ID: 929623357

View in Genome Browser
Species Human (GRCh38)
Location 2:43380682-43380704
Sequence GGTATTCGAAACCAAGATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 13, 3: 78, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929623357_929623363 9 Left 929623357 2:43380682-43380704 CCCCAATCTTGGTTTCGAATACC 0: 1
1: 0
2: 13
3: 78
4: 230
Right 929623363 2:43380714-43380736 TAAAAGAAACCAGGTCTCCTTGG 0: 1
1: 21
2: 107
3: 292
4: 794
929623357_929623361 0 Left 929623357 2:43380682-43380704 CCCCAATCTTGGTTTCGAATACC 0: 1
1: 0
2: 13
3: 78
4: 230
Right 929623361 2:43380705-43380727 ATTCTCCAATAAAAGAAACCAGG 0: 6
1: 80
2: 206
3: 378
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929623357 Original CRISPR GGTATTCGAAACCAAGATTG GGG (reversed) Intronic
902638954 1:17754133-17754155 TGGATTTGAAACCAAGTTTGGGG + Intergenic
904100542 1:28022936-28022958 GGTATTCAAAACCAAGATTTGGG - Intronic
904320268 1:29692955-29692977 GATATTAGAAACCAAGATTTGGG + Intergenic
904345179 1:29863314-29863336 AGTATTAGAAACCAAGATCTGGG - Intergenic
905487235 1:38310745-38310767 AGTATTAGAAACCAAGATCTAGG + Intergenic
907014102 1:50994463-50994485 AGTATTAGAAACCAAGATCTGGG - Intergenic
908011271 1:59779707-59779729 GGTATCAGAAACCAAGATCTGGG + Intergenic
909614924 1:77597000-77597022 GGTATTAGAAACCAAAATTTGGG - Intronic
910592130 1:88937201-88937223 GGTATTGGAGACCTAGATGGGGG + Intronic
911419460 1:97621669-97621691 GGTATTAGAAATCAAGATCTGGG - Intronic
912597908 1:110897813-110897835 GCTATGCGAAAGCAAGACTGTGG + Exonic
914766111 1:150639326-150639348 GGTATTTCAAGTCAAGATTGTGG + Intergenic
915034981 1:152914405-152914427 GGTATTAGAAACCAAGAACTTGG + Intergenic
916257045 1:162799461-162799483 GTTATTAGAAACCAAGATCTGGG + Intronic
916332220 1:163629576-163629598 AGTATTAGAAACCAAGATCTGGG + Intergenic
916429637 1:164714802-164714824 GGTATTAGAACCCAAGAAAGGGG + Intronic
916478178 1:165189906-165189928 GATATTAGAAACCAAGATCTAGG + Intergenic
918792895 1:188853514-188853536 GGTATTGGAAACCAAGATCTGGG + Intergenic
918928828 1:190825987-190826009 GGTATTAGAAACCAAGAACTGGG - Intergenic
919713904 1:200755181-200755203 GGTATTAGAAACCAAGATACAGG + Intronic
921969039 1:221124706-221124728 GGTATTAGAAAGCAAGATCTTGG + Intergenic
922403626 1:225287679-225287701 GGTATTAGAAACCAAGATCTGGG - Intronic
924487926 1:244505329-244505351 GGTATTAGACATCAAGATCGGGG + Intronic
1063018684 10:2104324-2104346 GGTATTAGAAACCAAGATCTGGG - Intergenic
1063043704 10:2370974-2370996 GGTGTTAGAAATCAAGATTTGGG - Intergenic
1063293511 10:4776938-4776960 GGTATTAGAAACCAAGATCTAGG - Intergenic
1064480256 10:15733638-15733660 GGTATTAGAAACCAAGATCTGGG - Intergenic
1066339639 10:34518343-34518365 GGTATTAGAAACCACGATCTGGG - Intronic
1066691668 10:38034822-38034844 GGTATTAGAAACCAAGATAGGGG + Intronic
1066723504 10:38365153-38365175 GTTATTAGAAACCAAGATCTGGG + Intergenic
1067001035 10:42613837-42613859 GGTATTAGAAACCAAGATAGGGG - Intronic
