ID: 929617193

View in Genome Browser
Species Human (GRCh38)
Location 2:43320895-43320917
Sequence TTTTAAGTATAGAAATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 615}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929617193 Original CRISPR TTTTAAGTATAGAAATTTGG GGG Intronic
901353321 1:8618837-8618859 TTTTAAGAAAATAAATTTGGTGG + Intronic
902214919 1:14928503-14928525 TTTTAAGGATAAAAATTTAAAGG - Intronic
902509371 1:16957745-16957767 TTTTAATTAAAAAAATTTGGGGG - Intronic
906221608 1:44084489-44084511 TTTTAAATTTAAAAATTTTGAGG - Intergenic
906883253 1:49616251-49616273 TTATAGGTTTAGAAATGTGGAGG - Intronic
907044412 1:51291185-51291207 TTTTAGTTAAAAAAATTTGGGGG + Intronic
907817472 1:57934231-57934253 TTTTAATTTTAGCCATTTGGTGG + Intronic
908083209 1:60602853-60602875 TTTTAATTTAAGAACTTTGGGGG - Intergenic
908162866 1:61428293-61428315 TTTTAAGAATTGAATTTTTGTGG - Intronic
908753871 1:67449847-67449869 TTTTAAAAATTGAAAGTTGGTGG - Intergenic
908859032 1:68462490-68462512 TTTTAAGTCTCTAAATTTTGGGG + Intergenic
908900518 1:68951182-68951204 GTTTCAGTGTAGAAATTTAGGGG - Intergenic
908905708 1:69006340-69006362 TTTTCAACATAGCAATTTGGGGG + Intergenic
909050003 1:70755049-70755071 TTTTTAGTCTAGTGATTTGGGGG - Intergenic
909350599 1:74648701-74648723 TTAGAAGAATAGAAATTTTGTGG + Intronic
909668982 1:78167001-78167023 TATCAAGTATAGCAATTTGTAGG - Intergenic
909732987 1:78919195-78919217 TTCTAAGAATGGAAATATGGAGG + Intronic
910752266 1:90644847-90644869 TTTTAAATATAGTAATCTAGGGG + Intergenic
910774160 1:90858326-90858348 TTTTAAGTATAGAAAGATGAAGG + Intergenic
911040307 1:93585898-93585920 TTTTAAATATAAAAATTAGCTGG - Intronic
911114736 1:94235961-94235983 TAGTAAGTATAGATGTTTGGGGG - Intronic
911162199 1:94692301-94692323 TTTTAGGGATAGAAAATAGGTGG - Intergenic
911238239 1:95435582-95435604 GTTTCAGTATATGAATTTGGAGG - Intergenic
911412283 1:97524779-97524801 AGTTAGGGATAGAAATTTGGGGG - Intronic
911505228 1:98740837-98740859 TCTTAAATGTATAAATTTGGAGG + Intronic
912033557 1:105281829-105281851 TTATAAGAAGAGAAAATTGGAGG - Intergenic
912541762 1:110421519-110421541 TTTTATGGATATCAATTTGGTGG - Intergenic
912813110 1:112808803-112808825 TTTTAAGTCAAGACATTTTGGGG + Intergenic
912852074 1:113135436-113135458 TTTGATGTATTGAATTTTGGAGG - Intergenic
913647564 1:120873715-120873737 ATTTCAATATACAAATTTGGGGG - Intergenic
914079074 1:144389145-144389167 ATTTCAATATACAAATTTGGGGG + Intergenic
914100105 1:144577357-144577379 ATTTCAATATACAAATTTGGGGG - Intergenic
914173978 1:145257692-145257714 ATTTCAATATACAAATTTGGGGG + Intergenic
914298884 1:146360325-146360347 ATTTCAATATACAAATTTGGGGG + Intergenic
914528639 1:148498877-148498899 ATTTCAATATACAAATTTGGGGG + Intergenic
914637753 1:149568230-149568252 ATTTCAATATACAAATTTGGGGG - Intergenic
915152289 1:153843573-153843595 TTTTAAATATAAAAAATTGAAGG - Intronic
915555931 1:156660832-156660854 TTTCAAGTTTAGAAATAGGGTGG - Intergenic
916095723 1:161348052-161348074 TTTTAACTATAGAGATTTTATGG + Intronic
916153628 1:161822105-161822127 TTTTAAGTATAGGAAGTTTGTGG + Intronic
916216294 1:162397898-162397920 TTTTTATTCTATAAATTTGGGGG + Intronic
917253325 1:173087068-173087090 TCTCAAGTAGAGTAATTTGGTGG - Intergenic
917506218 1:175629490-175629512 TTTTCTGTATAGAGATGTGGGGG + Intronic
917939836 1:179907551-179907573 TTTGAAGTTTAGAAATGAGGGGG + Intronic
918334427 1:183494330-183494352 TTTTAAGTTTCAAAATTTAGGGG + Intronic
919024128 1:192146528-192146550 GTTTCAGTATATGAATTTGGGGG - Intergenic
919034706 1:192292107-192292129 TTATAAGTATATAAATATGTAGG + Intergenic
919179935 1:194067727-194067749 TTTGAAGGAGAGAAATGTGGTGG + Intergenic
919294600 1:195679936-195679958 TCTTAAGACAAGAAATTTGGGGG + Intergenic
919300762 1:195762552-195762574 TTTTATGTATAGAATTTTTTTGG - Intergenic
919416665 1:197319164-197319186 CTTTAAAAATAGAAGTTTGGGGG + Intronic
919699389 1:200615948-200615970 TCTTTATTATACAAATTTGGGGG + Intronic
921627203 1:217389929-217389951 TTTTAAATGTGGAAATCTGGTGG - Intergenic
922139232 1:222865621-222865643 TTTTAAGTGTAGACATTTAAAGG + Intergenic
922279784 1:224112939-224112961 TTTACAATAGAGAAATTTGGTGG - Intergenic
922559285 1:226556860-226556882 TTCTAATTATATAAATTTGTGGG + Intronic
922818362 1:228467373-228467395 TTTTCAACCTAGAAATTTGGAGG - Intergenic
923382588 1:233436441-233436463 CTTTTAGAATAGAAATTTAGGGG - Intergenic
923610029 1:235482863-235482885 TTTTATGTCTAGTATTTTGGGGG - Intronic
923623710 1:235597403-235597425 ATTTCAATATAGGAATTTGGGGG - Intronic
923707786 1:236359253-236359275 TTTTTAATATAGGAATTTGGGGG - Intronic
924122127 1:240811668-240811690 TTTTAACTATACAAATTTGGTGG - Intronic
924445890 1:244130309-244130331 TTTGAAGTATATATATGTGGTGG + Intergenic
924485716 1:244481630-244481652 GTTTCAGCATAAAAATTTGGGGG - Intronic
924849681 1:247813941-247813963 TTTTAATTATAGTTATTTTGAGG - Intergenic
924906645 1:248460933-248460955 TTATAACTTTAGTAATTTGGAGG - Intergenic
1063780653 10:9318851-9318873 TTTTAAGTATAGTTATTTGGAGG - Intergenic
1064858887 10:19803129-19803151 TTTTAAGTGTAGAATTTAAGTGG - Intergenic
1065487729 10:26250844-26250866 TTCTAAGCACAGAAATTTGTTGG + Intronic
1065801189 10:29354239-29354261 GTTTCAGTATATGAATTTGGGGG - Intergenic
1066003177 10:31123615-31123637 TTATACATATAAAAATTTGGAGG - Intergenic
1066392966 10:34993630-34993652 ATTTAAGTATATAAATTTAAGGG + Intergenic
1066553913 10:36590173-36590195 TTTTAAAAATTGACATTTGGGGG + Intergenic
1066573835 10:36803211-36803233 TTTTATTTGCAGAAATTTGGAGG - Intergenic
1067193231 10:44090215-44090237 TTATAGGAAAAGAAATTTGGCGG - Intergenic
1067321123 10:45222263-45222285 TTATCAGTAAAGAAATATGGAGG + Intergenic
1067936749 10:50619358-50619380 TTTTTATTATGGAAATTTGCAGG - Intronic
1068414383 10:56698583-56698605 TATTATGTATTGAAATTAGGTGG + Intergenic
1069214183 10:65798760-65798782 ATTCAAGCATAGAACTTTGGTGG - Intergenic
1069960345 10:72075574-72075596 ATTTATGATTAGAAATTTGGGGG + Intronic
