ID: 929630034

View in Genome Browser
Species Human (GRCh38)
Location 2:43450326-43450348
Sequence AAGATATAAATCTGTGACAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929630034 Original CRISPR AAGATATAAATCTGTGACAT CGG Intronic
901804690 1:11730874-11730896 AAGATTGAATTCTGTGCCATCGG + Intergenic
903276774 1:22226982-22227004 AAGAAATAAAACTGAGACACGGG - Intergenic
904052405 1:27647703-27647725 AAGATATAAAGCTGTGTTTTCGG + Intergenic
907354990 1:53864919-53864941 AATTTCTTAATCTGTGACATGGG - Intronic
907758170 1:57331344-57331366 AATTTATAAATTTGTAACATAGG - Intronic
908865010 1:68537779-68537801 AAGAAAGAAAACTGTGAGATAGG - Intergenic
912026952 1:105188459-105188481 AAGCTTTAAATGTATGACATTGG + Intergenic
912641775 1:111353135-111353157 ATTATATAAATCTGTCACTTTGG - Intergenic
914322012 1:146574142-146574164 AAGTTAGAAAAATGTGACATTGG - Intergenic
914885208 1:151578923-151578945 TAGCTATAAATGTTTGACATGGG - Intronic
916713035 1:167428987-167429009 AAGATGTAGATCTGTTTCATGGG - Intergenic
916917434 1:169424033-169424055 AGGATATAAATAGGTGACTTTGG - Intronic
917542087 1:175923930-175923952 GACACATTAATCTGTGACATTGG - Intergenic
917610317 1:176682796-176682818 AAGTTATAAAACTGTGACTTGGG - Intronic
917728408 1:177849582-177849604 AATTTATAATCCTGTGACATGGG - Intergenic
917826932 1:178832053-178832075 AAAATATAGTTATGTGACATAGG - Intronic
918802662 1:188991991-188992013 AAGGTCTAAGTCTGTGACAACGG + Intergenic
919071900 1:192766356-192766378 AAAATAAAAAGCTGTAACATTGG - Intergenic
919394254 1:197024345-197024367 AATATATGAATTTGTGACTTTGG - Intergenic
920249268 1:204612139-204612161 AATATCTAAATCTGTAAAATGGG + Intergenic
920756155 1:208735698-208735720 CAGATATAAATGTGTGCCCTTGG - Intergenic
921274153 1:213501194-213501216 AAGATATAAATGTATTACAACGG + Intergenic
921552138 1:216550316-216550338 AAGATGCAAATGTGTCACATCGG - Intronic
923017628 1:230139215-230139237 TAAATATAAATCTCTGAAATGGG - Intronic
923816475 1:237384700-237384722 AATATATAAATGTGAGACACAGG + Intronic
924106234 1:240652020-240652042 AACATATTAATCAGTGAAATAGG - Intergenic
1063080016 10:2758763-2758785 AACATAAAAAGCTGTGAGATAGG - Intergenic
1063193179 10:3717217-3717239 ACGGTATTAATCTGAGACATAGG + Intergenic
1063825306 10:9890806-9890828 GACAAACAAATCTGTGACATAGG - Intergenic
1063878560 10:10507357-10507379 AACAAATAATCCTGTGACATTGG - Intergenic
1065529109 10:26650905-26650927 AAGGTATTTATCTGTCACATAGG - Intergenic
1065791834 10:29267665-29267687 CAGATGTTACTCTGTGACATTGG + Intergenic
1067036572 10:42925212-42925234 AAAATATAAATCAGTGATTTGGG - Intergenic
1068438963 10:57027119-57027141 AAGATAAAAATATTTGATATGGG + Intergenic
1069329288 10:67272064-67272086 AAGATACAAAGTTGTGACAGAGG - Intronic
1069377357 10:67806887-67806909 AAGATGTAATTCTGTTACACAGG - Intronic
1071428907 10:85588630-85588652 AAGATATAAAACTCTTTCATAGG + Intergenic
