ID: 929628312

View in Genome Browser
Species Human (GRCh38)
Location 2:43433062-43433084
Sequence ATCTTCCTCTAGAAGCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 7, 3: 37, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929628311_929628312 -4 Left 929628311 2:43433043-43433065 CCTAAGAAAGATATCGTATATCT 0: 1
1: 0
2: 0
3: 10
4: 137
Right 929628312 2:43433062-43433084 ATCTTCCTCTAGAAGCTTTATGG 0: 1
1: 0
2: 7
3: 37
4: 367
929628309_929628312 15 Left 929628309 2:43433024-43433046 CCTAAGAAATCTCTACCTACCTA 0: 1
1: 0
2: 4
3: 28
4: 214
Right 929628312 2:43433062-43433084 ATCTTCCTCTAGAAGCTTTATGG 0: 1
1: 0
2: 7
3: 37
4: 367
929628310_929628312 0 Left 929628310 2:43433039-43433061 CCTACCTAAGAAAGATATCGTAT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 929628312 2:43433062-43433084 ATCTTCCTCTAGAAGCTTTATGG 0: 1
1: 0
2: 7
3: 37
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929628312 Original CRISPR ATCTTCCTCTAGAAGCTTTA TGG Intronic
903714632 1:25355508-25355530 ACCTTGCTCCAGAAGCTTTCAGG - Intronic
903964136 1:27075478-27075500 GTTTTCTTCTAGAAGCTGTATGG - Intergenic
904104776 1:28069995-28070017 AACTTGCTCCAGAGGCTTTAGGG - Intronic
904204622 1:28845679-28845701 ATTTTCTTCTAGGAGTTTTATGG + Intronic
904951326 1:34241824-34241846 ATTTTCTTCGAGAAGTTTTATGG + Intergenic
906324061 1:44833269-44833291 ATCTACCTCTGGAGGCTTTGCGG + Intronic
906413633 1:45601275-45601297 ATTTTCTTGTAGAAACTTTATGG + Intronic
908024338 1:59934271-59934293 GTTTTCTTCTAGGAGCTTTAGGG - Intergenic
908467251 1:64408780-64408802 ATTTTCTTTTACAAGCTTTATGG + Intergenic
908715570 1:67066502-67066524 GTTTTCTTCTAGAAGTTTTATGG - Intergenic
909562154 1:77019010-77019032 TGCTTCCTCTAGAGGCTTCAAGG - Intronic
909734095 1:78934439-78934461 ATTTTCTTCTAGGAGTTTTATGG - Intronic
910335881 1:86130938-86130960 AGTTTCCTCAAGAAGGTTTACGG + Intronic
912072774 1:105833512-105833534 GTTTTCCTCTAGAAGTTTTATGG - Intergenic
913384065 1:118240410-118240432 GTTTTCTTCTAGAATCTTTATGG - Intergenic
913431413 1:118796734-118796756 GCTTTCCTCTAGTAGCTTTATGG + Intergenic
913724529 1:121638137-121638159 ATCTTCCCCTAAAAGCTAAACGG - Intergenic
913737697 1:121804110-121804132 ATCTTCCCCTAAAAGCTAAACGG - Intergenic
913757411 1:122091840-122091862 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
913840525 1:123414390-123414412 ATCTTCCTATAGAAACTAGACGG + Intergenic
914977993 1:152384006-152384028 GTGTTCTTCTAGTAGCTTTATGG + Intergenic
915700147 1:157784367-157784389 TTCTTCCTTTTGAAGCCTTAAGG - Intergenic
915707403 1:157858809-157858831 GTTTTCCTCTAGAAGCTTTATGG - Intronic
915710095 1:157888414-157888436 CTTTTCTTCTAGAAGTTTTATGG - Intronic
915821212 1:159025775-159025797 ATTATCTTCTAGAATCTTTATGG + Intronic
917010265 1:170463251-170463273 ATTTTTCTCTAGAAACTTAATGG + Intergenic
917072154 1:171163634-171163656 ATTTTCTGCTAGAAGTTTTAGGG - Intergenic
917207266 1:172590277-172590299 AAATTCCACTAAAAGCTTTAAGG - Intronic
918564542 1:185912826-185912848 AACTTGCTCTAGAATCTTTCTGG + Intronic
919573972 1:199283565-199283587 TTATTTCTCTAGAAGGTTTAGGG - Intergenic
920044025 1:203121931-203121953 ATCTTCCTATAGCATCTTTCAGG + Intronic
921341009 1:214134720-214134742 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
921534187 1:216325133-216325155 ATCCTCCTCTGGAATCTTTAAGG + Intronic
921709928 1:218363879-218363901 AGCTTGCTCTAGAACCTTAAAGG - Intronic
924789313 1:247229821-247229843 GTCATCTTGTAGAAGCTTTATGG - Intergenic
1062778857 10:182098-182120 ATGTTTCTCTAGAAGCTTTAGGG + Intronic
1063020795 10:2125700-2125722 TTGTTCCTCTAGAGGCTGTAGGG + Intergenic
1065272137 10:24045251-24045273 CTCTCTCTCTCGAAGCTTTAAGG + Intronic
1065894185 10:30147440-30147462 ATTATCTTCTAGAATCTTTATGG + Intergenic