1067049488 10:43004511-43004533 GGTATTAAAAACCAAGATATGGG + Intergenic
1067196560 10:44124705-44124727 GGTTTTAGAAACCAAGATATGGG + Intergenic
1067671480 10:48326513-48326535 GGTATTAGAAACAAAGATCTAGG + Intronic
1068646050 10:59469756-59469778 AGTATTAGAAACCAAGATTTGGG - Intergenic
1068982859 10:63079666-63079688 GGTATTAGAATCCAAGATCTGGG - Intergenic
1069668309 10:70180125-70180147 GGTATTAGAAACCAAGATCTGGG - Intergenic
1070242927 10:74701402-74701424 GGTATTAGAGACCAAGATCTGGG - Intronic
1070468857 10:76756927-76756949 GGTATTTGAAACCAAAGTTTGGG - Intergenic
1072320263 10:94242609-94242631 GGTATTAGAAACCAAGATCTGGG - Intronic
1072749514 10:97967451-97967473 GGTATTAGAAACCAAGATCTGGG + Intronic
1073697323 10:105884711-105884733 GCTATTAGAAACCAAGATCTAGG + Intergenic
1074047867 10:109855224-109855246 GGTATTTAAAACCAAGATCCAGG - Intergenic
1074261584 10:111859006-111859028 GGTATTAGAAACCAAAATCTGGG + Intergenic
1074956142 10:118391990-118392012 GGTATTGGAAACCAAGATCTAGG + Intergenic
1075428127 10:122357888-122357910 GGTGTTCTCAACCAACATTGTGG - Intergenic
1076524864 10:131106050-131106072 GGTGTTAGAAACCAAGATCCAGG + Intronic
1076989138 11:260656-260678 GGTATTAGAAACCAAGATCTGGG + Intergenic
1077948674 11:6930230-6930252 GGTATTAGAAACCAAGATCTGGG + Intronic
1078635936 11:13050083-13050105 GGTATTAGATACCAAGATCTGGG + Intergenic
1079320317 11:19446612-19446634 GGGATTCGATAACAAGAATGAGG + Intronic
1079990799 11:27244407-27244429 GGTATTAGAAACCAAGATCTGGG - Intergenic
1081004463 11:37717863-37717885 GGTATTAGAAACCAAGGTTTGGG - Intergenic
1082984369 11:59155158-59155180 GGCATTAGAAACCAAGATCTAGG + Intergenic
1084194304 11:67515532-67515554 GGTATTAGACACCAAGATCTGGG - Intergenic
1085691239 11:78665612-78665634 TGTATTTGAATCCAAGAATGAGG + Intronic
1086413072 11:86561348-86561370 GGTATTAGAAGGCAAGATTTGGG + Intronic
1086522432 11:87685033-87685055 GGCATTAGAAACCAAGATCTTGG + Intergenic
1087236322 11:95722913-95722935 GGTATTAGAAACCAAGATCTGGG - Intergenic
1087532193 11:99397824-99397846 GGTATTAGAAACCTAGATCTGGG + Intronic
1088095889 11:106101242-106101264 GGTATACCACACCAAGATTTGGG - Intergenic
1089035659 11:115387868-115387890 GGTATTAGAAACCAATATTGGGG - Intronic
1089673906 11:120076305-120076327 GGTATTGGAGACCAAGATCTGGG - Intergenic
1089892055 11:121891323-121891345 GGAATTTGAAAGCAAGATTGGGG - Intergenic
1090538344 11:127671615-127671637 GGTATTCGAAAACAAGATCTGGG - Intergenic
1093164071 12:15785659-15785681 GGTGTTAGAAACCAAGATCTGGG - Intronic
1094803050 12:34060477-34060499 GGCATTAGAAATCAAGATTTGGG - Intergenic
1098096181 12:66958555-66958577 GGTATTAGGAACCAAAATTTGGG + Intergenic
1098349105 12:69538983-69539005 TGTATTAGAAACCAAGATTTGGG - Intronic
1098705068 12:73676804-73676826 GGTATTTGAAACCAAGATCTGGG - Intergenic
1098764828 12:74473036-74473058 GGTCTTCAGAATCAAGATTGTGG - Intergenic
1098821589 12:75237706-75237728 GGTATTCAAAACCAAGATCTGGG + Intergenic