1074056935 10:109930912-109930934 AAAATAAAAATCTGTGTCTTCGG + Intergenic
1074839697 10:117337786-117337808 AAGTTACACATCTGTGAAATGGG - Intronic
1077772675 11:5237387-5237409 ATGATTTTAATCTGTGACCTTGG + Intergenic
1077797929 11:5510245-5510267 AAGACAGAAAACTGGGACATAGG - Intronic
1078647072 11:13150574-13150596 TAGATATAAACGTGTGGCATAGG - Intergenic
1080733788 11:34989225-34989247 AAGACATAAATATATGACAGTGG - Intronic
1081188509 11:40075097-40075119 AAGAATTAAATCTGTGAGACTGG - Intergenic
1081290853 11:41323800-41323822 AAAATATAAATTTGGGAGATGGG + Intronic
1083079773 11:60078699-60078721 AAGTTATAAATGTTTGGCATAGG + Intergenic
1085454599 11:76658654-76658676 AAAATATAGAGCTGTCACATAGG + Exonic
1086764537 11:90678099-90678121 ATGATATAAATCATTGAGATAGG - Intergenic
1087282748 11:96230287-96230309 AACATATAAATCTTTGAAAGAGG - Intronic
1087873634 11:103329081-103329103 AAGAAGTACATCTGTGACAGAGG + Intronic
1090220425 11:125017583-125017605 AATATATAAACCAGTAACATAGG - Intronic
1090640389 11:128724775-128724797 AAGAAACAAATCTGGGACACTGG - Intronic
1092669837 12:10850568-10850590 AAGATATAAAACATAGACATAGG - Intronic
1092854572 12:12660762-12660784 GAAATATAAATCTCTGAGATAGG + Intergenic
1094019186 12:25896238-25896260 AAGATATGATTCTGTGCTATGGG - Intergenic
1094759300 12:33511954-33511976 AAGAGATATATCTGTGAGATTGG - Intergenic
1094868430 12:34569026-34569048 AAGGTTTAACTCTGTGAGATGGG + Intergenic
1095263689 12:40128468-40128490 AAGACAGAAATCATTGACATTGG - Intergenic
1095809059 12:46352723-46352745 AAGATATAAACTGGTGACACTGG + Intergenic
1096903911 12:54915534-54915556 AAGAAATAATTCTATAACATTGG - Intergenic
1096932903 12:55235166-55235188 TAGTTATAAATCTGTGTTATTGG + Intergenic
1097883960 12:64710631-64710653 AAGATTTAGATGTGGGACATGGG - Intergenic
1098103981 12:67049996-67050018 AAGATGTAAACATTTGACATAGG - Intergenic
1098679104 12:73327602-73327624 AATATATAAACTTGTGTCATGGG - Intergenic
1099136898 12:78916852-78916874 AAGAAATGAATCTGTGAGAATGG - Intronic
1099957388 12:89363977-89363999 AGGATATAATTCTGTAACAAAGG + Intergenic
1100130315 12:91484738-91484760 AAAATAAAAATCTGTGGCACTGG + Intergenic
1100695480 12:97088155-97088177 TAGATAAATATGTGTGACATTGG + Intergenic
1101652149 12:106687051-106687073 CAGATTTAGATCTTTGACATTGG - Exonic
1103147134 12:118604603-118604625 AAGATCTCACTCTGTTACATAGG - Intergenic
1104621966 12:130320985-130321007 TAGATATATATCTGTAAAATTGG + Intergenic
1105422765 13:20267486-20267508 AAGAAATAAACCTTTAACATTGG + Intergenic
1105468273 13:20667741-20667763 AGGATATAAAACTGTGAAAATGG - Intronic
1107897636 13:44982012-44982034 AAGATATGAAACAGTAACATAGG + Intronic
1109364806 13:61340492-61340514 ATGATTTAACTCTGTGACTTTGG - Intergenic
1109451655 13:62522316-62522338 AAGAAATAAATATTTGACAGAGG + Intergenic