1070235734 10:74623320-74623342 CTTTAAATATATAAATTTTGAGG - Intronic
1071239433 10:83688257-83688279 GTTGAAGTCTAGAAAGTTGGAGG + Intergenic
1071427147 10:85570678-85570700 CTCTAAGTATAGAAATTATGGGG - Intergenic
1072047123 10:91667939-91667961 TTTTAATAATAGAAAATTTGGGG + Intergenic
1072571915 10:96665841-96665863 CTTTAAATAGAGAAATGTGGTGG + Intronic
1073695863 10:105866667-105866689 GTTTCAGCATAAAAATTTGGGGG + Intergenic
1074557555 10:114505830-114505852 TTTTAAGAATAGAAATACTGAGG - Intronic
1074606292 10:114971254-114971276 ATTTCAGCATATAAATTTGGAGG + Intronic
1074717291 10:116231392-116231414 TTTTAATTATAACATTTTGGAGG - Intronic
1075138111 10:119805116-119805138 ACCTAAGTATTGAAATTTGGTGG + Intronic
1075367472 10:121905330-121905352 TTTTCAGTATAGAAAATGGAAGG - Intronic
1077845847 11:6024017-6024039 TTCTAAGTATAGAGGTTTAGAGG - Intergenic
1077963326 11:7098816-7098838 TTTTAAGTGTACAAGTTTAGTGG + Intergenic
1078882726 11:15467885-15467907 TTTTAACTATTGGAATTTAGTGG - Intergenic
1079771876 11:24472784-24472806 AATTAAAAATAGAAATTTGGAGG + Intergenic
1080222713 11:29924529-29924551 TTTTAAGCCAAGAAGTTTGGAGG + Intergenic
1080378295 11:31740736-31740758 TTTTAATAAAACAAATTTGGGGG + Intronic
1081151369 11:39636804-39636826 TTTAAAATATAGAACTTAGGAGG - Intergenic
1082070339 11:47934534-47934556 TTTTCAGAATATAAATTAGGAGG + Intergenic
1082264062 11:50100566-50100588 TTTTAAGGAAAGAAAGTTTGGGG - Intergenic
1083461595 11:62816567-62816589 TTTTTACTATGAAAATTTGGGGG - Intronic
1084630169 11:70342779-70342801 TATTAAGTATACATATTTTGGGG + Intronic
1084870671 11:72096665-72096687 TTTTCAGCTTAGAGATTTGGGGG + Intronic
1085378594 11:76091287-76091309 TTTTATTTTTAGAAATTTGTAGG + Intronic
1085679823 11:78562855-78562877 ATTAAAATATAGAAATGTGGGGG - Intronic
1086139941 11:83486140-83486162 TTTTAACTAGGAAAATTTGGGGG - Intronic
1086236072 11:84632325-84632347 TTTTAAATATATTATTTTGGAGG - Intronic
1086613454 11:88785504-88785526 TTTTAACTATAGATGTTTTGAGG - Intronic
1087143052 11:94785225-94785247 TTTTAATCTAAGAAATTTGGTGG + Intronic
1087358060 11:97121043-97121065 TTAGAAGTATAGAAATTGGCCGG + Intergenic
1087404003 11:97706151-97706173 TTTTAAGTTTATGAATTTGCTGG + Intergenic
1087515795 11:99159324-99159346 TTTAAAGTATAGTAATCTGCCGG + Intronic
1087745739 11:101944253-101944275 TTTTAAATATAGAGCTTTTGAGG + Exonic
1087827343 11:102780768-102780790 TTTCAAGTTTAGAAAGTTGAAGG - Intergenic
1088238253 11:107748048-107748070 CTTTAGGTTTAGAAGTTTGGTGG + Intergenic
1088364363 11:109023415-109023437 TGTTGAGTACACAAATTTGGGGG + Intergenic
1090045097 11:123324578-123324600 ATTTGAGTATAGAAATTTGGGGG - Intergenic
1090148324 11:124352753-124352775 TCCTAAGTATACAAATTTGGGGG + Intergenic
1090283559 11:125479550-125479572 ATTTTAGCATATAAATTTGGGGG - Intronic
1091637191 12:2206010-2206032 ATTTCAGCATAGGAATTTGGGGG + Intronic
1092055026 12:5501634-5501656 TTTTAAGAAGATAATTTTGGTGG + Intronic
1092673862 12:10894161-10894183 TTTTAAGTAAGCAAAATTGGAGG - Intronic
1092982975 12:13816421-13816443 TTTTAAGTATGGGAAAATGGGGG - Intronic
1093207405 12:16267569-16267591 TTTTTAATTTAAAAATTTGGGGG + Intronic
1093439244 12:19173883-19173905 TTTTAAGTATTGGAATTAGGAGG + Intronic
1093511705 12:19936690-19936712 TTTTAAGTCTCTAGATTTGGGGG + Intergenic
1093600324 12:21013695-21013717 GTTTCAGCATAAAAATTTGGGGG + Intergenic
1094155914 12:27336633-27336655 TTTTAAGTTAAAAAATTGGGTGG - Intronic
1094244275 12:28269649-28269671 TTTAAAGTTTAGAAATGTGTAGG + Intronic
1095715427 12:45341090-45341112 TTTTAAGTATTTATAGTTGGTGG + Intronic
1096365129 12:51022646-51022668 TTTTAGGAAAAGAAACTTGGAGG - Intronic
1097095310 12:56543025-56543047 TTTTCAAAAAAGAAATTTGGAGG - Intronic
1097272603 12:57786454-57786476 GTTTAAGTATAGAAATGTACTGG + Intronic
1097746156 12:63305652-63305674 TTTTAAGTCTTCAACTTTGGAGG - Intergenic
1097793445 12:63839369-63839391 TTCTACATATGGAAATTTGGGGG + Intergenic
1098097860 12:66979204-66979226 TTTTAAGAAGAGAAGTTTTGTGG - Intergenic
1098551923 12:71772042-71772064 TTTTAAGTCAAAAATTTTGGGGG - Intronic
1098584005 12:72134761-72134783 TTCAAAGTAGGGAAATTTGGGGG + Intronic
1098608332 12:72422136-72422158 TTTTATCTATAGAAATGTAGTGG + Intronic
1098854133 12:75633215-75633237 ATTTAAACATAAAAATTTGGGGG - Intergenic
1099137227 12:78921073-78921095 TTTTAATTTTAGTTATTTGGTGG - Intronic
1099142865 12:79000906-79000928 TTCTAAGTAGCGATATTTGGGGG - Intronic
1099170938 12:79363191-79363213 TTTTAAAAATAGGAATTTGTGGG - Intronic
1100507915 12:95238540-95238562 TTTTTAGCATATAAATATGGTGG - Intronic
1101245112 12:102877673-102877695 TTTGAACGATAGTAATTTGGGGG - Intronic
1101477133 12:105061466-105061488 GTTTAAGCATATGAATTTGGAGG + Intronic
1101895286 12:108751873-108751895 TTTTAATTATGGAAATTTTCAGG + Intergenic
1102306388 12:111807848-111807870 TTTTAAGTAGAAGAATTAGGTGG + Intronic
1102720959 12:115015523-115015545 TTTTAGTTATGGAACTTTGGGGG - Intergenic
1103100273 12:118168808-118168830 TTCTAATAATAGATATTTGGAGG - Intronic
1104027585 12:125039661-125039683 TTTTAAGTATAGAAAAATCATGG + Intergenic
1104455045 12:128904033-128904055 TTTTAATTAAAGAAATTTTCAGG + Intronic
1105612806 13:21983999-21984021 ATTTAAGAAAACAAATTTGGAGG - Intergenic
1105686757 13:22791374-22791396 TTTTAAATATAGTCATTTAGTGG - Intergenic
1106254307 13:28008787-28008809 ATTTTGGTATATAAATTTGGGGG + Intronic
1106385214 13:29277963-29277985 TGTTAAGTACTGAAATTTTGGGG + Intronic
1108017494 13:46091183-46091205 ATTTTGGTATAGATATTTGGGGG + Intronic
1108621045 13:52184062-52184084 TTTGAAGTATAGAAAAATGCAGG + Intergenic
1109046402 13:57417960-57417982 TTACAAGTATTGATATTTGGAGG - Intergenic
1109099236 13:58159389-58159411 TTTTAGGCATTGAAATTTTGGGG + Intergenic
1109204375 13:59465447-59465469 TTTAATGTGCAGAAATTTGGGGG - Intergenic
1109509912 13:63357388-63357410 TTATAAATATAGAAATTTAATGG + Intergenic
1109734553 13:66465300-66465322 ATTTACATATAGAAATTTTGAGG + Intronic