1099572555 12:84342545-84342567 GGTATTAGAAACTAAGTTTTTGG + Intergenic
1099607106 12:84818117-84818139 GATCTTTGAAACCAAGAGTGAGG + Intergenic
1100629991 12:96378525-96378547 GGTGTTAGAAACCAAGATCTGGG + Intronic
1100956433 12:99914415-99914437 GGTAATCAAAACAAAGATTTTGG + Intronic
1101808626 12:108088511-108088533 GGTATTAGTAACCAAGATCTGGG - Intergenic
1102244903 12:111349325-111349347 GGTATTCCAGAGCAAGACTGTGG + Exonic
1104184439 12:126416261-126416283 GGTATTAGAGACCAAGATCTGGG - Intergenic
1105632331 13:22182642-22182664 GGAATTAGAAACCAAGATTTTGG + Intergenic
1105703373 13:22950509-22950531 GGCATTAGAAACCAAGATGTGGG + Intergenic
1106212832 13:27666779-27666801 GGTATTGAAAACCAATACTGGGG - Intronic
1110221452 13:73078794-73078816 GGTATTAGAAACCAAGATCTAGG - Intergenic
1110310547 13:74044330-74044352 GGTATTAGAAACCAAGATCTGGG - Intronic
1110338461 13:74360733-74360755 GGTATTAGAAACCAAGATCTAGG + Intergenic
1110366030 13:74686740-74686762 GGTATTAGAAACCAAAATCTGGG - Intergenic
1111887702 13:94043210-94043232 GGTATTAGAAACCAAGGTCTGGG + Intronic
1112005252 13:95248009-95248031 GGTTTTGGAAACCAAGATCTGGG - Intronic
1115828181 14:37300949-37300971 AGTATTAGAAACCAAGATCTGGG + Intronic
1115883135 14:37942940-37942962 AGTATTTAAAACCAAGATTTGGG + Intronic
1116224914 14:42137887-42137909 GGTATTAGAAACCAAAATCTGGG + Intergenic
1117414553 14:55481707-55481729 GATATTCGAAACCAAGATCTGGG - Intergenic
1120093962 14:80366654-80366676 GGTATTAGAAACCAAGATCCAGG - Intronic
1120225058 14:81781463-81781485 AGTATTAGAAACCAAGATTTGGG + Intergenic
1120716134 14:87842578-87842600 AGTACTAGAAACCAAGATTTAGG + Intronic
1121260532 14:92562813-92562835 GATATTAGAAACCAAGATCTGGG + Intronic
1123878269 15:24647749-24647771 GATATTAGAAACAAAGTTTGGGG + Intergenic
1124181958 15:27484585-27484607 GATATTAGAAACCAAGATCTGGG - Intronic
1125683956 15:41551617-41551639 GGTATTAGAAACCGAGATCTGGG + Intergenic
1126540803 15:49820991-49821013 GGTATTAGAGACCAAGATTTAGG + Intergenic
1126824463 15:52535420-52535442 GGTATTAGAAACCAAGATTTGGG + Intergenic
1127273284 15:57420227-57420249 GGTATTAGAGACCAAGATCTGGG + Intronic
1130216918 15:81980482-81980504 GGTATTAGAAACCAAGATATGGG + Intergenic
1131315292 15:91330246-91330268 GGTATTGGAAATCAAGATTTTGG + Intergenic
1131768726 15:95710972-95710994 GGTATTCAAACCAAATATTGTGG + Intergenic
1132361204 15:101217457-101217479 GGTATTAGAAAGCAAGACTTGGG - Intronic
1134033506 16:11011606-11011628 GGTATTAGAGGCCAAGATTTGGG + Intronic
1134075627 16:11289368-11289390 GGTATTAGAAACCAAGATCAGGG + Intronic
1135513447 16:23109239-23109261 GGTATTAGAAACCAAGATATGGG - Intronic
1136493532 16:30626645-30626667 GGTATTCAAAGCCAAAATTCAGG + Intergenic
1137528449 16:49259939-49259961 GGTATTAGAAACCAAGATCTGGG - Intergenic
1138129116 16:54464093-54464115 GGTATTAGAAACCAAGATTAGGG - Intergenic
1139098988 16:63743425-63743447 AGTATTAGAAACCAAGATCAGGG - Intergenic