1066592919 10:37015399-37015421 TTGTTCCTTTAGAAGCTTAAAGG + Intergenic
1067141553 10:43661523-43661545 GTTATCCTCTAGATGCTTTATGG + Intergenic
1068420306 10:56782693-56782715 AATTCCCTCTAGAGGCTTTAAGG + Intergenic
1068907142 10:62339206-62339228 ATTATCTTCTAGAAGTTTTATGG + Intergenic
1070649742 10:78226358-78226380 TTATTCTTCTAGAAACTTTAAGG + Intergenic
1071252413 10:83833882-83833904 GTTTTCTTCTAGAAGTTTTATGG - Intergenic
1071346838 10:84701415-84701437 ATTTTCCTCTAGATGCATTTAGG - Intergenic
1073836315 10:107447495-107447517 GTTTTCCTCTAGAATTTTTATGG - Intergenic
1074029546 10:109672322-109672344 ATTATCCTCTAGAATTTTTATGG - Intergenic
1074676786 10:115860173-115860195 ATCATCATTTAGAAGCTTTGAGG + Intronic
1075843426 10:125524502-125524524 ATTTTCTTCTAGGAGTTTTAAGG + Intergenic
1076741024 10:132485300-132485322 ATTTTCCTCCAAAAGCTCTAAGG - Intergenic
1077661458 11:4072149-4072171 ATTTAGCTCTGGAAGCTTTAGGG - Intronic
1078010189 11:7567194-7567216 ATCTTCCTCTAGTAAGTTTATGG + Intronic
1078034413 11:7788051-7788073 ATTTTCCTCTAGGAGTTTTACGG - Intergenic
1078803898 11:14676924-14676946 GTTTTCTTCTAGAAGTTTTATGG + Intronic
1080685715 11:34513352-34513374 CCCTTCCTAAAGAAGCTTTAGGG + Intronic
1081412879 11:42780690-42780712 GTTTTCTTCTAGAAGTTTTATGG - Intergenic
1081648686 11:44808291-44808313 ATCTTCCTCCAGCATCTTGAGGG + Intronic
1082472458 11:53267287-53267309 ATCTTCATATAAAAACTTTATGG + Intergenic
1082732968 11:56822693-56822715 GTCTTCTTCTAGAAATTTTAAGG - Intergenic
1083074861 11:60026242-60026264 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
1085895400 11:80633164-80633186 TTGTTCCTTTAGAAGCTTAAAGG - Intergenic
1086283578 11:85219520-85219542 ATCCTCCTCTAGAACCCTCAGGG - Intronic
1087815659 11:102655630-102655652 TACTCCCTCTAGAAGCTCTAGGG + Intergenic
1088136801 11:106565234-106565256 ATCTTATTCTAAAAGCTTTGAGG + Intergenic
1088308830 11:108438591-108438613 ATTTTCTTCTAGGAGTTTTATGG - Intronic
1088804186 11:113336484-113336506 ATTTTCTTCTAAAAGTTTTATGG + Intronic
1090277324 11:125429324-125429346 CTCTTCCTCAAGAAGCTTCCAGG - Intronic
1090866015 11:130701336-130701358 ATCTTTCTCTGGAAGCTTTCAGG + Intronic
1090875546 11:130785692-130785714 TCATTCCTCTAGAGGCTTTAAGG + Intergenic
1091492321 12:943877-943899 ATCTTCTTCCAGAAGCCTCACGG + Intronic
1091708447 12:2717623-2717645 GTCTCCCACTAGAATCTTTACGG - Intergenic
1092452984 12:8620362-8620384 ATTTTCTTCTAGTAGTTTTACGG + Intergenic
1093278261 12:17155921-17155943 ATTATCTTCTAGAATCTTTATGG - Intergenic
1093360069 12:18214299-18214321 ATTTTCTTCTAGGAGTTTTATGG - Intronic
1093683312 12:22028210-22028232 ATTTTCTTCTAGAATTTTTATGG - Intergenic
1093827856 12:23716864-23716886 ATTTTCCTTTAAAAGCTTTTTGG - Intronic
1095240586 12:39854265-39854287 ATCTTCCTCAGGAAAGTTTAAGG + Intronic
1096939846 12:55330727-55330749 ATCTTCCTTTCAGAGCTTTACGG - Intergenic
1097720366 12:63013285-63013307 ATTCTCCTGTAGAAGCTTTCTGG + Intergenic
1098200959 12:68055180-68055202 GTCTTTCTCAAGAAGCTCTAGGG + Intergenic
1100702173 12:97160559-97160581 GTCTTCCTCTGGAATGTTTAGGG + Intergenic
1101637242 12:106554585-106554607 ATCTTCCCCTAGAATCCTGAGGG - Intronic
1102434983 12:112915223-112915245 ATTATCTTCTAGAATCTTTATGG + Intronic
1103425317 12:120829182-120829204 GTTTTCTTCTAGAAGCTTTATGG - Intronic
1105093392 13:16328384-16328406 ATCTTCCCCTACAAGCTAGAAGG + Intergenic
1105093980 13:16337942-16337964 ATCTTCCCCTACAAGCTAGAAGG + Intergenic
1105108234 13:16570751-16570773 ATCTTCCCCTACAAGCTAGAAGG + Intergenic
1105125643 13:16855393-16855415 ATCTTCCCCTACAAGCTAGAAGG + Intergenic
1105127746 13:16889501-16889523 ATCTTCCCCTACAAGCTAGAAGG + Intergenic
1105140786 13:17103188-17103210 ATCTTCCCCTACAAGCTAGAAGG + Intergenic
1105158951 13:17399144-17399166 ATCTTCCCCTACAAGCTAGAAGG + Intergenic