1110112391 13:71764533-71764555 TTTTTAATTTAGAAATTTTGTGG - Intronic
1110477327 13:75931607-75931629 CCTTAAGTATATAAACTTGGTGG - Intergenic
1110692577 13:78448527-78448549 TTTTAAGTATATGAAACTGGAGG + Intergenic
1110797334 13:79655108-79655130 TTTCAAGTAAAGAAAATTTGAGG - Intergenic
1111211971 13:85091269-85091291 GTTTAAACATATAAATTTGGGGG - Intergenic
1111258475 13:85704014-85704036 ATTTCAATATACAAATTTGGGGG - Intergenic
1111706114 13:91751168-91751190 TTGTAAAGACAGAAATTTGGGGG - Intronic
1112131845 13:96533294-96533316 TTTTAAGTAAATAAATGTGGAGG - Intronic
1113104731 13:106759690-106759712 TATTAAGTCCAGAAATTTGTTGG + Intergenic
1113262491 13:108580278-108580300 TTTTAAGCATAGAAATCTCAAGG - Intergenic
1115016225 14:28617519-28617541 TTGTAAGTAAAGGAAGTTGGTGG + Intergenic
1115454738 14:33589085-33589107 TTTTAAGTACACAATTTTTGGGG - Intronic
1115795918 14:36935514-36935536 TGATAAGTATAGACATTAGGTGG - Intronic
1116392485 14:44409550-44409572 TATAAAGTATGTAAATTTGGGGG - Intergenic
1117249265 14:53919104-53919126 TTTTAGTTAGAGTAATTTGGTGG - Intergenic
1117338418 14:54774354-54774376 TTTTAATTATAGTTATTTGCTGG + Intronic
1117471998 14:56055876-56055898 TTTTTAATATACAAATCTGGAGG - Intergenic
1117705028 14:58456876-58456898 TTATAAAGATAGAAATTAGGAGG + Intronic
1117870212 14:60192654-60192676 TTTTAAGTTTTTAATTTTGGGGG + Intergenic
1118100276 14:62591808-62591830 TTTTAAGTAAATAAAATTTGAGG + Intergenic
1118506834 14:66422762-66422784 TGTTTAGTATGGCAATTTGGAGG - Intergenic
1119458528 14:74778237-74778259 ATTTAAATGTATAAATTTGGGGG + Intronic
1120068262 14:80071470-80071492 TTTAAAATATGGAAATTTGGGGG + Intergenic
1120323823 14:83000263-83000285 TTTTACAAATAGAAATTTTGTGG - Intergenic
1120438448 14:84506224-84506246 TTTTAAATCAAAAAATTTGGGGG + Intergenic
1120579771 14:86231414-86231436 TTTCAAATATAGAAGTTTGAGGG - Intergenic
1120728644 14:87977015-87977037 GTTTAACCATAGAAATATGGGGG + Intronic
1123634312 15:22288343-22288365 TTTTAAGAAAATAAATTTGGTGG - Intergenic
1124703572 15:31939677-31939699 TTTTAATTACAGTAATGTGGGGG + Intergenic
1124889536 15:33719531-33719553 TTTTAAATATAAAAAAATGGAGG - Intronic
1125013084 15:34901560-34901582 TCTCACATATAGAAATTTGGAGG + Intronic
1125187894 15:36953108-36953130 TTTTAATTTTAGAAATATAGTGG - Intronic
1125203229 15:37121153-37121175 TTTCAAGTATTGATATTTGCTGG + Intergenic
1125214756 15:37258722-37258744 TTTTAATTAAAAAAATTTTGTGG - Intergenic
1125267091 15:37894934-37894956 TTTTAAGTTTTCAAATTTGAAGG + Intergenic
1125808180 15:42513018-42513040 ACTTAAGTATAGAAATTTATAGG + Intronic
1127218918 15:56856437-56856459 TTTAAAGTAGTTAAATTTGGTGG - Intronic
1129543297 15:76369412-76369434 TCTTAAGTATAGAAGTGAGGTGG + Intronic
1130408811 15:83627065-83627087 CTTTACCTATAGAAATGTGGTGG + Intergenic
1130694497 15:86117117-86117139 TTTTACATAAAGAAATCTGGAGG + Intergenic
1131562956 15:93460124-93460146 TTTTAAGGAAAGAAAATAGGTGG + Intergenic
1132226404 15:100145324-100145346 TTAAAAGTCTAAAAATTTGGAGG - Intronic
1133178734 16:4036333-4036355 TTTTATTTATACAAACTTGGAGG + Intronic
1133515325 16:6503248-6503270 AGATAAGTATAGATATTTGGGGG - Intronic
1133641694 16:7723387-7723409 TTTTAAGCTTTTAAATTTGGAGG - Intergenic
1133974523 16:10591153-10591175 TTTTAAGCATGGAAAGTGGGTGG + Intergenic
1134893668 16:17864435-17864457 TTTTATGTATGGAAATTCTGAGG + Intergenic
1135304703 16:21358083-21358105 TTGTAAGGATTGAAATTTGCAGG + Intergenic
1135474895 16:22765262-22765284 TTTAAAGTCTCCAAATTTGGAGG - Intergenic
1136301446 16:29337210-29337232 TTGTAAGGATTGAAATTTGCAGG + Intergenic
1137999387 16:53259066-53259088 TTTTAAGAAGAAAAATTTAGGGG + Intronic
1138127358 16:54449712-54449734 TTTTAAATATTGAAATTTCAAGG - Intergenic
1138177319 16:54912552-54912574 TTTTAAATATATCACTTTGGTGG - Intergenic
1138320125 16:56104664-56104686 ATTTCAGCATATAAATTTGGAGG - Intergenic
1138936749 16:61735772-61735794 CTTTAGGTATAGAAAGGTGGAGG + Intronic
1139492243 16:67292488-67292510 TTTTAAGTTGAGAACTTTTGGGG + Intronic
1139944787 16:70632896-70632918 TTTTAACAATAGAAAATTGCTGG - Intronic
1140148387 16:72335333-72335355 TATTAAGTCTAGAAATTAGATGG + Intergenic
1141026977 16:80558012-80558034 TTATAAGTATAGACAGTGGGAGG - Intergenic
1141708878 16:85686162-85686184 TTTAAAGTATACAAGTTTTGAGG + Intronic
1142063145 16:88043908-88043930 TTGTAAGGATTGAAATTTGCAGG + Intronic
1142225680 16:88876513-88876535 TTTTCAGCAAAGAATTTTGGGGG - Exonic
1144157348 17:12518752-12518774 TTTTACTTCTAGAAACTTGGGGG - Intergenic
1145221063 17:21088907-21088929 TTTTAATTTTAGCAATTTTGAGG - Intergenic
1147772742 17:42879055-42879077 TTTTGTTTAAAGAAATTTGGAGG + Intergenic
1147984961 17:44300646-44300668 TTTTAAGAATAAAGGTTTGGGGG + Intergenic
1149563349 17:57625168-57625190 ATTTCAACATAGAAATTTGGGGG + Intronic
1150159479 17:62883734-62883756 ATTTCAATATATAAATTTGGAGG - Intergenic
1150662966 17:67101434-67101456 TTTTAAGTTTTGAGATTTTGTGG - Intronic
1151152572 17:72100437-72100459 TTTCAGGTACAGAAAGTTGGGGG + Intergenic
1151356815 17:73563688-73563710 TTTTAGGTATACATATTTTGGGG + Intronic
1152601154 17:81262903-81262925 TTTTAAGCTCAGAAAGTTGGGGG - Intronic
1153073787 18:1138088-1138110 ATTTCAGTACACAAATTTGGGGG + Intergenic
1153608709 18:6860138-6860160 TTTTATGTGTATCAATTTGGAGG + Intronic
1154246017 18:12699712-12699734 TTTTAAGTATTTTATTTTGGGGG + Intronic
1155281561 18:24245907-24245929 ATTTAAGAATAAAAATTTAGGGG + Intronic
1155303996 18:24461043-24461065 GTTTAAGTATTAAATTTTGGAGG + Intronic
1155607759 18:27627005-27627027 TTTACAGTAGAGAAATCTGGTGG - Intergenic
1155866089 18:30966676-30966698 TTTTAAGTGTATAGATTTAGGGG - Intergenic
1156085897 18:33402105-33402127 TATTCAGAATTGAAATTTGGGGG - Intronic
1156278478 18:35608010-35608032 TTTTAAAAATAGGGATTTGGGGG + Intronic
1156283771 18:35669715-35669737 TATTAAATATAGATATTTGCTGG - Intronic
1156816322 18:41315914-41315936 ATGTAAGTATAAAATTTTGGGGG + Intergenic