1141439551 16:84020845-84020867 CGTATAGGAAACCAAGGTTGTGG - Intronic
1143931145 17:10427221-10427243 AGTATTCTAAAACTAGATTGTGG - Intergenic
1143982540 17:10882421-10882443 GGTATTGGAAACCTAGATAAGGG + Intergenic
1144416753 17:15055248-15055270 GGTATTAGAAACCAAGATCTGGG - Intergenic
1144492477 17:15725738-15725760 GGTATCAGAAACCAAGATCTGGG - Intergenic
1144907997 17:18653449-18653471 GGTATCAGAAACCAAGATCTGGG + Intronic
1147190993 17:38738191-38738213 GGTGGTTGAAACCAAGATTGGGG - Intronic
1148975417 17:51523481-51523503 GGTATTGGAAGCCAAGATATGGG + Intergenic
1149619151 17:58029124-58029146 GGTATTAGAAACCAAGATCTGGG - Intergenic
1149811542 17:59678699-59678721 GGCATTAGAAACCAAGATCTGGG + Intronic
1150249520 17:63698343-63698365 GGGTTTGGAAACCAGGATTGGGG - Exonic
1150459780 17:65340001-65340023 GGTATTAGAAACCATGATCTGGG - Intergenic
1152807919 17:82365906-82365928 GGTGTTTGAGACCAAGACTGGGG + Intergenic
1153702183 18:7706671-7706693 GGGATTGGAAACCAAGATTCTGG + Intronic
1156013533 18:32521952-32521974 GGTATTAGAAACCAAGACTTGGG + Intergenic
1156619961 18:38839570-38839592 GGTACTGGAAACCAAGATCTGGG - Intergenic
1158844846 18:61430917-61430939 GGTATTGGAAACCAAGATCTGGG + Intronic
1159561038 18:69995269-69995291 TGAATTAGAAAACAAGATTGAGG - Intergenic
1159701715 18:71637353-71637375 AGTATTAAAAACCAAGATTGAGG - Intergenic
1164955088 19:32376356-32376378 GGTATCAGAAACCAAGATTTGGG - Intronic
1165524392 19:36341435-36341457 GGAATGCAAAAGCAAGATTGAGG - Exonic
1168490138 19:56802265-56802287 GGTATTCAAAACCAAGTAGGTGG - Intronic
925520792 2:4742725-4742747 GGTATTAGAAGCCAAGATCTGGG - Intergenic
925966166 2:9068339-9068361 GGTATTAGAAACCAATATCTGGG + Intergenic
926659445 2:15447460-15447482 TGTGTTAGAAACCAAGATAGTGG + Intronic
926856774 2:17265022-17265044 GGTGTTAGAAACCAAGATCTGGG + Intergenic
927088481 2:19692655-19692677 GGTATTAGAAACCAATATCTGGG + Intergenic
927312312 2:21645000-21645022 GCTATTTGAAACCACGATTCTGG + Intergenic
928599293 2:32887416-32887438 GGTATTAGAAACCAAGATCTGGG - Intergenic
929623357 2:43380682-43380704 GGTATTCGAAACCAAGATTGGGG - Intronic
930429021 2:51250634-51250656 TGTAGTAGAAACGAAGATTGGGG - Intergenic
930568275 2:53050848-53050870 GATATTAGAAACCAAGATGTTGG - Intergenic
931298449 2:60953276-60953298 AGTATTCTAAAACTAGATTGTGG - Intronic
932361663 2:71113388-71113410 GGTATTAGAAGCCAAGATCTAGG - Intronic
933034546 2:77377243-77377265 GGTATTAGAAATCAAGATCTGGG + Intronic
933378732 2:81515920-81515942 GGTATTAGAAGCCAAGATCTGGG - Intergenic
933521203 2:83376513-83376535 AATATTAGAAACCAAGATTTAGG + Intergenic
935747381 2:106200457-106200479 AGTATTGGAAACCAAGATTTGGG + Intergenic
936380876 2:111984899-111984921 GGTATTCCAAATAAACATTGTGG - Intronic
936653992 2:114463066-114463088 GGTTTTTGAAACCAAGATCTTGG + Intronic
938634408 2:133207491-133207513 GTTATTTGAAACCAAGATCTTGG - Intronic
940732525 2:157409099-157409121 GGTATTAGAAGCCAAGATCTTGG + Intergenic
