999 5:122939878-122939900 GCTTAGAACCACACATCTCAAGG + Intronic
998334642 5:141360676-141360698 GCTGAGAAACAGACTCCAGATGG + Exonic
1001055326 5:168444693-168444715 GCTGAGAACCCCTCTCCTCATGG + Intronic
1001330688 5:170760321-170760343 CCAGAGAACCACACTCAACAGGG + Intergenic
1001473816 5:172035182-172035204 GCTGAGACCCACCCATCTCAGGG + Intergenic
1002908714 6:1471846-1471868 GCTGAGAGGCACAGTCCTGAAGG - Intergenic
1003283136 6:4711533-4711555 GCACAGAACCACAGCCCTCAGGG + Intronic
1006021509 6:31120565-31120587 GCTGATTACCACGCTCCTCCCGG - Intronic
1013373515 6:109491277-109491299 CCTGAGAACCACTCCCCTCCAGG - Intergenic
1014302474 6:119699764-119699786 TCTGAGAACCACACAGCCCAGGG - Intergenic
1017239084 6:152147365-152147387 GCTGGGATCCTCCCTCCTCAGGG - Intronic
1018914986 6:168127656-168127678 CCTGTGCACCACACTCATCAGGG + Intergenic
1019269674 7:139952-139974 GCTCAGAATCCCCCTCCTCATGG - Intergenic
1019707203 7:2502378-2502400 GCTGGGACCCCCACTCCCCATGG - Intergenic
1032813312 7:135444738-135444760 GCTGCGACCCTCACTCTTCATGG + Intronic
1034686948 7:152980584-152980606 GCTGGGATACACTCTCCTCAGGG - Intergenic
1038817861 8:30924090-30924112 GCTGAGCACCACTCTCCACGAGG - Intergenic
1039691032 8:39864944-39864966 GCTGAGCAGAGCACTCCTCAAGG - Intergenic
1042663136 8:71177866-71177888 GCAGAGACCCACACTCCAGAAGG + Intergenic
1042681135 8:71385897-71385919 AATGAGAACCACACCACTCATGG - Intergenic
1043347096 8:79310978-79311000 GCTGAAAACATCAGTCCTCAAGG + Intergenic
1045208864 8:100073911-100073933 GCTGAAAACAAAACTCTTCATGG + Intronic
1048817046 8:138343808-138343830 GCAGAGAGCCAGAGTCCTCAGGG - Intronic
1049015714 8:139918602-139918624 GCTGAGAACAGCACTGCTCGGGG - Intronic
1050303385 9:4282391-4282413 GCTGAGAACCACCCACATTAGGG - Intronic
1055151684 9:73008269-73008291 GCTGAGATCCACACAGCTCAGGG + Intronic
1058562341 9:106243275-106243297 AGTGAGAACCACAGTCCTAAGGG - Intergenic
1059313246 9:113402774-113402796 GCTAATAACCACACTCCATAGGG + Intergenic
1186588951 X:10908332-10908354 GCTGGGAACCACAGACCCCATGG - Intergenic
1195020927 X:100827518-100827540 GTTGAGTACAACACTACTCATGG + Intronic
1198937805 X:141916998-141917020 GCAGAGAACCCCAATCCTCAGGG + Intergenic
1198961246 X:142185866-142185888 GCAGAGAACCCCAATCCTCAGGG - Intergenic
1198978402 X:142363713-142363735 GATGAGAAACACAGGCCTCACGG + Intergenic
1201514980 Y:14810093-14810115 GATGAGAACCACAGTCCTCCAGG - Intronic