1156827295 18:41446623-41446645 TTTTAAGTGTACAAATTCAGTGG - Intergenic
1157062678 18:44311208-44311230 TTTAAAACTTAGAAATTTGGGGG + Intergenic
1157315937 18:46589724-46589746 ACTTCAGTATATAAATTTGGGGG - Intronic
1158083394 18:53621159-53621181 TTTTAATTAAAAAAATTTGTGGG + Intergenic
1158510483 18:58086003-58086025 TTTTAACCATTGAAACTTGGGGG + Intronic
1158599356 18:58843801-58843823 TTTTAATTATAGGGTTTTGGGGG - Intergenic
1159270355 18:66141418-66141440 GTTTCAGCATATAAATTTGGGGG - Intergenic
1161614502 19:5262549-5262571 ATTTAATTACAGAAGTTTGGGGG - Intronic
1161757802 19:6147233-6147255 TTTTGACTATTAAAATTTGGCGG + Intronic
1163927541 19:20360409-20360431 TTTTATTTATAACAATTTGGGGG + Intergenic
1164134648 19:22403134-22403156 TGTTAATTTTAGAAATTTAGTGG - Intronic
1164164167 19:22653648-22653670 TGTTAATTTTAGAAATTTAGTGG + Intronic
1164689383 19:30198804-30198826 TTTCAAGTAGAGAAACTTGGAGG + Intergenic
1165552329 19:36598004-36598026 TTTTAAGTATAGATATCTACAGG - Intronic
1165675670 19:37720339-37720361 TTTTAGGTAAGTAAATTTGGGGG + Intergenic
1167718494 19:51160448-51160470 TTTTATGCCTAAAAATTTGGGGG - Intergenic
925125486 2:1452717-1452739 TATTTTGTTTAGAAATTTGGAGG - Intronic
925497293 2:4466344-4466366 TATCATGTATTGAAATTTGGAGG + Intergenic
926450235 2:12994575-12994597 GTTTCAGTATATAAATTTTGGGG + Intergenic
926489332 2:13504531-13504553 TTATAAGTAATAAAATTTGGGGG - Intergenic
926982690 2:18587799-18587821 GTTTTAATATAGAAATTTGTTGG + Intronic
927046216 2:19281373-19281395 ATAAAAGTATAGAAATGTGGAGG - Intergenic
927359764 2:22219363-22219385 CTTTCAGTATATGAATTTGGGGG - Intergenic
928686309 2:33753509-33753531 AATTCAGTATAAAAATTTGGGGG + Intergenic
928693992 2:33830276-33830298 GTTTCAATATATAAATTTGGGGG - Intergenic
928990374 2:37226941-37226963 TGTTAAGTAGAGAGTTTTGGGGG - Intronic
929617193 2:43320895-43320917 TTTTAAGTATAGAAATTTGGGGG + Intronic
929723177 2:44393274-44393296 TTTTTTGTATAGAAGTTTTGTGG + Intronic
929839542 2:45443437-45443459 TTTTAATTTTAAAATTTTGGTGG + Intronic
930252951 2:49056037-49056059 TTTTAATTATTGCAATTAGGTGG - Intronic
930371549 2:50507796-50507818 TTTTAAGTATGGAAACATGCTGG + Intronic
930413189 2:51053129-51053151 TTTTCAGTTTAATAATTTGGTGG + Intergenic
930458434 2:51637256-51637278 ATTTAATTATAGAAATTTTTAGG - Intergenic
931379842 2:61742531-61742553 CTTTAAGTATTAAAATTTGGGGG + Intergenic
931491122 2:62748796-62748818 TTTTAAATACAGAAAATTGTAGG - Intronic
931672154 2:64656831-64656853 TTATAAGTATAGAACTGTGATGG + Intronic
931752862 2:65346385-65346407 TTTTAAGTATACAAGTTCAGTGG + Intronic
931766342 2:65459802-65459824 TTTTCAGAATAAAAATTGGGGGG - Intergenic
932037035 2:68255960-68255982 TTTTTAGAATGGAAAGTTGGAGG + Intronic
932112141 2:69011576-69011598 TTTTAAGTCTCTAAGTTTGGGGG - Intergenic
933200637 2:79444221-79444243 TTTTAAGCAAGTAAATTTGGGGG + Intronic
933371662 2:81422641-81422663 CTTTAAGTAAAGAATTTTGTAGG - Intergenic
933383131 2:81576538-81576560 TGTTAAAGATACAAATTTGGTGG + Intergenic
933434797 2:82235170-82235192 TTGTAAGTAGAGTAATTAGGTGG + Intergenic
933529294 2:83486258-83486280 CTTTGAGTAGAGAAATGTGGTGG - Intergenic
935537179 2:104308249-104308271 GTTTAAATATATGAATTTGGAGG + Intergenic
935864137 2:107366820-107366842 TTCTAACTATAGAAAGTTGCTGG - Intergenic
936377124 2:111950576-111950598 TCTTAAGTGTAGACATTTAGTGG + Intronic
936558612 2:113517314-113517336 TTTAAACCACAGAAATTTGGAGG - Intergenic
937403809 2:121609629-121609651 TTTTAAGGAGAGAAACTGGGTGG - Intronic
937699707 2:124850568-124850590 CTGTAATAATAGAAATTTGGAGG - Intronic
939043908 2:137226947-137226969 CTTTAAGCATAGTATTTTGGAGG - Intronic
940065256 2:149620522-149620544 TATCAAATAGAGAAATTTGGCGG + Intergenic
940161282 2:150716401-150716423 TTTGAAATATAGAAATTTTGGGG + Intergenic
940435121 2:153643567-153643589 TTTATAGTATGGAAATTTTGTGG - Intergenic
940596810 2:155805012-155805034 TTTTAAGAATAGAAAAATGAAGG + Intergenic
940786931 2:157991172-157991194 GTTTCAGTATACAAATTTTGGGG + Intronic
941296077 2:163739727-163739749 CTTTAAGGAAAGAAGTTTGGAGG + Intergenic
941372410 2:164681938-164681960 TATTAAGGATGGAAATTTGCAGG + Intronic
941502702 2:166299746-166299768 ATTTAAGTATAGAAATCAGAGGG - Intronic
941615847 2:167718464-167718486 TTTTAAGTGTAGAATAGTGGAGG + Intergenic
941703984 2:168637835-168637857 TTTTACAGGTAGAAATTTGGAGG + Intronic
941927366 2:170909464-170909486 TTTTAAGCATACAATTTTGTGGG + Intergenic
942409185 2:175689565-175689587 GTTTAAATATAGAATCTTGGTGG - Intergenic
942894852 2:181040126-181040148 ATTTAAGTATATAAATTTTTAGG - Intronic
943079423 2:183240041-183240063 CTGTAAGTATAGACATTGGGAGG - Intergenic
943267862 2:185758872-185758894 TAATAAGTTTTGAAATTTGGCGG + Intronic
943725695 2:191249218-191249240 TTTTAAGAAGAGAAATAAGGAGG + Intronic
944016980 2:195052383-195052405 GGTTAAGGTTAGAAATTTGGTGG - Intergenic
944878193 2:203984468-203984490 TTTTAAGTAAAGACATTTGTTGG + Intergenic
945006964 2:205418991-205419013 TTATAAGTATAGAAATATTTTGG - Intronic
945149505 2:206773777-206773799 TATTAAATATAGAAATTTTGGGG + Intronic
945336107 2:208594612-208594634 TTTTAAGTCTTGCAATGTGGTGG - Intronic
946680799 2:222213636-222213658 TTTTGATTAAAGAAATTTGTTGG - Intronic
946988261 2:225299449-225299471 TTTTAACCATAGAAATGCGGTGG + Intergenic
947058531 2:226135634-226135656 TGTTAAGTATAGTAAATTGTAGG - Intergenic
947557347 2:231106717-231106739 ATTTAAGCACACAAATTTGGAGG + Intronic
1168894629 20:1315083-1315105 TAATAAGTCTTGAAATTTGGTGG - Intronic
1169596098 20:7200732-7200754 TTTTAACTATTGAAATGTCGGGG + Intergenic
1169880335 20:10340813-10340835 TGTGAATTATAGACATTTGGGGG + Intergenic
1170057374 20:12221441-12221463 TTTTAAGTCTCCAAATTTTGGGG - Intergenic
1170326970 20:15167004-15167026 ATTTAAGTATTTAAATTTAGGGG + Intronic
1170455365 20:16527895-16527917 TTTCCAGAAAAGAAATTTGGTGG + Intronic
1174372242 20:50099227-50099249 ACTTAAGTATATAAATTTGAGGG - Intronic