1108181961 13:47849242-47849264 GTCTTCTTCTAGAATTTTTATGG + Intergenic
1108641121 13:52383062-52383084 AGCTTGCTATAGAAGCTTTCAGG - Intronic
1108856007 13:54793246-54793268 CTCTCCCTCTGGAAGCTCTAGGG + Intergenic
1109261974 13:60156106-60156128 CTCTCCTTCTAGAAGCTCTAGGG + Intronic
1110394711 13:75015804-75015826 ATCTTCTTTTAGCAGTTTTAGGG - Intergenic
1111056582 13:82958190-82958212 GTTTTCTTCTAGAAGTTTTATGG - Intergenic
1111430111 13:88138307-88138329 CTCTTCCTCTAAAGGCTCTATGG + Intergenic
1112631549 13:101166821-101166843 GTTTTCTTCTAGGAGCTTTATGG + Intronic
1112924451 13:104656841-104656863 ATCTTCCTAAAGATGCTGTAAGG + Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114713015 14:24797355-24797377 CTGTTCCTCTGGAAGCTCTAGGG + Intergenic
1115469876 14:33757469-33757491 ATCTTCCTAGAGTATCTTTAAGG - Intronic
1115489648 14:33946783-33946805 TTCTTCCTCCAACAGCTTTACGG + Intronic
1115525612 14:34277504-34277526 ATATTTCTCTAGAAGGGTTAGGG - Intronic
1120567861 14:86081774-86081796 GGCTTCTTCTGGAAGCTTTAGGG + Intergenic
1120727166 14:87957358-87957380 ATTTTCTTCTAGAATTTTTATGG + Intronic
1120904691 14:89610072-89610094 ATCTTCATGTTGAAGCTTAAAGG + Intronic
1121379011 14:93444533-93444555 ATTTTCTTCTAGAAGTTTAATGG + Intronic
1122009988 14:98738348-98738370 ATCCTCCCCTAGAAGCTTGAAGG - Intergenic
1122376432 14:101263016-101263038 ATTTTCTTTTAGAAGCTTTATGG + Intergenic
1122764725 14:104058997-104059019 GTTTTCTTCTAGAAGTTTTATGG + Intergenic
1122932286 14:104939689-104939711 ATCTGCCTCTGGGAGCTGTAGGG + Exonic
1123828441 15:24107338-24107360 TTTTTCTTCTAGAATCTTTATGG + Intergenic
1125247415 15:37657119-37657141 GTCTTCTTCTAGGAGTTTTATGG - Intergenic
1127873446 15:63091829-63091851 ATCTGTCTCAAGAAGCTTTTGGG + Intergenic
1129027664 15:72593433-72593455 ATTTTCTTCTAGAAGTTTTATGG + Exonic
1129125683 15:73438975-73438997 ATTTTCTTCCAGAAACTTTATGG - Intergenic
1130409101 15:83629873-83629895 ATTTTCTTCCAAAAGCTTTAAGG - Intergenic
1130806019 15:87323560-87323582 ATTTTCTTCTAGAAGTTTCATGG - Intergenic
1131764695 15:95662618-95662640 ATCTTTCTCTAGGAGATTCATGG + Intergenic
1132304128 15:100797577-100797599 ATTTTCCTTTAAAAGCTTCATGG - Intergenic
1132401687 15:101512246-101512268 TTCTTCATCTAGAAGATTTGCGG + Intronic
1132916528 16:2349356-2349378 GTTTTCTTCTAGAAGTTTTACGG + Intergenic
1133549916 16:6844164-6844186 AGATTCCTCCAGAAGCTATAAGG - Intronic
1133626587 16:7575596-7575618 CACTTCCTCTAGAGGCTCTAGGG - Intronic
1134376282 16:13677688-13677710 CTTTTCCTCTAGAATTTTTATGG + Intergenic
1137242427 16:46667636-46667658 GTTTTCTTCTAGGAGCTTTATGG + Intronic
1137739650 16:50755964-50755986 GTTATCCTCTAGAATCTTTATGG + Intronic
1138302285 16:55942114-55942136 GTTTTATTCTAGAAGCTTTATGG - Intronic
1139108437 16:63857735-63857757 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1139555483 16:67706592-67706614 GTATTTTTCTAGAAGCTTTATGG - Intronic
1140030209 16:71330412-71330434 TTTTTCTTCTAGAAGTTTTAAGG - Intergenic
1140522967 16:75597995-75598017 TGCTTCCTCTAAAAGCTTTAGGG - Intronic
1145628290 17:25826634-25826656 ATCTTCCTGTAAAAGCTAGATGG + Intergenic
1146736999 17:35246941-35246963 ATTTTTCTCTAGAAATTTTATGG + Intronic
1150195140 17:63290140-63290162 TTCTTCTGCTAGAAGCTTGAGGG + Intronic
1150274525 17:63887707-63887729 AGATTCCTCTTGAAGCTTCAAGG - Intergenic
1153573765 18:6500070-6500092 ATTTTCTTCTAGAATTTTTATGG + Intergenic
1153855415 18:9139946-9139968 CTCTTTCTTTAGAAGTTTTACGG + Intronic
1154084771 18:11293064-11293086 ATCTTTCTGCAGAAGGTTTAAGG - Intergenic
1154192508 18:12242678-12242700 CTTTTCTTCTAGAAGCCTTACGG + Intergenic
1156099015 18:33571472-33571494 CTTTTATTCTAGAAGCTTTATGG - Intergenic