1109637382 13:65140153-65140175 AACATATGAATTTGTGACGTAGG + Intergenic
1109692627 13:65913005-65913027 AAGATATTAATCTCAGACTTAGG - Intergenic
1109703916 13:66063539-66063561 ACAATATAAATATTTGACATAGG - Intergenic
1110002179 13:70216761-70216783 TACATATAAATTTGTTACATAGG + Intergenic
1110880387 13:80565333-80565355 AATATAAAAATGTGTGACAGTGG + Intergenic
1111124566 13:83897705-83897727 AAAATATAATTCTGTGAATTTGG - Intergenic
1112213648 13:97407122-97407144 AAGACATTAAACTGGGACATTGG - Intergenic
1113480810 13:110619294-110619316 AAGATATGAATCTTGGATATTGG + Intronic
1117052690 14:51877398-51877420 AAGAAATAGATTTGTGAAATTGG - Intronic
1117072061 14:52066650-52066672 AAGATAGAGATCAGTGACATGGG + Intronic
1117974657 14:61285412-61285434 AGGATATAACTGTGTGACCTTGG + Intronic
1118902508 14:69998617-69998639 AAGATGTAAATCAGAGCCATAGG - Intronic
1119368312 14:74114793-74114815 AAGAAATCAATATGTGAAATAGG + Intronic
1120356261 14:83438215-83438237 TAGATATAAAACTGTTACCTAGG - Intergenic
1120672596 14:87380478-87380500 AAAATATAAATATGTAATATAGG + Intergenic
1121043351 14:90769011-90769033 AAGATATAATTTTGTGACATCGG + Intronic
1125323225 15:38510616-38510638 AGGATATAAATGTATGGCATGGG - Intronic
1126643550 15:50852707-50852729 AACATATAAATCTGAGGTATGGG + Intergenic
1127101902 15:55575098-55575120 AAGACACAACTCTGTGACCTTGG - Intronic
1127486580 15:59423468-59423490 AAGCGATAACTCTGTGACCTTGG - Intronic
1130019439 15:80215611-80215633 AATCTAAAAAGCTGTGACATTGG - Intergenic
1130271172 15:82449144-82449166 AAGATACAAATTTCTGACAGTGG - Intergenic
1130463509 15:84176490-84176512 AAGATACAAATTTCTGACAGTGG - Intronic
1130489162 15:84418301-84418323 AAGATACAAATTTCTGACAGTGG + Intergenic
1130500756 15:84497052-84497074 AAGATACAAATTTCTGACAGTGG + Intergenic
1133387347 16:5380358-5380380 AAGAGATACATCTGTGTGATGGG + Intergenic
1140011614 16:71137021-71137043 AAGTTAGAAAAATGTGACATTGG + Intronic
1140219724 16:73034835-73034857 AGGAGATAGAACTGTGACATTGG - Intronic
1146262864 17:31433150-31433172 AAGAAAAAAATCTGAGACAGTGG + Intronic
1146710720 17:35039205-35039227 AAGAAAAAAATCTGTCATATGGG - Intronic
1146762870 17:35493336-35493358 ATGATATAAATTTGGGAAATAGG - Intronic
1149237669 17:54612041-54612063 TAGATGTAAATGTGTGATATAGG + Intergenic
1151411866 17:73936184-73936206 CAAATATAAATGTGTGACACTGG + Intergenic
1153062751 18:1011107-1011129 AACATGTAAATCTGGGACAGTGG + Intergenic
1156144019 18:34153581-34153603 AAGATATAAATCAGTGAATATGG + Intronic
1157397493 18:47355060-47355082 AAGATTTAAATGTTTGACATTGG - Intergenic
1158885449 18:61822907-61822929 AAAATATAAATATTTGAAATGGG + Intronic
1159184889 18:64956898-64956920 AAAATATAATTCTGTGGAATTGG + Intergenic
1159393438 18:67826114-67826136 AATATATAATTCAGTGGCATTGG - Intergenic
1163048600 19:14663845-14663867 AATATATATATTTGTTACATAGG + Intronic