1176639755 21:9290801-9290823 TTTTGAGTATAAATATTTAGGGG + Intergenic
1176921809 21:14696776-14696798 ATTTCAATATAGAAATTTAGGGG - Intergenic
1177190977 21:17850495-17850517 TTTTTAACATATAAATTTGGGGG + Intergenic
1177705407 21:24697977-24697999 TTTTAAATATAAGAACTTGGAGG + Intergenic
1178577402 21:33807130-33807152 TTTTAAGCAAAGAAATCTGTTGG - Intronic
1178764402 21:35435954-35435976 TTTTATATCTAGACATTTGGTGG - Intronic
1178886743 21:36490687-36490709 TTATAAGTAAAGAAATTTTTTGG - Intronic
1179265959 21:39803812-39803834 ATTTAAGTTTTGAAATCTGGAGG + Intergenic
1179601833 21:42484025-42484047 TTTTAATTATTGAAGTTTTGTGG + Intronic
1180117175 21:45716660-45716682 GTTTAAATATAGTGATTTGGGGG + Intronic
1180348766 22:11780177-11780199 TTTTGAGTATAAATATTTAGGGG + Intergenic
1180373052 22:12063631-12063653 TTTTGAGTATAAATATTTAGGGG + Intergenic
1180423801 22:12898268-12898290 TTTTGAGTATAAATATTTAGGGG + Intergenic
1181379928 22:22493915-22493937 GCTTCAGTATACAAATTTGGGGG - Intronic
1181912343 22:26248799-26248821 TTTTAAGGAAAGAAATTTCATGG + Intronic
1184186843 22:42870631-42870653 TTTTAAATATGGCGATTTGGGGG + Exonic
1184740565 22:46426600-46426622 ATTTCAATATAGCAATTTGGGGG + Intronic
949367588 3:3299949-3299971 TTCTAAGTATAGAAATTAAGTGG + Intergenic
950772709 3:15324799-15324821 TTTTGAGCTTAGAAACTTGGAGG - Intronic
951278148 3:20714666-20714688 TTTTAGGTATAGAAAACTTGGGG + Intergenic
951540841 3:23780423-23780445 TTTTAAGTCACTAAATTTGGGGG - Intergenic
951686032 3:25345844-25345866 TTTTAAGAAATGAATTTTGGAGG - Intronic
951733400 3:25836060-25836082 TTTTATTTAGAGAAATTAGGAGG + Intergenic
951959046 3:28294360-28294382 TGTTAAGTAGCAAAATTTGGGGG + Intronic
952467702 3:33608175-33608197 TTTTAAGAAGAGATATTTGTTGG - Intronic
953312915 3:41897462-41897484 TTTTTTGTATAGGGATTTGGAGG - Intronic
953519097 3:43624105-43624127 TGTTAAGTATAGCAAATTGTTGG + Intronic
955368376 3:58331060-58331082 TCTGAAGTGTAGAAATTTAGTGG + Intergenic
956390913 3:68771622-68771644 TTTTAATGAAATAAATTTGGAGG - Intronic
957100448 3:75820011-75820033 TTTTGAGTATAAATATTTAGGGG - Intergenic
957336968 3:78843132-78843154 TTTTAAAACTAGTAATTTGGGGG + Intronic
957341362 3:78901785-78901807 TTATTAGTATAGACATTTGATGG - Intronic
957435278 3:80167359-80167381 TTTTACCTATAGACATTTTGGGG + Intergenic
957438546 3:80211803-80211825 ATTTAAGCATTGAATTTTGGGGG + Intergenic
957787773 3:84904164-84904186 TGTTAATAATAGAAGTTTGGAGG - Intergenic
957949275 3:87104333-87104355 ATTTAATTACAGAAATGTGGAGG + Intergenic
958461098 3:94396931-94396953 CTTTCAGTATATGAATTTGGGGG - Intergenic
958972643 3:100629508-100629530 TTTTACGTGTAGAAATTAAGTGG + Intronic
959329836 3:104990004-104990026 ATTTAAAAATAGAAATATGGAGG + Intergenic
959332317 3:105021859-105021881 TTTTCAATACATAAATTTGGTGG - Intergenic
959764193 3:110004859-110004881 TCTTCAGGATAGCAATTTGGAGG + Intergenic
959928227 3:111949218-111949240 TATAAAGTATACCAATTTGGGGG + Intronic
960140246 3:114144870-114144892 TTTTAAGTATAGAATTGAGAAGG - Intronic
960360912 3:116710112-116710134 TTTTAAAATTAGAAATTTGTGGG - Intronic
960433610 3:117599494-117599516 CTTGAAGTAGAGATATTTGGAGG - Intergenic
960983597 3:123255704-123255726 TTTTAAGTCTAAAAATATGTAGG + Intronic
961025750 3:123555458-123555480 TTTTAACTTTAAAATTTTGGTGG - Intronic
962188795 3:133288729-133288751 TTTTACATATAATAATTTGGGGG + Intronic
962658191 3:137570992-137571014 GTTTAAATATAGTAGTTTGGGGG - Intergenic
962850325 3:139303592-139303614 ACTTCAGTATAGGAATTTGGGGG + Intronic
963369629 3:144382366-144382388 TTTTCAATATAAAAATTTGGAGG - Intergenic
963469860 3:145726737-145726759 TTTTAAATAATGAATTTTGGAGG - Intergenic
963534039 3:146505251-146505273 TGTTAAGTATTGAAGTTTTGTGG - Intergenic
963686883 3:148446801-148446823 TTTTAAGTATGAATATTTAGGGG + Intergenic
963782550 3:149501379-149501401 TTTTCAAAATAGAAAGTTGGAGG - Intronic
963877693 3:150494955-150494977 TTGTAACTTTAGAAATTTGGGGG - Intergenic
964106282 3:153043466-153043488 TTAAAAGTATAAAAATTTGCTGG - Intergenic
964298042 3:155255465-155255487 TTTTAAGTCGAGTAAATTGGAGG + Intergenic
964811888 3:160673790-160673812 TTTTAATTGTTGAAATATGGAGG + Intergenic
965094571 3:164208505-164208527 TTTTAACCATAGAAAATTGGGGG - Intergenic
965239011 3:166169656-166169678 TCTAAAGTTTATAAATTTGGGGG + Intergenic
965328035 3:167332062-167332084 TTTTAAAAATCCAAATTTGGTGG + Intronic
965381853 3:167999472-167999494 TTTTAATTATAGCAATTTCTTGG + Intergenic
965853356 3:173058020-173058042 TTTTAATAATAGAATTTTGAGGG - Intronic
966001078 3:174949179-174949201 ATTTCAGCATAGGAATTTGGGGG + Intronic
966106148 3:176336483-176336505 AAATCAGTATAGAAATTTGGTGG - Intergenic
966292659 3:178378425-178378447 TTTTTTGTATGGAAATTTTGAGG + Intergenic
966478589 3:180379055-180379077 ATGTAAGAATAGAATTTTGGGGG + Intergenic
967193914 3:187010316-187010338 TTTTTAGTCTATTAATTTGGTGG + Intronic
967584421 3:191194666-191194688 TTTAAAGTATAAAAATTAGCTGG + Intergenic
967685657 3:192412721-192412743 TTTTATATATAGAAATTCGTAGG + Intronic
967802703 3:193681592-193681614 TTTTAACAATAGAAGTTTTGTGG + Intronic
967909735 3:194532146-194532168 TTGTAAGTGTGCAAATTTGGGGG + Intergenic
1202747139 3_GL000221v1_random:114228-114250 TTTTGAGTATAAATATTTAGGGG - Intergenic
968859268 4:3153302-3153324 GTTTCAGTGTATAAATTTGGGGG + Intronic
969407586 4:7004226-7004248 TTCTAAATATGGAGATTTGGAGG + Intronic
970349722 4:15189964-15189986 TTTTAAGTTTGGAAATATGGAGG - Intergenic
970686860 4:18578216-18578238 GTTAAAGTACTGAAATTTGGGGG + Intergenic
970833914 4:20377404-20377426 TTCTAAGTATATAAAATGGGAGG + Intronic
970904277 4:21197495-21197517 TTTTCAATATTGAAATTTAGAGG + Intronic
971010079 4:22424525-22424547 TTTCAAGTATAGCCATTTGGTGG + Intronic
971569380 4:28191315-28191337 TTTTAAATATAGTAATTTATTGG + Intergenic
971653323 4:29308235-29308257 TTTTAAATATTGTAATTTGTTGG + Intergenic
971754715 4:30692573-30692595 TTTTAATTATAAAAATATGTTGG + Intergenic