1156310836 18:35920291-35920313 ATTTTCTTCTACAAGTTTTATGG - Intergenic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1157540762 18:48504506-48504528 GTTTTCTTGTAGAAGCTTTATGG + Intergenic
1159507339 18:69354472-69354494 ACATCTCTCTAGAAGCTTTACGG + Intergenic
1159619813 18:70623977-70623999 ATCTTCCTCTTGAGGCTTTGAGG - Intergenic
1159860952 18:73648389-73648411 ATTTTCCTCTCCTAGCTTTAGGG - Intergenic
1160594803 18:79965699-79965721 ATCCTCCTCTGCATGCTTTATGG + Intronic
1163199419 19:15753841-15753863 GTCTTCTTCTAGAATTTTTATGG + Intergenic
1164786935 19:30940817-30940839 TTTTTTTTCTAGAAGCTTTATGG + Intergenic
1165026069 19:32962504-32962526 ATTTTCTTCTAGAAGTGTTATGG - Intronic
1166618716 19:44275550-44275572 ACCTTTCTCATGAAGCTTTATGG - Intronic
1166625707 19:44353287-44353309 CTCTTGTTCTAGAAGTTTTATGG - Intronic
1167209151 19:48122317-48122339 ATCTTCCTCTTGAAGGTTTCAGG - Intronic
926065908 2:9839798-9839820 TTTTTTTTCTAGAAGCTTTATGG + Intergenic
926346319 2:11949200-11949222 GTTTTTCTCTAGAAGTTTTATGG - Intergenic
926486392 2:13465341-13465363 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
926665439 2:15516921-15516943 ATCACCCTCTAGAATGTTTAGGG + Intronic
926758738 2:16257663-16257685 ATATCCCTCTAGAAACTTCAGGG + Intergenic
926995856 2:18735193-18735215 ATTTTCTTCTAGGAGTTTTATGG - Intergenic
927801759 2:26106903-26106925 ATTTTCTTCTAAAAGCCTTATGG - Intronic
929628312 2:43433062-43433084 ATCTTCCTCTAGAAGCTTTATGG + Intronic
929875277 2:45791646-45791668 ATTTCACTCTAGAATCTTTATGG + Intronic
929897239 2:45972567-45972589 GTTTTCTTCTAGGAGCTTTATGG + Intronic
931940429 2:67246040-67246062 CTCTCCCTCTGGAGGCTTTAGGG - Intergenic
935320904 2:101888183-101888205 ATATTCCTCTGGATGTTTTAAGG - Intronic
935325454 2:101931866-101931888 ATCTTTCCCTGGAAGCTTTGAGG + Intergenic
935986201 2:108675554-108675576 GTCTTCCTCTAAAAGCTACAGGG - Intronic
937816670 2:126258353-126258375 CTCATCCTCAAGAAGCTTTTAGG - Intergenic
937954438 2:127413402-127413424 GTTTTCTTCTAGAAGCTTTATGG - Intergenic
939041789 2:137198346-137198368 ATCTACCTCTAAGAGGTTTAGGG - Intronic
939280945 2:140064135-140064157 ATCTTCCCCCAGAAGCTTCCTGG + Intergenic
939682056 2:145148705-145148727 ATTTTCTTTTAGAAGTTTTATGG + Intergenic
940044755 2:149397810-149397832 ATTTTTATCTAGAAGCTTTCAGG + Intronic
940218882 2:151329837-151329859 CTCTTTCTCTGGAAGCTTTTTGG - Intergenic
940289368 2:152063469-152063491 ATCTTGCTCTAGAGGCTGTTTGG + Intronic
940655826 2:156486980-156487002 ATCTACTTCCAGATGCTTTAGGG + Intronic
940938347 2:159525917-159525939 ATATTGATCTAGCAGCTTTAAGG + Intronic
941573655 2:167202857-167202879 AGCTTCCTCCAGAAGCTCCAGGG + Intronic
941657222 2:168157051-168157073 ATCTTCCTCTAGCTCCTTAATGG + Intronic
941985459 2:171506335-171506357 AATTTCCTCTAAAAGTTTTATGG + Intergenic
942479011 2:176362393-176362415 GTTTTCTTTTAGAAGCTTTAGGG - Intergenic
942823500 2:180144932-180144954 ATCTTCCTCTTGAAGTTCAATGG + Intergenic
943561939 2:189474178-189474200 TTCTTCTGCTAGCAGCTTTAAGG - Exonic
943891542 2:193293260-193293282 TTGTTCTTCTAGAAGTTTTATGG - Intergenic
944270028 2:197772174-197772196 ATCTTAAACTAAAAGCTTTAAGG - Intronic
944919745 2:204399776-204399798 GTTTTCTTCTAGAAACTTTATGG - Intergenic
945888831 2:215406887-215406909 ATTTTCCCCTAGAAGCTTAAGGG - Intronic
1168735172 20:128971-128993 GTCTTCTTCTAGTAGTTTTATGG + Intergenic
1169185058 20:3608311-3608333 ATTTTCTTCTAGTAGTTTTATGG + Intronic
1169904487 20:10587880-10587902 TTCTTCTACTAGAAGTTTTATGG - Intronic
1170996504 20:21365038-21365060 ATCTGCCTCAAGATGCTTTGGGG + Intronic
1171878230 20:30598003-30598025 AGCTCCCTCTGGAAGCTCTAGGG + Intergenic
1172347665 20:34216532-34216554 ATATACTTCTAGAAGTTTTATGG + Intronic
1173183976 20:40825694-40825716 ATTTTTCTCTAGAAGCTTGCAGG - Intergenic