941114183 2:161452552-161452574 GGTTTAAGAAACCAAGTTTGTGG - Intronic
941526809 2:166616128-166616150 GGTATTAGAAGCCAAGATCTGGG - Intergenic
941832806 2:169980778-169980800 TGTATTAGAAACCAAGATCGGGG - Intronic
942660674 2:178261232-178261254 GGTATTAGAAATCAAAATGGTGG + Intronic
943408917 2:187521063-187521085 GGTATTAGAAACCCAGATCTGGG + Intronic
943901991 2:193451514-193451536 GGCATTAGAAACCAGGATTTGGG - Intergenic
944006393 2:194913212-194913234 GGTATTTGAAACCAAGATTTGGG + Intergenic
944332530 2:198488377-198488399 GGTATTAGAAATCAAGAGAGTGG - Intronic
945204880 2:207320755-207320777 GGTATTTGAAACCAAGGTCTGGG - Intergenic
945558198 2:211305282-211305304 GGTATTAGAAACCAAAATCTGGG - Intergenic
945750495 2:213776508-213776530 GTTGTTTGAAACCAAGTTTGCGG + Intronic
945770576 2:214036391-214036413 GGTATTAGAGATCAAGATTAGGG + Intronic
948006359 2:234611180-234611202 GGTATTAGAAACCAAGATCTGGG - Intergenic
948304826 2:236938896-236938918 GATATTAGAAACCAAGATGTGGG + Intergenic
948342030 2:237261206-237261228 GATATTAGAAACCAAGATCTGGG - Intergenic
1173068142 20:39734578-39734600 GGTATTAGAAATCAAGATTTAGG - Intergenic
1173996444 20:47342214-47342236 AGTATTAGAAACCAAGATGTGGG - Intronic
1174397348 20:50255628-50255650 GGTATAAGAAACCAAGATCTGGG + Intergenic
1174966212 20:55218973-55218995 GGTATTAGAAACCAATATCTGGG + Intergenic
1175486142 20:59347885-59347907 GATATTAGAAACCAAGATCTGGG + Intergenic
1177354452 21:19989396-19989418 GGTATTAGAAACCAAGACCATGG + Intergenic
1178129826 21:29559842-29559864 GGAATTTGAGAACAAGATTGTGG - Intronic
1178415008 21:32397372-32397394 GGTATTAGAAACCAAGATCTGGG - Intergenic
1178630416 21:34254850-34254872 GCTATTAGAAACCAAGATCTAGG + Intergenic
1179314398 21:40228789-40228811 CCTATTAGAAACCAAGATTTGGG + Intronic
1179390510 21:40985750-40985772 GGTATTAGAAACCAAGATTAGGG - Intergenic
1180753953 22:18147310-18147332 GGAATTAGAAACCAAGATCTGGG + Intergenic
1182536305 22:31006105-31006127 GGCATTAGAAACCAAGATCTGGG - Intergenic
1182995811 22:34811087-34811109 GGTTTTAGAGACCAAGATGGAGG - Intergenic
1184317737 22:43710140-43710162 AGTATTCCTAACCTAGATTGTGG + Intronic
952014958 3:28945441-28945463 GGTATTAGAAACTAAGATCTGGG + Intergenic
952113322 3:30149771-30149793 GATATTAGAAACCAAGATCTGGG - Intergenic
952280788 3:31921306-31921328 GGTATTACAAACCAAGATGTGGG - Intronic
952703835 3:36355827-36355849 GGTATTAAAAACCAAGATATGGG + Intergenic
953623721 3:44553853-44553875 GGATTTGGAAACCAAGATTGAGG - Intergenic
954516635 3:51183981-51184003 GATATTAGAAACCAAGATCTAGG - Intronic
955039416 3:55300573-55300595 GGTATTAGAGACCAAAATTTGGG + Intergenic
955483775 3:59415426-59415448 GGTATTGGAAACCAAGATCAGGG - Intergenic
957364322 3:79202811-79202833 GGTTTTGGAAACCAAAATTAAGG - Intronic
958772426 3:98441427-98441449 GGTATTAGAAACCAAGATCTGGG + Intergenic
959607120 3:108253369-108253391 GGTATTAGAAACCAAGATCTGGG + Intergenic
959655265 3:108797114-108797136 GGTATTAGAAATCAAGATCTGGG - Intergenic