971786001 4:31103622-31103644 TTTTAAAGACAGAAATTGGGAGG - Intronic
972036497 4:34529095-34529117 TTTAAAGTATTAAAATTTGGTGG + Intergenic
972640199 4:40918417-40918439 TTTTAAGTTAAAAGATTTGGGGG + Intronic
973183181 4:47293074-47293096 TTTTACCTATACAAATTTGGGGG + Intronic
973296184 4:48523265-48523287 TTTTAAATATAAATATTTGATGG - Intronic
973630169 4:52812906-52812928 TTTTCAGTTTAGAATTTTAGTGG + Intergenic
973976519 4:56268481-56268503 TTAAAAAGATAGAAATTTGGGGG + Intronic
973990585 4:56402943-56402965 CTTTAGGTATAGAAAGTTGATGG - Intronic
974005304 4:56550627-56550649 TTTTAAGTATAAAAATTTATGGG - Intronic
974160571 4:58132919-58132941 TTTTAAGTATAGGAACTATGGGG + Intergenic
975174153 4:71268245-71268267 TTAGAAGTATAGAAGGTTGGAGG + Intronic
975323861 4:73038189-73038211 TTTTAAGGATTTGAATTTGGAGG - Intergenic
976351857 4:84069048-84069070 ATCTAAGTATAGAAATTTAGGGG - Intergenic
976704215 4:88005073-88005095 AGTGAAGTATAGAAATGTGGGGG + Intergenic
976966777 4:91052938-91052960 TTTAAAGTGTAGTAAATTGGTGG + Intronic
978077544 4:104551756-104551778 TTTTAAGGTTAGAAAGTTTGTGG + Intergenic
978462327 4:108969887-108969909 TTTTATATATATATATTTGGTGG - Intronic
978740990 4:112137693-112137715 TTTTCAGAATAAAAATGTGGAGG + Intergenic
979737874 4:124110695-124110717 TTTAAAATATTAAAATTTGGGGG + Intergenic
979895545 4:126151522-126151544 TTTTATTTATATAAATTTGTAGG - Intergenic
980586605 4:134825408-134825430 TTTCAATAAAAGAAATTTGGAGG - Intergenic
981038599 4:140197909-140197931 ATTTCAGCATACAAATTTGGGGG - Intergenic
981338946 4:143598131-143598153 ATTTCAGCATATAAATTTGGGGG + Intronic
981769189 4:148287567-148287589 TTTTAAGTATAGTAATTTATAGG - Intronic
981838809 4:149086989-149087011 TTATAAGTAAAGAAAATTGCAGG - Intergenic
981848553 4:149199669-149199691 TTTTAAATATATAAATTTATGGG + Intergenic
982641303 4:157964917-157964939 TTTCAAGTGCAGAGATTTGGAGG + Intergenic
983279796 4:165665839-165665861 CTTTAAGTAGTGAACTTTGGTGG - Intergenic
983816839 4:172140178-172140200 TTTTAAGTATGGAAATATTTGGG - Intronic
983892944 4:173049540-173049562 ATTTCAATATATAAATTTGGGGG + Intergenic
984307529 4:178015010-178015032 TTTTAAGAATAGAAATTTTTGGG + Intergenic
984412696 4:179415031-179415053 TTTTAAATATAGCTTTTTGGGGG - Intergenic
985134572 4:186773191-186773213 TTTTATGTATACAGACTTGGTGG - Intergenic
1202754643 4_GL000008v2_random:49191-49213 TTTTGAGTATAAATATTTAGGGG + Intergenic
986153432 5:5149189-5149211 TTTTAAGTCAAGATACTTGGTGG - Intronic
986457952 5:7939471-7939493 TTTAAATTATAGAAATTTTCAGG - Intergenic
986624404 5:9709864-9709886 TTTTAAGTCACTAAATTTGGGGG + Intronic
986956064 5:13151358-13151380 TTTTAATTATAAACATATGGTGG - Intergenic
987390609 5:17371671-17371693 TTTTAAGTGTTAAAATTTGGAGG - Intergenic
987444334 5:17999089-17999111 TTTGTAGTATAGAAATCAGGTGG + Intergenic
987554249 5:19425994-19426016 TGTTAAGTATATTTATTTGGGGG - Intergenic
987657288 5:20822913-20822935 GTTTAAGTATGGACATATGGAGG - Intergenic
987946531 5:24616577-24616599 TTTTAAATATAGAAAGTATGAGG - Intronic
988301821 5:29439266-29439288 ATTTAAATATAGAAATTTTGAGG - Intergenic
988315422 5:29620475-29620497 TTTTATATAGAGAACTTTGGTGG + Intergenic
988656145 5:33213965-33213987 TTTCAAATATAAACATTTGGGGG - Intergenic
988766258 5:34381035-34381057 GTTTAAGTATGGACATATGGAGG + Intergenic
988845797 5:35126473-35126495 TTTTAATTTTAAAAAATTGGAGG + Intronic
989467070 5:41769277-41769299 TTTTAATTATTAAATTTTGGGGG - Intronic
989980458 5:50637588-50637610 ATTTAAATATACAAATTTTGGGG - Intergenic
990190396 5:53253254-53253276 TTTTCAATATATAAGTTTGGGGG + Intergenic
990779407 5:59342554-59342576 TTTAAAGTACATAAATTTTGGGG + Intronic
991556696 5:67902677-67902699 TTTAAAGTTTAGAGACTTGGAGG - Intergenic
992161186 5:74003910-74003932 TTAAAAATATAAAAATTTGGAGG - Intergenic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993185452 5:84612889-84612911 TTGTAATAATACAAATTTGGAGG - Intergenic
993817485 5:92569286-92569308 TATTAAGTATAGAAACATGAAGG + Intergenic
994089166 5:95793630-95793652 TTTTAGGAATAGAAATTTGCCGG + Exonic
994166532 5:96614974-96614996 GTTGAACTATTGAAATTTGGGGG - Intronic
995158061 5:108939691-108939713 TTTTAAATAAAGAAAGATGGTGG - Intronic
995303538 5:110615140-110615162 GATTAAGTAAAGAATTTTGGAGG - Intronic
995659413 5:114464168-114464190 TTTTAGGTATAGGAAATGGGAGG + Intronic
996246212 5:121266547-121266569 GTTTAAGTTTCTAAATTTGGTGG - Intergenic
997122370 5:131188637-131188659 TTCTGAATATAGAAATTTGGTGG + Intronic
997136347 5:131330321-131330343 TTTAATGTAGAGGAATTTGGAGG + Intronic
997776245 5:136608837-136608859 GTTAAAGTATAGACTTTTGGTGG + Intergenic
998388164 5:141770262-141770284 ATTTCAGTATATGAATTTGGAGG + Intergenic
999028921 5:148268286-148268308 TAATAAGTAGAGAAATTAGGAGG + Exonic
999186790 5:149716694-149716716 ATTTAAGCATAGAAATATAGTGG - Intergenic
999422131 5:151453839-151453861 TTTTAAAAATAAAAATTTGTAGG - Intronic
999469965 5:151845539-151845561 TTTTAACTATAGCCATTTAGTGG - Intronic
1000976619 5:167771959-167771981 TTCTAATTATATAAATATGGTGG + Intronic
1004838886 6:19560164-19560186 TTTTACATATAAAATTTTGGAGG - Intergenic
1005249345 6:23926849-23926871 ATTTCAACATAGAAATTTGGAGG + Intergenic
1006428254 6:33979469-33979491 TTTTAAGCACAGAAGTGTGGAGG - Intergenic
1008021737 6:46586272-46586294 TTTTAAATATAAAAATTTAATGG + Intronic
1008280497 6:49590236-49590258 AGTAAAGCATAGAAATTTGGAGG + Intergenic
1008461934 6:51785762-51785784 TTTTGTGGATAGAAATTTTGAGG - Intronic
1008797718 6:55324305-55324327 TTTTAAGTAGACAAATATAGTGG + Intergenic
1008836032 6:55831390-55831412 TTTTAAGGAAAGGAACTTGGAGG + Intronic
1008886368 6:56435305-56435327 TTTTAATGAAATAAATTTGGTGG + Intergenic
1009397601 6:63217928-63217950 ATTTCCATATAGAAATTTGGGGG + Intergenic
1009877700 6:69525904-69525926 TTATAAGTATTGAAATCTGGTGG + Intergenic
1009973182 6:70646174-70646196 TTTTGAGTATAGAAGTCTGATGG + Intergenic
1010145180 6:72659772-72659794 TTGTCAATATATAAATTTGGAGG + Intronic