1173480901 20:43398514-43398536 ATCTGGCTCTAGAAGCTACATGG - Intergenic
1174566267 20:51466626-51466648 ATTTTCTTCTGGAAGCTTTTCGG - Intronic
1174930521 20:54808952-54808974 ATGTTCCTCCAGAACTTTTAAGG + Intergenic
1175297939 20:57922054-57922076 ATCTTCCTCTGAGAGCTGTATGG + Intergenic
1175390611 20:58625043-58625065 ATCTTCCTCTAGAAGCTTCTGGG - Intergenic
1175587405 20:60153194-60153216 GTTTTCTTCTAGAAGTTTTATGG + Intergenic
1177464346 21:21456637-21456659 ATTTTCTTCTAGTAGATTTATGG - Intronic
1178574845 21:33777009-33777031 ATTTTCTTCTAGAAGTTTTTGGG + Intronic
1179946327 21:44679923-44679945 GTTTTCTTCTAGTAGCTTTATGG - Intronic
1183581626 22:38729812-38729834 ATTTGTCTCTAGAAGCTATAAGG + Intronic
1184952715 22:47855784-47855806 ATTTTCCTCTAGAAATTTGAAGG - Intergenic
949587985 3:5461834-5461856 ATTTTCTTCTAGAAATTTTATGG - Intergenic
950144680 3:10640618-10640640 CTCCTCCTCCAGAAGCTTTCTGG - Intronic
951091693 3:18580968-18580990 ATTTTCTTCTAGAGGTTTTATGG - Intergenic
951821388 3:26816800-26816822 GTTTTCTTCTAGATGCTTTATGG - Intergenic
952279655 3:31910752-31910774 ATTTTACTCTGGAAGCTTGAGGG - Intronic
952314968 3:32224652-32224674 ATATTCATATAGAATCTTTAGGG + Intergenic
952595207 3:35009246-35009268 ATATTCCTCTAGGAGTTTTCTGG - Intergenic
953303474 3:41803425-41803447 GACCTCTTCTAGAAGCTTTATGG - Intronic
954944300 3:54405603-54405625 ATTTTCTTCTAGCAGTTTTATGG - Intronic
955784208 3:62519221-62519243 ATGTTCCAATAGAAGTTTTATGG - Intronic
957610273 3:82456663-82456685 ATTTTCATCTAGAATCTTTTAGG + Intergenic
957852708 3:85830622-85830644 ATTTTCTTCTAGGAGCTTTATGG + Intronic
957961050 3:87253054-87253076 TTCTTCCTCTACTAGCTTAATGG + Intronic
958265799 3:91435539-91435561 CTTTTCCTCTAGAAACTTTGTGG - Intergenic
958543145 3:95506816-95506838 ATTTTCCTTGAGAAGTTTTAGGG + Intergenic
960646536 3:119891001-119891023 CTATTCCTCAAGAAGCTCTAGGG + Intronic
961268018 3:125663133-125663155 ATGTTCCTCTAAAAGCTCAATGG + Intergenic
961350492 3:126298573-126298595 GTCATCTTCTAGAATCTTTATGG + Intergenic
962050570 3:131810092-131810114 ATTTTCTTTTGGAAGCTTTATGG - Intronic
962564419 3:136642816-136642838 ATCCTCCCCTAGAGGCTTCAGGG - Intronic
962993729 3:140604617-140604639 GTTTTCCTATAGAAGTTTTATGG + Intergenic
963794129 3:149614605-149614627 ATCTTCCTCCAAAATCATTAAGG + Intronic
963957280 3:151268832-151268854 ATTTTCCTCTAGAAGCTTTGTGG - Intronic
964605967 3:158560400-158560422 TGCTTCCTCTGGAAGCTCTAGGG - Intergenic
965345550 3:167544728-167544750 ATGTTCTTCTAGAATTTTTATGG - Intronic
965906313 3:173711244-173711266 ATCTCACTTTAGATGCTTTATGG + Intronic
965959105 3:174407581-174407603 ATCTACCTCTAGAAGTTCGATGG + Intergenic
966381482 3:179348833-179348855 ATCTCCCTCTAGTAGCATAATGG + Exonic
966479145 3:180385635-180385657 ATCTTCCTCTAGAAGTTTTTGGG - Intergenic
966694243 3:182773276-182773298 GTCTTCTTCTAGTAGTTTTATGG + Intergenic
967314538 3:188139023-188139045 TTCTTTCTCTAAAAGCTTAAAGG - Intergenic
967968508 3:194982812-194982834 ATGCTCCTCTGAAAGCTTTAGGG - Intergenic
968032719 3:195515356-195515378 ATCTTCCACTTGCAGGTTTATGG - Exonic
969165893 4:5312216-5312238 TTGTTTTTCTAGAAGCTTTATGG + Intronic
971157850 4:24102592-24102614 ATCTTCTTTTAGAAGGCTTACGG + Intergenic
974062102 4:57044456-57044478 GTTTTCTTCTACAAGCTTTATGG + Intronic
974179765 4:58369240-58369262 ATTTTCTTCTAGAAGTTTTACGG - Intergenic
975978757 4:80130531-80130553 ATCTACCTCTTGAAATTTTAAGG + Intergenic
975998176 4:80340475-80340497 ATATTCCTCTAGGAGATTCAGGG + Intronic
976122335 4:81796925-81796947 ATTTTCTTCTAGTAGCTTCATGG - Intronic
976627242 4:87199391-87199413 GTTTTCCTCCAGTAGCTTTATGG - Intronic
976721184 4:88170352-88170374 ATATTTCTTTAGAAGCTTCAGGG + Intronic
978604966 4:110469549-110469571 ATCTTGATCCAGAAGCTGTAGGG + Intronic