960109211 3:113828883-113828905 GGTACTTGAAACTGAGATTGTGG - Intronic
960370160 3:116826465-116826487 GGAATTAGAAACCAAGATTTGGG - Intronic
962955396 3:140261563-140261585 GGTATTAGAAACCAAGAGCTGGG + Intronic
964615269 3:158657002-158657024 GGTATTAGAAACCAAGATTTGGG + Intronic
964899384 3:161639784-161639806 GGTAATGGAAAACAAGTTTGGGG - Intergenic
965112196 3:164441537-164441559 GGTATTAGAAACCAAGATCTAGG - Intergenic
967610125 3:191495305-191495327 GGTACTAGAAACCAAGATCTAGG + Intergenic
967720776 3:192814089-192814111 GTTATTTGAAAACTAGATTGAGG - Intronic
968146345 3:196302286-196302308 GGCATTAGAAACTAAGCTTGGGG - Intronic
970050442 4:11908323-11908345 GGTATTCAAAACCAGGAATTTGG + Intergenic
971815865 4:31487973-31487995 GGTATTAGAACCCAAGATCCTGG - Intergenic
973622331 4:52740004-52740026 GGTTTTAGAAACCAAGATCTGGG - Intronic
973896174 4:55415500-55415522 GGTATTAGAACCCAAGATCTAGG + Intronic
974699634 4:65423807-65423829 GGCATTAGAAACCAAGATCTGGG + Intronic
975128770 4:70811570-70811592 GGTATTAGAAAACAAGATCTGGG - Intergenic
977207101 4:94175712-94175734 TGTCTTCGAAAACAAGATTAAGG - Intergenic
977590340 4:98819259-98819281 GGTATTAGAAACCAAGATTTGGG - Intergenic
978365332 4:107975221-107975243 GGTATTAGAAACCAAGGTCTGGG - Intergenic
979464375 4:121019468-121019490 GGTGTTAGAAACAAAGATTTGGG + Intergenic
980274425 4:130631129-130631151 GGAATTCGAAACCAGGATCTGGG + Intergenic
981016833 4:139982451-139982473 GGTATTAGAAACCAAGGTCTGGG + Intronic
981266170 4:142786120-142786142 GGTGTTAGAAATCAAGATTTGGG - Intronic
981353970 4:143765671-143765693 AGTATTAGAAACCAAGATCTGGG + Intergenic
981679017 4:147372927-147372949 GGTATTAGAAACCAAGATCTGGG + Intergenic
981839828 4:149098416-149098438 GGTATTAGAAACCAAAATCTGGG + Intergenic
981962405 4:150557002-150557024 GCTATTAGAAACCAAGATGTGGG - Intronic
982379397 4:154733394-154733416 GGTAATGGAAAACAAGATGGAGG - Intronic
982509346 4:156261981-156262003 GGTATTAGAAACCAAGATCTGGG + Intergenic
983490331 4:168381942-168381964 AGTAATCAAAACCAAGAATGGGG + Intronic
985040662 4:185888487-185888509 GAAATTCAAAACCAAGATGGAGG - Intronic
987394568 5:17410103-17410125 GGCATTAGAAACCAAGGTTGAGG + Intergenic
987556382 5:19456476-19456498 AGTATCAGAAACCAAGATTTGGG - Intergenic
988374375 5:30415376-30415398 GGTATTAGAAACCAAGATTTGGG - Intergenic
988878688 5:35475916-35475938 GGCATTAGAAACCAAGATGTGGG + Intergenic
989080704 5:37617318-37617340 AATATTCTAAAACAAGATTGTGG + Intronic
989167959 5:38449015-38449037 GCTATTCCAAACCAAGAGCGAGG - Intronic
990752104 5:59027828-59027850 GGTATTAGAAACCAAAATGAGGG + Intronic
991282315 5:64929262-64929284 GGTGTTAGAAACCAAGATCTGGG - Intronic
991988101 5:72310258-72310280 GGCATTAGAAACCAAGATCTAGG - Intronic
993239664 5:85365886-85365908 GGTATTAGAAACCAATATTTTGG + Intergenic
993251473 5:85530337-85530359 GGTATTAGAAACCAAGATGTGGG + Intergenic
993851992 5:93021986-93022008 GGTACTTGAAATCTAGATTGTGG + Intergenic