1010190127 6:73186786-73186808 TTTTAAAAAAAGAATTTTGGTGG - Intronic
1010671238 6:78689356-78689378 ATTTCAGTATACAAATTTTGGGG - Intergenic
1010863122 6:80937959-80937981 TTCTAAGTATAATAATTTAGAGG - Intergenic
1011553636 6:88551878-88551900 TTTTACCTTTAGAAATTTCGAGG + Intergenic
1012103207 6:95118474-95118496 TAATAAGTTTAAAAATTTGGTGG - Intergenic
1012119271 6:95343377-95343399 ATATAAGTATAAAAATTTGTGGG - Intergenic
1012634941 6:101526319-101526341 TTTTAAAAATAGAAATTGGATGG + Intronic
1012808880 6:103932200-103932222 TTTTATTTATATAAATTTTGGGG - Intergenic
1013265495 6:108493477-108493499 TTCTAACTCTAGAAATATGGAGG + Intronic
1013786732 6:113789630-113789652 ACTTCAGTATATAAATTTGGTGG + Intergenic
1013985187 6:116183475-116183497 TTTTAAATATGGATATTTTGTGG + Intronic
1014000435 6:116359960-116359982 TTTTAAGTAAAACAATTTTGTGG - Intronic
1014506183 6:122260405-122260427 TTTTAAGTTTAGAAAGCTGAAGG - Intergenic
1014526083 6:122503202-122503224 ATTTCAGTATATAAATTTGCAGG + Intronic
1015116167 6:129651836-129651858 ATTTCAGTATATGAATTTGGTGG - Intronic
1015153724 6:130066752-130066774 ATTTAATAATAGAAATTTGCAGG - Intronic
1015481252 6:133712654-133712676 TTCAATGTAAAGAAATTTGGAGG - Intergenic
1015683475 6:135833810-135833832 TTTTCATTAGAGAAATTTCGAGG + Intergenic
1015852401 6:137588167-137588189 TTTAAAGTATTGAAATTAGAGGG + Intergenic
1015939700 6:138435567-138435589 TTTTGGGAATAGAATTTTGGTGG - Intronic
1015990643 6:138938384-138938406 CTTTAAGTATAGAATATTTGTGG + Intronic
1016273301 6:142315988-142316010 TCTTAACCATAGAAATATGGTGG - Intronic
1016759307 6:147719584-147719606 TGTAAAGTGTAGAAATCTGGAGG - Intronic
1017501624 6:155030755-155030777 TTTTCACTATAGAAATTTTTTGG + Intronic
1017728383 6:157292287-157292309 TTTTAAGTATAAGAATTTATAGG + Exonic
1018516543 6:164585882-164585904 ATTTAACTATAGAAATTTATAGG + Intergenic
1020589308 7:10114385-10114407 TATTATGAATGGAAATTTGGGGG + Intergenic
1020612820 7:10422202-10422224 TTTTGTGTAAAGAAATTGGGTGG + Intergenic
1020757607 7:12223348-12223370 TTTTAATTTTAAAAATATGGAGG + Intronic
1021591106 7:22263427-22263449 TATTAATTTTAAAAATTTGGTGG + Intronic
1022340182 7:29460313-29460335 TTGTAACAGTAGAAATTTGGGGG + Intronic
1024039288 7:45537855-45537877 TTTTAAGTATAGGCATTTACAGG - Intergenic
1024175773 7:46839394-46839416 TTCTAAGTTTAGAAATGTTGGGG + Intergenic
1025581484 7:62724442-62724464 TTTTGAGAGTGGAAATTTGGGGG + Intergenic
1026282024 7:68930447-68930469 GTTTAACTATAGAAACTTGGGGG - Intergenic
1026483690 7:70799860-70799882 TTTTAGGGAGATAAATTTGGTGG + Intergenic
1027205945 7:76099107-76099129 TTTTAAGGAAAGAAAGTTGAGGG - Intergenic
1027467336 7:78532186-78532208 TTTTCATTACAGAATTTTGGAGG - Intronic
1027489918 7:78810324-78810346 TTTCGAGTAGAGAAGTTTGGTGG - Intronic
1027839293 7:83287715-83287737 TTTTACTCAGAGAAATTTGGAGG - Intergenic
1027971421 7:85087330-85087352 TTTTAAGGATATAATTTTGGTGG + Intronic
1028030197 7:85902667-85902689 TTTAAACTATAGAGATTTGTAGG + Intergenic
1028096434 7:86766771-86766793 CTTTGATTATAGTAATTTGGTGG - Intronic
1028734812 7:94196874-94196896 GTTTTAGCATATAAATTTGGGGG - Intergenic
1029165821 7:98589508-98589530 GTTTCAATATATAAATTTGGGGG + Intergenic
1030446541 7:109652442-109652464 TTTTCAGTAGAAAAATTGGGGGG - Intergenic
1030749957 7:113219528-113219550 TTTAAAGTTCAGTAATTTGGGGG - Intergenic
1030784945 7:113647735-113647757 TTTTAACCACAGAATTTTGGGGG + Intergenic
1031089282 7:117334424-117334446 TTTTAAGCATCTAAATTTTGGGG - Intergenic
1031232953 7:119133954-119133976 ATTTCAACATAGAAATTTGGTGG - Intergenic
1031455919 7:121979463-121979485 TTTTCAGTACAGAAATTTCTGGG - Intronic
1031461886 7:122061355-122061377 TGTTAATGATATAAATTTGGCGG - Exonic
1031658590 7:124391720-124391742 TTTTAAGTAAATAAAATTTGTGG - Intergenic
1032386186 7:131526444-131526466 TCTTAAGTATAGAAGTTTTGGGG - Intronic
1032821958 7:135532155-135532177 TTTTAAATGTAGTAATTTAGAGG - Intergenic
1032989506 7:137376751-137376773 ATTTAAGTTTAGAAATGTGATGG + Intergenic
1033990826 7:147284299-147284321 TTTTAGTGATAAAAATTTGGAGG + Intronic
1034247173 7:149655251-149655273 TTTTTAGTTTAAAAATTTGTGGG - Intergenic
1034841443 7:154401283-154401305 TTCTAAGAATAGAAAATTGAAGG + Intronic
1034854050 7:154523845-154523867 TTTATAATAGAGAAATTTGGTGG - Intronic
1035319758 7:158021023-158021045 TTTTAAGTATAGAAATCTCAAGG - Intronic
1036279453 8:7387317-7387339 TTTTAAGAATAGCACTTTGGAGG + Intergenic
1036342066 8:7924560-7924582 TTTTAAGAATAGCACTTTGGAGG - Intergenic
1036388123 8:8299304-8299326 CTTGCAGTATAGGAATTTGGAGG + Intergenic
1036406969 8:8463641-8463663 TTTTAAACCTGGAAATTTGGAGG + Intergenic
1036531596 8:9594198-9594220 TTTTAAGTATAGTATTTTGAAGG + Intronic
1037041020 8:14233966-14233988 TTCTAAGAAGAGAAATTTGGAGG + Intronic
1038282752 8:26180828-26180850 TTTTCAATATACGAATTTGGAGG - Intergenic
1038362013 8:26889703-26889725 TTTTAGTTCTAGAATTTTGGGGG + Intergenic
1038587457 8:28802751-28802773 TTTGAAGTATGGAAAATTGTAGG - Intronic
1039086142 8:33781956-33781978 TTTTCTGTATAGAAATGTAGGGG - Intergenic
1039403389 8:37292486-37292508 TTCTGAGTAAAGAAATTGGGTGG - Intergenic
1039949769 8:42160854-42160876 TTTTAAGGAAACAAATTTGGTGG + Intronic
1041989617 8:63970627-63970649 TTTTAACTTGAGAAATGTGGTGG - Intergenic
1042893433 8:73638586-73638608 TATTAAGTCTAGAACTTTAGTGG - Intronic
1044156215 8:88850476-88850498 CTTTAAGAAAAGAAATTTTGGGG + Intergenic
1044433369 8:92134584-92134606 TTTTAAGGAATGAAATTTAGGGG + Intergenic
1044714091 8:95084953-95084975 TTTTTAGTATAGAGATTTTCAGG - Intronic
1044910654 8:97054934-97054956 TTTTAAGTATAGAGTTCAGGGGG + Intronic
1045463715 8:102449589-102449611 CTTTAAGGATACAATTTTGGTGG + Intergenic
1045468849 8:102493347-102493369 GTTTAAATATATAAATTTTGGGG - Intergenic
1045694007 8:104787536-104787558 TTTTAAATATGGCTATTTGGAGG - Intronic
1045702575 8:104883686-104883708 GTCAAACTATAGAAATTTGGAGG - Intronic
