ID: 929631136

View in Genome Browser
Species Human (GRCh38)
Location 2:43463334-43463356
Sequence GTGGAGTCCTTTGGAAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929631131_929631136 5 Left 929631131 2:43463306-43463328 CCTCAAAACAGATCAAAGCAAAC 0: 1
1: 1
2: 4
3: 72
4: 722
Right 929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 148
929631128_929631136 28 Left 929631128 2:43463283-43463305 CCAACAGGTATAAAGAGACCAGC 0: 1
1: 0
2: 1
3: 9
4: 146
Right 929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 148
929631129_929631136 10 Left 929631129 2:43463301-43463323 CCAGCCCTCAAAACAGATCAAAG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 148
929631130_929631136 6 Left 929631130 2:43463305-43463327 CCCTCAAAACAGATCAAAGCAAA 0: 1
1: 0
2: 2
3: 112
4: 747
Right 929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929631136 Original CRISPR GTGGAGTCCTTTGGAAATCT TGG Intronic
901391795 1:8950815-8950837 GTGGAGTACAGTGGTAATCTCGG - Intronic
905886636 1:41495391-41495413 GTGGAGTTCTTTGGAGCTGTGGG - Intergenic
906113428 1:43339396-43339418 GTGGAGTTCTTGGGATCTCTGGG - Exonic
907512609 1:54972928-54972950 GTGGGGTTCTTTAGAAATCCTGG + Intergenic
908323731 1:63003085-63003107 GTGGAATCCTTGGGAGAACTAGG + Intergenic
911849340 1:102796870-102796892 GTGGTGCCCTTAGCAAATCTAGG + Intergenic
912651316 1:111441991-111442013 GTGGAATCCTTTGGGAATCAGGG - Intronic
915047817 1:153033330-153033352 TTGGAGGTGTTTGGAAATCTAGG - Intergenic
917657629 1:177142497-177142519 GTGGAGTAGTTTGGAAAGCCAGG + Intronic
917726728 1:177834957-177834979 TTGGAGATCATTGGAAATCTTGG + Intergenic
918366363 1:183812336-183812358 TTGGAGTTCTTTGGAGATTTTGG + Intronic
918400052 1:184154096-184154118 ATGGAGAGATTTGGAAATCTAGG - Intergenic
919659025 1:200225198-200225220 GTAGAATCCTTTGGAAAGGTGGG - Intergenic
1063123669 10:3122544-3122566 GTGGCGTCCTCAGGAAATCAGGG + Intronic
1064925723 10:20566679-20566701 AAGGAGTCCCTGGGAAATCTTGG + Intergenic
1064979557 10:21152329-21152351 TTGGATGCCTTTGGAATTCTTGG - Intronic
1065503685 10:26407993-26408015 ATGCAGTCCTTTAGGAATCTTGG - Intergenic
1067023076 10:42818989-42819011 GTGGAGGCCTTCAGCAATCTTGG + Intronic
1068618470 10:59149143-59149165 ATGTAGTCCTTTGGACACCTGGG - Intergenic
1068793625 10:61053769-61053791 TTGGAGTCCTTTGTAAGTTTGGG + Intergenic
1069626554 10:69871468-69871490 GGGGAGTCCTTGGGGAATGTGGG - Intronic
1069806819 10:71131540-71131562 CTGGAGTCCTTGGGAGATCTAGG - Intergenic
1070479275 10:76866128-76866150 GTGGAGTCCTTTTTATATCGAGG - Intergenic
1078852260 11:15175679-15175701 ATTGAGACCTTTGGAAATCATGG + Intronic
1078888199 11:15526937-15526959 CTGGAGTTCTTTGGGAATCATGG - Intergenic
1080962143 11:37173028-37173050 GTGGAGTCTTTTGGAAAGGCTGG + Intergenic
1083174133 11:60938807-60938829 GTGGAGTGCTGTGGAAGTCAGGG - Intronic
1083228970 11:61303107-61303129 GATGAGTGCTGTGGAAATCTTGG - Exonic
1084463424 11:69308806-69308828 GTGGGAGCCTTTGGAAAGCTGGG - Intronic
1084922472 11:72482313-72482335 GTGCATTCCCTTGGAAAACTGGG - Intergenic
1085589034 11:77739965-77739987 TTGGAGTTCTGAGGAAATCTTGG - Intronic
1086325551 11:85695189-85695211 TTGGGCTCATTTGGAAATCTTGG + Exonic
1087024936 11:93640553-93640575 GTCGTGTCATTTGGGAATCTAGG + Intergenic
1088777695 11:113101231-113101253 GTGGAGGCCATAGGAACTCTAGG - Intronic
1089047109 11:115511314-115511336 ATGCAGTCCTTTGGAAATTTAGG - Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094102933 12:26783050-26783072 GGGAAGTCCTTTTGAAAGCTGGG - Intronic
1095823554 12:46507592-46507614 GGGGACTCCCTTGGAAATGTTGG + Intergenic