980811887 4:137893776-137893798 ATCTTCCTCAAGATATTTTATGG - Intergenic
981256937 4:142672837-142672859 AGTTTCCTCTGGAAGTTTTATGG + Intronic
983615257 4:169697199-169697221 ATTTTCCTCTCAAAACTTTATGG + Exonic
983668889 4:170213516-170213538 ATCTCCCTCTGGAACCTGTAGGG + Intergenic
983886197 4:172983247-172983269 TGCTTCCTCCAGAAGCTCTAGGG - Intronic
985433798 4:189907798-189907820 GTCTTCTTCTAGGAGTTTTATGG + Intergenic
986205208 5:5618027-5618049 ATTTTGTTCTAGAAGCTTTATGG + Intergenic
986443357 5:7799941-7799963 ATTTTCCTCTGGAGTCTTTAAGG - Intronic
987189132 5:15455710-15455732 ATTTTCCTCTAGTAGTTTCATGG + Intergenic
987240107 5:15988055-15988077 ATTTTCTTCTAGTAGCTTTATGG + Intergenic
987241756 5:16007099-16007121 ATCTTCCTCAAGAAGACATAAGG + Intergenic
988128246 5:27071704-27071726 TTCTTCCTTTAGAAACTTAAAGG + Intronic
988276947 5:29092506-29092528 GTTTTCTTCTAGAAGCTTTAAGG + Intergenic
988303161 5:29460534-29460556 CTCTTGCTATAGAACCTTTAGGG - Intergenic
988544002 5:32140170-32140192 TTTTTCCTCTAGAAGCATTTGGG - Intronic
988725450 5:33921976-33921998 AGCTTCCTCTAGAAACTTTATGG + Intergenic
988756715 5:34261929-34261951 CTCTTCCTCTAGAAAATTGAAGG + Intergenic
989527684 5:42472176-42472198 ATCTTCCTGTAGATGTTTAAGGG - Intronic
990383289 5:55235518-55235540 TTCTTCCTAGAGAAGCTTTCTGG + Intergenic
991042644 5:62191868-62191890 ATTGTCTTCTAGAATCTTTATGG + Intergenic
992299073 5:75359120-75359142 ATGTTCCTCCAGAAGGTTCAGGG - Intronic
992924135 5:81563781-81563803 ATGTTTCTCTAGTAGTTTTATGG - Intronic
992932362 5:81661944-81661966 GTTTTCTTCTAGTAGCTTTATGG + Intronic
993381035 5:87208154-87208176 GTCTTCCTCTAGAATTTTTATGG + Intergenic
994406692 5:99353354-99353376 ATTTTCCTCTATGAGTTTTATGG + Intergenic
995298908 5:110555039-110555061 ATTTTCTTCTACTAGCTTTAAGG + Intronic
995306213 5:110653927-110653949 TTCTTCCTCTTGAAATTTTAAGG - Intronic
995855431 5:116586519-116586541 AGCATGCTCTTGAAGCTTTATGG + Intergenic
996902904 5:128564133-128564155 ATCCTCCTCTAGAGGCAATATGG - Intronic
998249433 5:140541666-140541688 TTCTGCCGCTTGAAGCTTTATGG + Intronic
998297474 5:140985518-140985540 ATCTTCACCGTGAAGCTTTAAGG - Intronic
998520186 5:142793280-142793302 ATCTTTCTTTAGAGGCTTGAGGG + Intronic
998739587 5:145185231-145185253 ATTTTCCTCTAGGACTTTTATGG - Intergenic
1000040910 5:157484608-157484630 ATTTTCCCCAAGAAGCTTCATGG + Intronic
1000254112 5:159521447-159521469 ATATTCCTCTGGAAGGTTTAAGG + Intergenic
1000563688 5:162822090-162822112 ATCTTTCTTTAGAGGCTTTCAGG - Intergenic
1000676021 5:164123539-164123561 GTTTTCCTCTAGAATTTTTATGG - Intergenic
1000721086 5:164708080-164708102 ATCTTGCTCTAGAACTTTTTAGG + Intergenic
1001217726 5:169871614-169871636 ATCTTAGTGTAGAAGCTTTGGGG - Intronic
1004762220 6:18679894-18679916 ATTTTCTTGTAGAAGTTTTATGG - Intergenic
1004961001 6:20788412-20788434 ATGTTCTTCTGTAAGCTTTATGG + Intronic
1005186400 6:23167128-23167150 TGCTACCTCAAGAAGCTTTATGG + Intergenic
1005748247 6:28859986-28860008 ATTTTTCTCAAGAAGCTCTATGG + Intergenic
1005834779 6:29700306-29700328 ATATTCTTCCAGAAGTTTTATGG + Intergenic
1006197874 6:32258201-32258223 ATTTTCTTCTAGGAGTTTTATGG + Intergenic
1007872440 6:45055708-45055730 GTTATCCTCTAGAATCTTTATGG - Intronic
1008551314 6:52634434-52634456 TTTTTTTTCTAGAAGCTTTATGG - Intergenic
1008774607 6:55022445-55022467 GTTTTTTTCTAGAAGCTTTATGG - Intergenic
1009319473 6:62269137-62269159 ATTTTCTTCTAGAAGCTTTATGG - Intronic
1010134396 6:72533246-72533268 AATTTCCTCTAGAAGCTGTGTGG + Intergenic
1010579932 6:77583105-77583127 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1010811240 6:80301153-80301175 ATTTTCCTCTGCTAGCTTTAGGG - Intronic
1011592094 6:88979786-88979808 ATTTTCTTCTAGAATTTTTATGG + Intergenic
1011650323 6:89500136-89500158 TCCTTCCTCTAGAAGCATCAAGG - Intronic