1045808637 8:106195276-106195298 CTTTAAGATTAGAAATTTGTAGG - Intergenic
1045866134 8:106867433-106867455 TTTTAATTATACAATTTTGTTGG + Intergenic
1046091121 8:109503715-109503737 TTTAAAGTCTCTAAATTTGGGGG - Intronic
1046158164 8:110321685-110321707 TTTTAAGATTAGTAACTTGGAGG + Intergenic
1046264349 8:111812001-111812023 TTTGAAGTAATGAATTTTGGGGG + Intergenic
1046309090 8:112411265-112411287 TATTAAGTATAGAAAACTGTAGG + Intronic
1046327209 8:112664595-112664617 ATTTCAACATAGAAATTTGGGGG - Intronic
1047095378 8:121619394-121619416 GTTTAATTATAGCAATTTTGGGG + Intronic
1047140984 8:122139368-122139390 TTTTAGGGGGAGAAATTTGGGGG - Intergenic
1047588327 8:126299121-126299143 TTTTAAATATGGATATTTGAGGG + Intergenic
1048184970 8:132231446-132231468 ATTTAAATATAGGGATTTGGGGG + Intronic
1048579080 8:135716139-135716161 GTTTCAGCATATAAATTTGGGGG - Intergenic
1048929401 8:139299398-139299420 TTTTAAGTATCTAAATTTAATGG - Intergenic
1050099333 9:2101468-2101490 TTTTAACTATAGAAATAGGTAGG + Intronic
1050359894 9:4819887-4819909 TTTTATTTGTACAAATTTGGTGG - Intronic
1050364313 9:4860118-4860140 TTTTTAGGATAGAATTTTTGCGG + Exonic
1050724797 9:8636521-8636543 TTTTAAAAAAGGAAATTTGGGGG - Intronic
1050846553 9:10228084-10228106 TTTTAAGTAGCTAAATTTTGAGG - Intronic
1051761883 9:20476499-20476521 TTTTAAGGATATAAATTTTTTGG - Intronic
1052012609 9:23428545-23428567 TTTTAAGCATTGAAATATGGTGG + Intergenic
1052632061 9:31053897-31053919 TTCTAAGCCTAGAAATTAGGAGG + Intergenic
1053445814 9:38152332-38152354 TGTTAAGAATAGTTATTTGGGGG - Intergenic
1053735461 9:41098946-41098968 TTTAAACCACAGAAATTTGGAGG + Intergenic
1053922501 9:43010758-43010780 TTTTAACTATCTAAATTTGGTGG + Intergenic
1054692916 9:68332455-68332477 TTTAAACCACAGAAATTTGGAGG - Intronic
1054752435 9:68921572-68921594 TTTTAAATAGAGAAAGGTGGGGG - Intronic
1054789072 9:69237998-69238020 TTTTCAAAATAAAAATTTGGGGG - Intronic
1055112915 9:72577144-72577166 TATTAAGAAAAGAATTTTGGAGG - Intronic
1055173685 9:73291354-73291376 TTTTAAATATCAAAATTTGTTGG + Intergenic
1057585741 9:96327224-96327246 TTTTAAGAAAAGAAAAATGGAGG - Intronic
1058051784 9:100413614-100413636 TTTCAAGTACAGAAAATTTGAGG + Intergenic
1058141019 9:101356938-101356960 TTTTAAACATATAAATTTTGGGG + Intergenic
1058773919 9:108265513-108265535 TTTTAAATAAAGCAATATGGAGG - Intergenic
1058847689 9:108977877-108977899 TTTACAATATAGAAATTTGCGGG - Intronic
1059731864 9:117064781-117064803 TTTTAAGTATATAGATCTAGGGG - Intronic
1060174087 9:121484635-121484657 ATTTAAGTAAATAAATCTGGTGG + Intergenic
1203715775 Un_KI270742v1:144315-144337 TTTTGAGTATAAATATTTAGGGG - Intergenic
1203535438 Un_KI270743v1:33912-33934 TTTTGAGTATAAATATTTAGGGG + Intergenic
1203650028 Un_KI270751v1:107879-107901 TTTTGAGTATAAATATTTAGGGG - Intergenic
1185799193 X:2994309-2994331 TTTTAAGTCTTGATATTTAGTGG + Intergenic
1186057061 X:5661142-5661164 ATTTCAACATAGAAATTTGGGGG - Intergenic
1186099368 X:6139161-6139183 TTACTAGAATAGAAATTTGGAGG + Intronic
1186105283 X:6199003-6199025 TTTTTAGTTTAGAAATTTAGGGG - Intronic
1186215885 X:7300819-7300841 TTTGAAATATTGGAATTTGGAGG + Intronic
1187649786 X:21390180-21390202 TTTTAAGTAAATAAATCTTGTGG + Intronic
1187888323 X:23909725-23909747 TTTAAAGAATAGAAAGTTGGAGG + Intronic
1188266833 X:28087158-28087180 TTTTGCTTATACAAATTTGGGGG + Intergenic
1188278916 X:28238911-28238933 TTTTAACTATAGACATTTTCTGG + Intergenic
1188352569 X:29150443-29150465 GTTTAAATACAGAAATGTGGTGG + Intronic
1188634285 X:32408944-32408966 TTTTAAATATAGAGATGGGGTGG - Intronic
1188653449 X:32660562-32660584 TTTTAAAAATGGATATTTGGTGG - Intronic
1189029228 X:37432874-37432896 TAGTAAGTGTAGATATTTGGGGG - Intronic
1189084454 X:38006273-38006295 TTTTAAGAATAGAGATTTTCAGG + Intronic
1189834553 X:45006319-45006341 CTTTATGTATAACAATTTGGGGG - Intronic
1189904213 X:45741433-45741455 GTTTCAGTATACAAATTTGGGGG - Intergenic
1190580414 X:51888284-51888306 TTTTAATTAAAAAAATTTTGTGG - Intronic
1190757355 X:53412553-53412575 TTTAAAGGATAGGAATTTGAGGG - Intronic
1192601306 X:72467413-72467435 TTAAAAGTATAGAAATTTATAGG + Intronic
1194042076 X:88953424-88953446 TTTTATGTTAAGAAAGTTGGTGG - Intergenic
1194503651 X:94707386-94707408 TCTTTAGTTTAGTAATTTGGGGG + Intergenic
1194659987 X:96620458-96620480 TTTTAAGTGTATAAATTTATAGG - Intergenic
1195010270 X:100726789-100726811 TTTTAATTATATAAATTTATGGG + Intronic
1195169766 X:102255183-102255205 CTTTAAGTATATTAATATGGTGG + Intergenic
1195189091 X:102431917-102431939 CTTTAAGTATATTAATATGGTGG - Intronic
1195295313 X:103470775-103470797 CTTTAAGTAGCAAAATTTGGAGG - Intergenic
1195712260 X:107782962-107782984 TTCTAAATATAGAAATTGTGGGG - Intronic
1197128615 X:122977339-122977361 TTTTAAATACAGGAATTTGGGGG + Intergenic
1197441714 X:126499262-126499284 ATTTAAGTATACATATTTAGTGG + Intergenic
1197666582 X:129230502-129230524 TTTAAAATATGGATATTTGGGGG - Intergenic
1198334012 X:135649935-135649957 TTTTCAGCATAGAAAGTTTGTGG - Intergenic
1198439831 X:136652309-136652331 TTTTAGGGTGAGAAATTTGGGGG - Intronic
1198450706 X:136764880-136764902 TTTTAAAAATACAAATTTTGGGG - Intronic
1198606587 X:138345420-138345442 TTTAAAGAATTGAAATTTGTAGG - Intergenic
1199181451 X:144859596-144859618 TTTTAAATAAACACATTTGGGGG + Intergenic
1199619820 X:149689212-149689234 TTTAAAGTGCAGATATTTGGAGG + Intronic
1199871693 X:151904186-151904208 TTATATGTACAGAAATTTGTGGG + Intergenic
1200016406 X:153167370-153167392 TTTTTAAAATAGAAATTGGGAGG + Intergenic
1200287790 X:154840099-154840121 TTATAAATATAGAGATTAGGTGG - Intronic
1200536090 Y:4399339-4399361 ATTTCAGTATATAAATTTGAGGG - Intergenic
1201298160 Y:12483031-12483053 TGTTAAAAATAGAAATTGGGCGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201616855 Y:15909916-15909938 AGTTATGTATATAAATTTGGGGG + Intergenic
1202305696 Y:23468007-23468029 TTTTAGGAAAATAAATTTGGTGG - Intergenic
1202565113 Y:26202582-26202604 TTTTAGGAAAATAAATTTGGTGG + Intergenic