1165996950 19:39850317-39850339 AAGAAATAAATCTCTGTTATTGG + Intergenic
925526349 2:4806712-4806734 AAGATATAAGCAAGTGACATGGG - Intergenic
925530714 2:4858946-4858968 AAAATCTAAATGTGTCACATAGG + Intergenic
925636428 2:5945696-5945718 AAAATATAAATGTGTGAATTGGG - Intergenic
927262976 2:21112958-21112980 AATATATAATTCTCTTACATGGG + Intergenic
929630034 2:43450326-43450348 AAGATATAAATCTGTGACATCGG + Intronic
931212519 2:60211341-60211363 AACATATATTTCAGTGACATGGG + Intergenic
931635376 2:64336687-64336709 CAGATATAATTCTTTGTCATGGG + Intergenic
932930866 2:76036687-76036709 AAGATAGAAAACTGAGAAATAGG + Intergenic
933045673 2:77533528-77533550 TACAGATGAATCTGTGACATGGG - Intronic
933104213 2:78302272-78302294 AAGATTTGTATGTGTGACATGGG - Intergenic
935875853 2:107506263-107506285 AAGATATTAATATGGGAAATTGG - Intergenic
938007860 2:127802953-127802975 AAGATCTCAATCTGTTACCTAGG - Intronic
938960930 2:136341057-136341079 AAAATATAAATGAGTGAAATGGG + Intergenic
939100013 2:137884965-137884987 AAGATTTAAACCTATGACATAGG + Intergenic
939326060 2:140689997-140690019 AAAATATACATCATTGACATAGG + Intronic
939384008 2:141472913-141472935 AAGATGTAAATCTATGACAAAGG + Intronic
940038592 2:149335068-149335090 AATACATAAATCAGTAACATAGG - Intronic
941240840 2:163035767-163035789 AATATGTAAATGTGTGTCATGGG + Intergenic
941977343 2:171419867-171419889 GAGATTTAAATCAGTCACATGGG - Intronic
942521617 2:176809781-176809803 GAGATTTACATCTTTGACATAGG + Intergenic
942887036 2:180938449-180938471 AAGAAATAAAGATATGACATTGG - Intergenic
943049380 2:182896631-182896653 AGAATATAAAGCTGTGAGATTGG - Intergenic
943570480 2:189568067-189568089 AAGATGGAAATTGGTGACATTGG - Intronic
944779649 2:203004667-203004689 AAGGTATAAATGTGTGTGATAGG + Intronic
944998649 2:205323674-205323696 AGGATACAAATCTCTGTCATGGG + Intronic
945007487 2:205424026-205424048 AATAGATAAATCTGTGTTATGGG - Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
945728096 2:213498358-213498380 AAGATTTAGATCTATGACACAGG - Intronic
946283594 2:218684949-218684971 AAGATATACATCTGTGCTAAAGG + Intronic
1169373525 20:5047158-5047180 AAAATATGAATCTGAGAAATGGG - Intergenic
1169476365 20:5934602-5934624 ATAAAATAAATTTGTGACATGGG - Intergenic
1170673828 20:18460428-18460450 AAGATTTAAAGTTGTGACTTAGG + Intronic
1170773895 20:19358583-19358605 AAGATATAAGTCTGTGAAACTGG - Intronic
1172609925 20:36242881-36242903 AAGGTCTCACTCTGTGACATGGG + Intronic
1172827926 20:37806108-37806130 AAGTTTTAACTCTGTCACATTGG + Intronic
1177822527 21:26047118-26047140 AAGAGGTAAATCTTTAACATAGG - Intronic
1179378125 21:40870371-40870393 ATGATATCAATATGTGAAATAGG + Intergenic
1180571320 22:16723849-16723871 AAGAGATATAGCTGTGACCTTGG + Intergenic
1180572430 22:16739817-16739839 AAGATTTAAATATTTGCCATAGG + Intergenic
949151787 3:777785-777807 AAGAAATAAATATGTGGAATGGG - Intergenic