1011751631 6:90460432-90460454 ATCTTCCACTAGGGGATTTAGGG - Intergenic
1012026227 6:93995487-93995509 AACTTTCTCTAGAATATTTAAGG + Intergenic
1012565824 6:100649425-100649447 TTATTCCTATAGAAGCTATAGGG + Intronic
1013187580 6:107773832-107773854 AACTTCTTCTACAAGCTTTTGGG - Intronic
1013450198 6:110273069-110273091 ATTATCCTCTAGAATTTTTATGG + Intronic
1014279297 6:119422973-119422995 ATTTTCTTCTAGAATTTTTATGG - Intergenic
1014993922 6:128117263-128117285 TTCTTCCTAGAGGAGCTTTAGGG - Intronic
1015133774 6:129844590-129844612 AGCTGCCTCCTGAAGCTTTAAGG + Intronic
1015473439 6:133632812-133632834 ATCTCAACCTAGAAGCTTTATGG - Intergenic
1016203312 6:141440476-141440498 CTTTTCTTCTAGAAGTTTTAAGG + Intergenic
1016645603 6:146404823-146404845 ATCATCATGTATAAGCTTTAGGG + Intronic
1016807892 6:148231081-148231103 GTTTTCTTCTAGGAGCTTTATGG + Intergenic
1017349540 6:153423503-153423525 ATTTTCTTCTAGAAACTTTATGG + Intergenic
1018047060 6:159974842-159974864 CTCTGCCTCTAGAAGTTTTTTGG + Intronic
1018151197 6:160940921-160940943 ATTTTCTTCTAAAAGCATTATGG + Intergenic
1018315594 6:162553560-162553582 TTCTTTCCCTTGAAGCTTTAGGG - Intronic
1018865126 6:167740543-167740565 ATTTTCTTCTCGAAGCATTAGGG + Intergenic
1018995590 6:168707714-168707736 AGCTTCCTCTAGAAGTGTCAGGG + Intergenic
1019585266 7:1798504-1798526 ATTTTATTGTAGAAGCTTTATGG - Intergenic
1020820374 7:12959592-12959614 ATTTTCTTCTAGAATTTTTATGG + Intergenic
1020871469 7:13634998-13635020 TTTTTCTTCTAGAAGTTTTATGG - Intergenic
1020956306 7:14743542-14743564 CTCTTCTTCTAGATGCTCTAGGG - Intronic
1021160417 7:17265614-17265636 ATTTTCTTCTAGGAGTTTTATGG + Intergenic
1021171297 7:17400962-17400984 ATGTTCCTCTAGAATTTTTCAGG - Intergenic
1021183708 7:17538081-17538103 TTTTTCTTCTAGAATCTTTATGG - Intergenic
1021666982 7:22993281-22993303 ATTTTCTTCTAAAAGCCTTATGG - Intronic
1022407018 7:30099966-30099988 ATCTCCCTCTGAAGGCTTTAGGG + Intronic
1022775160 7:33519685-33519707 TTCTTCCCCTAGAAGATTCATGG - Intronic
1022987349 7:35669787-35669809 ATCTACTTCAAGAAGATTTAGGG + Intronic
1023201793 7:37706099-37706121 TTCTTCCTCCAGAAGCTCTCGGG + Intronic
1024693372 7:51827573-51827595 ATCTTCCTGCAGAGGCTTTGGGG + Intergenic
1027537955 7:79430482-79430504 ATGTTTCTTTAGTAGCTTTATGG - Intronic
1027594843 7:80160092-80160114 ATCTTCCCAGAGAGGCTTTAAGG - Intronic
1027842637 7:83332669-83332691 ATTTTGTTCCAGAAGCTTTATGG - Intergenic
1029333806 7:99882854-99882876 GTTTTCCTCTAGGAGTTTTATGG + Intronic
1030561746 7:111095685-111095707 ATCATCCACTATAAGTTTTAAGG + Intronic
1030883239 7:114906802-114906824 ATTTTCTTTGAGAAGCTTTATGG - Intergenic
1031517113 7:122714991-122715013 TACTCCCTCTAGAAGCTCTAGGG - Intronic
1031713939 7:125083623-125083645 GTTTTCCTCAAGAAGCTTTAGGG + Intergenic
1033531445 7:142268026-142268048 CTCTACCTCTATAAGCTTTCTGG - Intergenic
1033670008 7:143482762-143482784 TTGTTTTTCTAGAAGCTTTATGG + Intergenic
1034031485 7:147771235-147771257 ATTATCTTCTAAAAGCTTTATGG - Intronic
1034229732 7:149513082-149513104 GTCATCTTCTAGAATCTTTATGG + Intergenic
1035684893 8:1516875-1516897 CTCATCCTCTTGAAGCTGTAGGG - Intronic
1036401988 8:8417176-8417198 ATCCTACTCAAGAAGCTATAAGG - Intergenic
1037478456 8:19280332-19280354 ATTTTACTTTAGTAGCTTTAAGG + Intergenic
1037587224 8:20286041-20286063 GTTTTCTTCTAGATGCTTTAGGG - Intronic
1039401358 8:37272311-37272333 ACCTTCCTCTACAGGCTTAAAGG + Intergenic
1040623752 8:49120132-49120154 AGCTTCCTCTAAAAGATATATGG - Intergenic
1040699783 8:50047799-50047821 ATCTTCATCTAGAATCTCTAAGG - Intronic
1041319140 8:56595542-56595564 ATCTTCCTCGAGAAGCATTGTGG - Intergenic
1042886516 8:73558460-73558482 ATCTTCCTGGAGCATCTTTATGG + Intronic
1042941888 8:74116213-74116235 AACTTCCTCTACAAGGTTTGAGG - Intergenic