994266807 5:97726508-97726530 GGTATGAGAAACCAAGATACAGG + Intergenic
994366155 5:98919887-98919909 GGCATTAGAAACCAAGATTTGGG - Intronic
994464915 5:100114536-100114558 AGTATTAGAAACCAAGATCTGGG - Intergenic
995202099 5:109437648-109437670 GGTATTAGAAACCACGATCTGGG - Intergenic
995807709 5:116072120-116072142 AATATTAGAAACCAAGATTAGGG + Intergenic
996054391 5:118967395-118967417 GATATTCAAAACCAAGATCCGGG - Intronic
998195683 5:140068464-140068486 GGTACTAGAAACCAAGATCTAGG - Intergenic
1000585444 5:163091932-163091954 GGTATCAGAAACCAAGATCTGGG - Intergenic
1000735765 5:164898318-164898340 AGAATTAGAAACCAAGATTTGGG + Intergenic
1001901003 5:175429695-175429717 GGTGTTAGAAACCAAGATCTGGG - Intergenic
1002036435 5:176474015-176474037 GGTATTAGAAACCAAGTTCTAGG + Intronic
1002554341 5:180023343-180023365 GGTATTAAAAACCAAGATCCGGG - Intronic
1003139895 6:3462521-3462543 GGTATTAGATACCAAGATCTGGG - Intergenic
1004799262 6:19128160-19128182 GGTATTAGACACCAAGATCTTGG - Intergenic
1004901166 6:20195512-20195534 GGTCTTAGAAACCAAGATCCAGG + Intronic
1005002084 6:21251812-21251834 GCTATTAGAAACCAAGATCTGGG + Intergenic
1005176845 6:23056619-23056641 GGTATTAGAAACCAACATCTGGG - Intergenic
1007995231 6:46300918-46300940 GGTTATCTAAACTAAGATTGTGG + Intronic
1008404738 6:51106333-51106355 GGTATTAGAAATCAGGATAGTGG + Intergenic
1009884616 6:69610941-69610963 GGTATTAGAAACCAAGATCTGGG - Intergenic
1011008457 6:82675695-82675717 GGTGTTAGAAACCAAGATCTGGG - Intergenic
1012469466 6:99554800-99554822 GATATTAGAAACCAAGATATGGG + Intronic
1012783561 6:103593617-103593639 GGTTTTAGAAACCAAGATCTAGG + Intergenic
1014182930 6:118405376-118405398 GGTTTACCAAACCAAGATTTTGG - Intergenic
1014329749 6:120047840-120047862 AATATTAGAAACCAAGATTTGGG + Intergenic
1015086705 6:129302901-129302923 GGTATTGGAAACGATGAATGAGG - Intronic
1015553382 6:134435452-134435474 GGTATTAGAAATCAAGATTGGGG - Intergenic
1016640557 6:146343911-146343933 TGTATTAGAAACCAAGATCTGGG + Intronic
1016708399 6:147140897-147140919 GGTATTAGAAAACAAGATCTGGG - Intergenic
1017504783 6:155058162-155058184 GCTATTAGAAACCAAGATCTGGG + Intronic
1021362888 7:19738501-19738523 GGTATTAGAAACCAAGATCTGGG - Intronic
1022600597 7:31755433-31755455 GGTTTTAGAAACCAAGATCAGGG - Intronic
1023902457 7:44492976-44492998 GATATTAGAAACCAAGATCTGGG - Intergenic
1024455441 7:49600571-49600593 AGTATTAGAAACCAAGATCTGGG + Intergenic
1024848800 7:53684352-53684374 GGTATTAGAAACCAAGCTCTGGG - Intergenic
1027924597 7:84445189-84445211 GGTATTAGAAATCAATAATGAGG + Intronic
1028278871 7:88895558-88895580 GGTATTAGAAACCAAGATCTTGG - Intronic
1028293130 7:89092876-89092898 AGTATTAGAAACCAAGATCTGGG + Intronic
1030429253 7:109421091-109421113 GATATTAGAAACCAAGATCTAGG + Intergenic
1030649913 7:112106282-112106304 GGTATTCTAAACCACGGATGAGG + Intronic
1030757128 7:113300629-113300651 TGTATTAGAAACCAAGATCTAGG + Intergenic