950478477 3:13229045-13229067 AACAAATAAGCCTGTGACATGGG + Intergenic
950886911 3:16370324-16370346 ATGATAAAAATCTGTTTCATCGG + Intronic
950906150 3:16540283-16540305 AAGATATTAATCTTTGGCAGAGG + Intergenic
951864810 3:27296003-27296025 AAGATATAAATCTAAGATATTGG - Intronic
955993178 3:64650400-64650422 GAGCAATAAATCTGTGACACAGG + Intronic
956204526 3:66741629-66741651 ATGGTAAAAATCTGTGACAGGGG + Intergenic
957105256 3:75879075-75879097 AAGATTTAAATATTTGCCATAGG - Intergenic
958077287 3:88696951-88696973 AAGATAAAGTTCTATGACATTGG - Intergenic
959397054 3:105854022-105854044 AACATATAAATGTGAGACATTGG - Intronic
959446811 3:106450495-106450517 AAGAAATAATTTTGTGACTTGGG + Intergenic
959758028 3:109922961-109922983 AACACATAAATCTGTCACAGAGG - Intergenic
960326163 3:116298585-116298607 TAGTCATTAATCTGTGACATAGG + Intronic
963029575 3:140955159-140955181 AAGATAAAAATATGTCATATTGG - Intronic
964997972 3:162911091-162911113 AAGATACAAATTTTTAACATTGG + Intergenic
965210265 3:165777412-165777434 AATATATAAATATGTAAAATAGG + Intronic
966102426 3:176287211-176287233 AAGTTGTAAATATGTGACATTGG - Intergenic
966542799 3:181110550-181110572 AAGATATAAACATTTGATATTGG - Intergenic
967329844 3:188279368-188279390 TAAATATAATTCTGTGACTTTGG + Intronic
968535876 4:1128884-1128906 AAGATATACCACTTTGACATGGG + Intergenic
969975308 4:11093940-11093962 AAGAAATAAATCATTTACATGGG + Intergenic
970768823 4:19585286-19585308 AACATATAAATCTGTGATTCGGG - Intergenic
971538070 4:27779917-27779939 AAAAAATAAATGTGTGAAATAGG + Intergenic
971739381 4:30501115-30501137 AATATATAAATATGAGAAATTGG - Intergenic
972241335 4:37196108-37196130 ATGATAGAAAACTGTCACATGGG + Intergenic
973014276 4:45118080-45118102 CATATATAAATCTGGCACATAGG - Intergenic
973779650 4:54276486-54276508 TAGATATAAATATTTGAAATTGG - Intronic
974358538 4:60844696-60844718 AAAATATATATCAGTGCCATTGG - Intergenic
974662969 4:64919129-64919151 AAGATAGAAATATGGGAGATGGG - Intergenic
975338178 4:73205796-73205818 AGGAGATAAATCTATGAAATGGG + Intronic
975457690 4:74611955-74611977 AAGATATAAATAAGCGAAATGGG + Intergenic
976012072 4:80502277-80502299 AAGATAAAAATCATTGCCATTGG - Intronic
976346455 4:84008480-84008502 AAACTATAAAACTCTGACATAGG - Intergenic
976385141 4:84448339-84448361 TAGATATACAACTGTGAAATAGG - Intergenic
976768692 4:88626981-88627003 AAGTTATAAATCAGTGATTTAGG - Intronic
976985012 4:91283112-91283134 ATAATATAATTCTGTGACAGAGG + Intronic
977194092 4:94037768-94037790 AAGATATAAATCAGTCAGCTTGG + Intergenic
977231802 4:94460203-94460225 AACATATAAAACTGCCACATGGG - Intronic
978070443 4:104461198-104461220 AAGATATAAATGTACAACATTGG + Intergenic
978104723 4:104887787-104887809 AAGAAATAACTCTGTGTCAAAGG - Intergenic
980202967 4:129678823-129678845 AACCTACCAATCTGTGACATTGG - Intergenic
981212269 4:142121696-142121718 AAGATATATTTCTGTGTCAGGGG - Intronic