1043292982 8:78627271-78627293 GTTTTCTTCTAGAAGTTTTAGGG - Intergenic
1044797042 8:95912200-95912222 GTTTTCTTCTAGAAGTTTTATGG + Intergenic
1045041683 8:98230505-98230527 ATCCTCCTCTGGGAGATTTACGG - Intronic
1045837847 8:106544424-106544446 ATCTTGCTTTAGAAGCTAAAAGG + Intronic
1046042633 8:108924666-108924688 ACTTTTCTCTAGGAGCTTTAAGG + Intergenic
1046698023 8:117364550-117364572 GTTCTCCTCTAAAAGCTTTATGG + Intergenic
1048693203 8:136990595-136990617 CTTTTCCTCTAGAAGCTTTGTGG + Intergenic
1050719460 9:8569220-8569242 CTTTTCCTCTGGAAGTTTTAAGG - Intronic
1051239242 9:15034694-15034716 ATTTTCCTCTCAAAACTTTATGG - Intergenic
1051582431 9:18691914-18691936 ATTTTCCTAGAGAATCTTTAAGG + Intronic
1051634465 9:19169217-19169239 TGTTTCCTCTAAAAGCTTTATGG - Intergenic
1051805756 9:20990846-20990868 ATCTTCTTGTAGCATCTTTAAGG + Intronic
1052253960 9:26431729-26431751 ATTATCATCTAGAATCTTTATGG - Intergenic
1053335060 9:37260768-37260790 ATACTCCTCTAGGAGCCTTATGG + Intronic
1055895693 9:81172835-81172857 GTGTTCTTCTAGAAGTTTTATGG + Intergenic
1056397053 9:86191555-86191577 ATTATCTTCTAGAATCTTTACGG - Intergenic
1057266798 9:93622626-93622648 AGCTCCCTCTGGAAGCTCTAGGG - Intronic
1057398295 9:94700025-94700047 CTCTTCCTCCAGAAGGTATAGGG - Intergenic
1057532758 9:95867332-95867354 ATATTACTTTAGAATCTTTATGG + Intergenic
1058739897 9:107932511-107932533 ATGTTCCTCTAGATCTTTTAGGG - Intergenic
1058817688 9:108700467-108700489 ATTTTCTTCTAGAACATTTAAGG + Intergenic
1059056765 9:110991116-110991138 GTTTTCCTCTAGAAGTTTTATGG - Intronic
1060938266 9:127528286-127528308 ATCTCCTTCCAGAAGCTTTCTGG - Intronic
1061559085 9:131391237-131391259 ATTTTCTTCTGGAGGCTTTAGGG + Intergenic
1203452258 Un_GL000219v1:130049-130071 GTCTTCTTCCAGAAGTTTTATGG - Intergenic
1185543914 X:926512-926534 TGCTTCCTCTGGAAGCTCTAGGG + Intergenic
1187034269 X:15521545-15521567 TGTTTCCTCTGGAAGCTTTAGGG + Intronic
1187074869 X:15924400-15924422 GTTTTCTTCTAGAAGCTTTATGG + Intergenic
1187258608 X:17664295-17664317 ATTTTCTTCTAGGAGTTTTATGG + Intronic
1187530164 X:20089089-20089111 ATTTTCTTCTAGAAGTTTTATGG + Intronic
1187589253 X:20698181-20698203 ATCATCTTCTAGAATCCTTATGG - Intergenic
1190422087 X:50295360-50295382 TTATTCCATTAGAAGCTTTACGG + Intronic
1191293989 X:58838704-58838726 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1191413315 X:60434417-60434439 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1191462428 X:61091562-61091584 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1193430311 X:81393818-81393840 GTTATCCTCTAGAATCTTTACGG - Intergenic
1193989617 X:88290194-88290216 ATCATCTTCTAGAATTTTTATGG - Intergenic
1194058760 X:89170441-89170463 ATCATCTTCTAGAATATTTATGG - Intergenic
1194281319 X:91957755-91957777 ATCTGCCCCTAGAAGCTGTCTGG + Intronic
1194404102 X:93472805-93472827 ATCTTTCAGTAGAATCTTTAGGG - Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1195237453 X:102915505-102915527 ATTATCTTCTAGAATCTTTATGG - Intergenic
1195797265 X:108664456-108664478 GTTTTCCTCTAAAAGCATTATGG - Intronic
1195938343 X:110146040-110146062 ATTTTCCTCACGAGGCTTTAAGG + Intronic
1196685862 X:118509798-118509820 CACTTCCTCCAGAAGCTGTAGGG + Intronic
1197405339 X:126041469-126041491 ATCATCCTGAAGAAGCTGTATGG + Intergenic
1198914468 X:141652584-141652606 AACCTCCTCTATATGCTTTATGG + Intronic
1199174315 X:144766894-144766916 ATCTTCCTTTAGAATTTTTAAGG + Intergenic
1199334603 X:146603710-146603732 ATTTTCTTCTAGGAGGTTTATGG + Intergenic
1199343110 X:146705714-146705736 ATTTTCCTCTTTAAGCTTTGGGG + Intergenic
1199549835 X:149047172-149047194 GTATTCTTCTAGAAGCTTAAAGG + Intergenic
1200598908 Y:5182411-5182433 ATCTGCCCCTAGAAGCTGTCTGG + Intronic
1202136265 Y:21667879-21667901 ATATTACTCTAGAAGCTAAAAGG - Intergenic