1031479772 7:122264664-122264686 TGTATTAGAAATCAAGATTTGGG - Intergenic
1031745105 7:125486416-125486438 AGTATTAGAAACCAAGATCCTGG - Intergenic
1033448740 7:141444137-141444159 GGTATCAGAAACCAAGATATGGG + Intronic
1038365301 8:26925806-26925828 GGTATTAGAAACCAAGATCTGGG - Intergenic
1039767415 8:40644250-40644272 GATATTAGAAACCAACATTTGGG - Intronic
1040914239 8:52552887-52552909 GGCATTAGAAACCAAGATCAGGG + Intronic
1040998503 8:53426194-53426216 GGTATTAGAAACCAGGATCTGGG - Intergenic
1041573254 8:59362743-59362765 GGTATTAGACATCAAGATAGGGG + Intergenic
1042437562 8:68784950-68784972 GATTTTAGAAACCAAGATTGGGG + Intronic
1042447556 8:68904412-68904434 AGTTTTTGAAACAAAGATTGGGG + Intergenic
1042950024 8:74191636-74191658 GGTATTAGAAACCCAGATTTGGG + Intergenic
1043001589 8:74766730-74766752 GGTATTAGAAATCAAGATTTGGG + Intronic
1043001860 8:74769338-74769360 GGTATTAGAAATCAAGATTTGGG + Intronic
1043132476 8:76478634-76478656 GGTAGTTGAAACCATAATTGTGG - Intergenic
1043825385 8:84922445-84922467 GGTATTAAAAACCAAAATTCTGG + Intergenic
1043888621 8:85631483-85631505 GGTAATAGAAACCAACTTTGAGG + Intergenic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1045067347 8:98460604-98460626 GGGATTACAAACCAAGATTATGG - Intronic
1045410713 8:101914883-101914905 AGTATTAGAAACCAAGATCTGGG + Intronic
1047872279 8:129097423-129097445 GATATTCTAAAGGAAGATTGAGG - Intergenic
1048548443 8:135408557-135408579 GGTATTAGCAACCAAGATCTGGG + Intergenic
1048640324 8:136351001-136351023 GGTATTAGAAACCAAGATCTGGG - Intergenic
1050070185 9:1802491-1802513 GGTATTAGAAACCAAGATCTGGG - Intergenic
1050225557 9:3450948-3450970 AGTATTGGAAACCAAGATCTGGG - Intronic
1051029179 9:12653934-12653956 GGTAGTAGAAACCAAGATCTGGG + Intergenic
1052164392 9:25306383-25306405 GTTATTAGAAACCAAAATTTAGG - Intergenic
1052257009 9:26469048-26469070 GGTGTTAGAAACCAAGATCTGGG + Intergenic
1056898498 9:90575309-90575331 GGTATTAGAAACCAAGATCTGGG - Intergenic
1057104387 9:92397656-92397678 GGTATTAGAAACCAAGATGCAGG + Intronic
1060165412 9:121409909-121409931 GGTATTAAAAACCAAAATTTTGG + Intergenic
1186926966 X:14344170-14344192 GGTAATACAAACCAAGATTTTGG - Intergenic
1188543581 X:31276873-31276895 GGTGTTCAAAATCAAGATTGTGG + Intronic
1189697709 X:43682249-43682271 AGTATTAGAAACCAAGATCTGGG - Intronic
1192148916 X:68699818-68699840 GGTATTTGCACCCAAGATTCTGG - Intronic
1192227001 X:69236300-69236322 GGTATTAGAAACCAAGATCTGGG + Intergenic
1192329263 X:70161377-70161399 GGTATTAGAAACCAAGATTTGGG - Intronic
1194155817 X:90387440-90387462 GGTATTAGAAATCGAGATTTGGG - Intergenic
1197276426 X:124484800-124484822 GGTATTAGAAACCAAGATCTGGG + Intronic
1198885669 X:141333485-141333507 GGTATTCTAAACCAGGCGTGTGG + Intergenic
1199254843 X:145707813-145707835 GGTATTAGAAACCAAGATCTGGG - Intergenic
1199584176 X:149395839-149395861 GGTATTAGAGACCAAGATCTGGG - Intergenic
1200502165 Y:3964394-3964416 GGTATTAGAAATCGAGATTTGGG - Intergenic