981486628 4:145293735-145293757 AAGATATAAATCTATCAGATAGG + Intergenic
981744160 4:148036145-148036167 ATGATATAATTCCGTGACCTAGG + Intronic
981795696 4:148592917-148592939 AAGAGACTCATCTGTGACATAGG - Intergenic
982530674 4:156538846-156538868 AAAATATGAATCTGTGCTATTGG + Intergenic
982713392 4:158781493-158781515 AAAATGTAAATCTGTAACAAAGG - Intronic
983438288 4:167745961-167745983 AATATTTAAATCAGTAACATTGG - Intergenic
984449640 4:179883090-179883112 AAGTTAAAATTATGTGACATGGG - Intergenic
985524130 5:393287-393309 AAGACAAGAATCTGTGACATCGG - Intronic
985910920 5:2881669-2881691 AAGATAAAAAGGTGTAACATTGG + Intergenic
986514052 5:8542126-8542148 AACATAAAGATCTGTTACATAGG - Intergenic
987222937 5:15809038-15809060 CAGAGTTAAATCTATGACATTGG - Intronic
987582043 5:19806527-19806549 ACGATATAAATCTTTGACATTGG - Intronic
987608422 5:20170076-20170098 CATATGTAAATATGTGACATGGG + Intronic
988129344 5:27081985-27082007 CATATATAAACATGTGACATAGG - Intronic
988330860 5:29837999-29838021 ATTAAATAAATCTGTGAAATTGG + Intergenic
988548626 5:32180232-32180254 AGGATATTACTCTGTGACCTAGG - Intergenic
990926852 5:61035634-61035656 AAGACACAAATCTGTGCCAGGGG + Intronic
992558849 5:77930240-77930262 AAGTTATAATTCTGTTAAATTGG - Intergenic
992572874 5:78077736-78077758 AAGATATACATATGTAACCTTGG - Intronic
992694274 5:79269601-79269623 AAGCTATAAAACTCTGACAAAGG - Intronic
993024502 5:82630173-82630195 AAGAAATTAATCTGTCACATAGG + Intergenic
993439099 5:87933117-87933139 AATAAATAAATCTGTAAAATGGG + Intergenic
993764413 5:91837886-91837908 TAGACATAAATATGGGACATCGG + Intergenic
993983657 5:94571652-94571674 AAGACTTAAATCTGTGAAAGAGG - Intronic
994803264 5:104408052-104408074 AAGATACATATCTGTGATTTAGG - Intergenic
994804690 5:104429222-104429244 CATTTATAAATCTGTGACTTTGG - Intergenic
995160917 5:108980581-108980603 AACAGATTAGTCTGTGACATGGG - Intronic
996899105 5:128523274-128523296 AAGGTATAAATCTTTGCTATTGG + Intronic
997780441 5:136652469-136652491 AAGTTCTCAATCTGTGTCATAGG + Intergenic
997952144 5:138250962-138250984 AAGCTATTAATATGTGACCTTGG - Intergenic
1000552345 5:162682588-162682610 AAGACAGAAATCTGTAACTTTGG - Intergenic
1001847740 5:174936761-174936783 AAGACATAAATGTGAGACTTTGG + Intergenic
1003729875 6:8809536-8809558 AATTTTTAAATCTGTAACATTGG - Intergenic
1003769076 6:9277191-9277213 AAGATTTAAATCTAAGACCTTGG - Intergenic
1003957984 6:11183250-11183272 AATATTTAATTCTGTGACAGAGG + Intergenic
1005160752 6:22859936-22859958 AAGATAAAAATGTGTGACAGAGG - Intergenic
1006235663 6:32629429-32629451 AACATGTAAATATGTGTCATAGG + Intronic
1006482351 6:34307110-34307132 GAGATATAATTCTGAAACATTGG + Intronic
1007951220 6:45874146-45874168 AAGATGCAAATGTGTCACATGGG - Intergenic
1008162451 6:48095312-48095334 AAGATATACCTGTCTGACATAGG + Intergenic
1008841277 6:55907821-55907843 AAGATATAAATCTGTATATTTGG - Intergenic
1009260143 6:61475989-61476011 AAGTTTTAACTCTGTGAGATGGG - Intergenic
1009363693 6:62841762-62841784 AAGTTGTACATCTGTGATATTGG - Intergenic
1010714837 6:79216565-79216587 AAGAGAGAAATCCATGACATGGG - Intronic
1011036311 6:82979634-82979656 AAGATGTAATTTTGTTACATGGG + Intronic
1012030943 6:94061967-94061989 AAGTTGAAAATCTGTGAAATTGG + Intergenic
1012603190 6:101123798-101123820 AAAATATACATCTAAGACATAGG - Intergenic
1012874363 6:104708979-104709001 TAGATATAAATCTCTGTCCTTGG + Intergenic
1014087007 6:117358224-117358246 AAGATATAAATTTGTAGCACTGG - Intronic
1014976710 6:127894005-127894027 AAGATGTAACTCTCTAACATAGG + Intronic
1016567955 6:145478587-145478609 AAGTTAGAATTCTGTTACATTGG - Intergenic
1016586383 6:145691024-145691046 AAGATCTAAATTTATGTCATTGG + Intronic
1016602873 6:145882571-145882593 AAGACATAATTCTGTGACAAAGG + Intronic
1018379755 6:163247925-163247947 AAGATACACTTCTGTAACATTGG + Intronic
1019271620 7:152413-152435 AAAAAAAAAATCTGTGACAATGG - Intergenic
1019856575 7:3614451-3614473 AAGTTATAAAACTCTGACCTGGG - Intronic
1020746373 7:12083499-12083521 AATATAAACATATGTGACATGGG - Intergenic
1020816583 7:12912931-12912953 AAGGTATAAAGATGTGAAATAGG + Intergenic
1022641437 7:32188537-32188559 TAAATAAAAATATGTGACATAGG - Intronic
1024312856 7:47985425-47985447 AAGAAATAGCTCTATGACATAGG - Intergenic
1024839511 7:53568970-53568992 AGAATATAAATGTGAGACATTGG + Intergenic
1025523026 7:61764940-61764962 AAAATTTAACTCTGTGAAATGGG + Intergenic
1025524868 7:61792751-61792773 AATATTTAACTCTGTGAGATGGG + Intergenic
1025546778 7:62183969-62183991 AAAATTTAACTCTGTGAAATGGG + Intergenic
1027799559 7:82734492-82734514 GAGAAATAAATCTGTGAGGTGGG + Intergenic
1027984593 7:85271127-85271149 AAGATATAAATTTGAGATAACGG + Intergenic
1028047714 7:86143745-86143767 AAGATATAATAATGTGGCATTGG - Intergenic
1028176393 7:87664744-87664766 AATATATAAGTTTGTGTCATTGG + Intronic
1028873625 7:95795832-95795854 CTTATATAAATTTGTGACATGGG - Intronic
1029108413 7:98196730-98196752 AAGATGAAGATCTGTGACAAGGG + Intronic
1031588103 7:123557220-123557242 AATAAATAAAAATGTGACATCGG + Intronic
1031594798 7:123637628-123637650 AAGATATATAACTGTAAGATTGG - Exonic
1031802355 7:126264088-126264110 AATAAACAAATCTGTGACAAAGG + Intergenic
1032250902 7:130256419-130256441 AAGGAATCAATTTGTGACATGGG + Intergenic
1033003185 7:137530071-137530093 AAAAAATAAATCTGTGACTCTGG - Intronic
1033531683 7:142270566-142270588 AAGATATTAAGCTGAGAAATCGG - Intergenic
1035931020 8:3780120-3780142 CTGATATAAACCTGTGCCATCGG + Intronic
1037165951 8:15828740-15828762 AAGATATAAATATGTGGCAAAGG - Intergenic
1037444733 8:18953986-18954008 AAGATATCAAACAGTGACACAGG + Intronic
1038268838 8:26058935-26058957 AAGATAAAACTCTCAGACATGGG - Intergenic
1038615787 8:29093225-29093247 GAGCTATACATCTGTGTCATTGG - Intronic
1039440765 8:37593919-37593941 AATTTCTAAATCTGTGAAATGGG - Intergenic
1040118986 8:43659700-43659722 AAGGTTTAAATCTATGAAATGGG - Intergenic
1040134618 8:43838295-43838317 AAGCTTTAACTCTGTGAGATGGG - Intergenic
1041963601 8:63648683-63648705 AAGATAAAAAGCAGTGAAATTGG + Intergenic
1042359028 8:67861395-67861417 AAGAAATACATCTTTGTCATTGG - Intergenic
1043732088 8:83695197-83695219 AATATATAAATCTGGAACTTGGG + Intergenic
1043784187 8:84376505-84376527 AAGACAGAAATCTGTGTTATGGG + Intronic
1043852471 8:85230331-85230353 AATACATACTTCTGTGACATAGG + Intronic
1044564388 8:93647544-93647566 AAGAGAGAAATCAGTGAAATAGG + Intergenic
1044640444 8:94374782-94374804 AAAATATGAAACTGTGACAGTGG - Intronic
1044954380 8:97464409-97464431 ATTATATAAATTTGTGTCATGGG - Intergenic
1045181728 8:99791434-99791456 AAGATATACATCTATGTGATGGG + Intronic
1045941566 8:107745062-107745084 AAGATTTAACTCTGTGACAGAGG + Intergenic
1046221109 8:111216119-111216141 AAGTTATAAATATCTGAAATGGG - Intergenic
1046506521 8:115144855-115144877 AAGTTATAAACCTGAGAAATGGG - Intergenic
1047832604 8:128652556-128652578 GACATATAAATCTGTGATGTAGG - Intergenic
1050113041 9:2236123-2236145 AACATATAAAGCTGTGTCTTTGG - Intergenic
1050595031 9:7196511-7196533 AACATATAAATATGTGTAATGGG - Intergenic
1053480032 9:38409764-38409786 AAAATGTAAAACTGTGAAATAGG - Intronic
1056083974 9:83126553-83126575 AAGATCTATATCTGAGGCATGGG - Intergenic
1056173519 9:84011738-84011760 TAGATGTAAATCTGTGACCGTGG + Intergenic
1056569083 9:87800275-87800297 ATTATATGAATCTGTAACATAGG - Intergenic
1058017066 9:100045624-100045646 AAGAAATAATACTGTGACTTTGG + Intronic
1186862540 X:13687961-13687983 AAAATACAAATCTGTTAAATTGG - Intergenic
1187085547 X:16039395-16039417 AAGATATAAGACATTGACATGGG - Intergenic
1189078754 X:37946134-37946156 AAAATATAAACCAGAGACATAGG + Intronic
1190535190 X:51419243-51419265 AAGATGTAATTCTGAGACATTGG + Intergenic
1191261254 X:58324499-58324521 AATGTTTAAATCTGTGAGATGGG - Intergenic
1193041878 X:77012409-77012431 AATCTATAAGTCTGTAACATTGG + Intergenic
1193291932 X:79784084-79784106 GAAATATAAATCTATGAAATAGG + Intergenic
1193658232 X:84224515-84224537 AAGATATAAATATGTTATACTGG - Intergenic
1194339226 X:92688739-92688761 AAGATATAAATATGTGACCTGGG - Intergenic
1196288273 X:113908464-113908486 AAGAAATAAGTGTATGACATTGG + Intergenic
1200647613 Y:5805520-5805542 AAGATATAAATATGTGACCTGGG - Intergenic
1201098365 Y:10652493-10652515 AAGATCTAACTCTGTCACACCGG + Intergenic
1201100610 Y:10668803-10668825 AAGATCTCACTCTGTCACATTGG + Intergenic
1201853740 Y:18517655-18517677 AAGGTATAATTCAGTGACACAGG + Intergenic
1201879581 Y:18802729-18802751 AAGGTATAATTCAGTGACACAGG - Intronic
1202371683 Y:24202130-24202152 AAGATACAAATTTCTGACAGTGG + Intergenic
1202499102 Y:25467986-25468008 AAGATACAAATTTCTGACAGTGG - Intergenic