1097597450 12:61651901-61651923 GTGGAGTATTGTGGATATCTTGG - Intergenic
1098985589 12:77008521-77008543 GTAAAGTGCTTTGCAAATCTAGG - Intergenic
1101288861 12:103345540-103345562 GTGCAGAACTTTGTAAATCTTGG + Intronic
1101463956 12:104928061-104928083 CTGGATTCCTTTGGTAATTTTGG + Exonic
1101530179 12:105566603-105566625 GTGGAGACCCTTGGAAGCCTTGG + Intergenic
1103179650 12:118899045-118899067 GAGGAATCATGTGGAAATCTGGG + Intergenic
1104422895 12:128651737-128651759 GTGGAGCCATGTGGATATCTGGG + Intronic
1109282469 13:60372745-60372767 GTGTAGTTCTTTGGAATACTGGG - Intergenic
1111919327 13:94394061-94394083 GAAGAGTCCTATGGAAATTTGGG - Intronic
1111933871 13:94539039-94539061 TTGGAGTTCTTTGGAAATGCAGG - Intergenic
1117725375 14:58667971-58667993 CTGAAGTCCTTTAGAAATGTTGG + Intergenic
1118562873 14:67106301-67106323 TTGGAGACCTTTGGAATTCCTGG + Intronic
1120595663 14:86432175-86432197 GTGGAGTGGCTTGGAAATGTTGG + Intergenic
1121454808 14:94031388-94031410 GAGGAGTCCTTAGGTAATGTGGG + Intronic
1123424225 15:20156169-20156191 GTGGAGGCCTTCAGCAATCTTGG + Intergenic
1123533446 15:21162698-21162720 GTGGAGGCCTTCAGCAATCTTGG + Intergenic
1124114084 15:26823745-26823767 GAGGAGTCCTTGTGTAATCTGGG - Intronic
1124150344 15:27172298-27172320 GAGTAGCCCTTTTGAAATCTTGG + Intronic
1129427399 15:75473656-75473678 GTGGAGACCTTTGGAAAAAAGGG + Intronic
1130336436 15:82960840-82960862 GTGAGGTCTTCTGGAAATCTGGG + Intronic
1132223479 15:100123075-100123097 GTGGGGTCCTTGGGAAAGTTGGG - Intronic
1133896739 16:9936729-9936751 TTGTAGGCCATTGGAAATCTTGG - Intronic
1134635004 16:15785530-15785552 CTGGAGGCCCTTGGAGATCTAGG - Intronic
1136511768 16:30742367-30742389 CTGGAGGCCCTTGGGAATCTGGG - Intronic
1137488143 16:48908860-48908882 TTGGAGTCCTTTGCAATTGTGGG + Intergenic
1140808581 16:78555712-78555734 GTGGAGTCATTTGGAACTGCAGG - Intronic
1140892553 16:79297736-79297758 ATGGAGTTCTGTGGAAATGTGGG + Intergenic
1143610892 17:8016732-8016754 CTGGAGTGGTTTGGAAATCCAGG + Intronic
1147543796 17:41382614-41382636 GTGGAGTTGTTTGGGAATCAGGG + Intronic
1148863743 17:50618105-50618127 GTGGAGCTCTTTGGAGACCTGGG + Exonic
1149659403 17:58326517-58326539 GTGGGGTCCTTGGCAACTCTAGG + Intronic
1149667563 17:58376243-58376265 GAGGGGTCCCTTGGATATCTTGG + Intronic
1151782273 17:76255166-76255188 TTGGAGTGCTGTGGAGATCTCGG + Intergenic
1157092413 18:44651897-44651919 GTTTAGTCCTTTGGAAATTATGG + Intergenic
1161100695 19:2419829-2419851 GTTGAGCCCTTCAGAAATCTGGG - Intronic
1162350274 19:10144666-10144688 GTTGTGTCCCTTGGATATCTGGG - Intronic
1165753207 19:38274332-38274354 ATGGAGTTCTTTGAAACTCTTGG + Intronic
929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG + Intronic
931639865 2:64372353-64372375 GTGGATCTCTTTGGAAAGCTGGG - Intergenic
934537897 2:95151485-95151507 GTGCAGCCCTGTGGACATCTTGG + Intronic
935859209 2:107309886-107309908 TTTGAGTCCTTGGCAAATCTCGG + Intergenic
938400519 2:130987227-130987249 GGGGAGTCCTTCTGGAATCTGGG - Intronic
938572431 2:132572649-132572671 GCGGACTCCTATGGATATCTGGG - Intronic
939020818 2:136956343-136956365 GTGGTGTGTTTTGCAAATCTGGG + Intronic
944327523 2:198424240-198424262 TTGGTGTCCTCTGCAAATCTGGG + Intronic
945590324 2:211721035-211721057 GTGCTTCCCTTTGGAAATCTGGG + Intronic
946972447 2:225109776-225109798 GTGTAGTCCTCTGGAACTCTGGG + Intergenic
948218316 2:236248818-236248840 GTGGAGACCTTTTGGAATCTTGG - Intronic
948339361 2:237237227-237237249 GCTGAGTCCTTTGGAAGCCTAGG + Intergenic
1169308843 20:4518005-4518027 GTGGACTCCTCTAGAAGTCTGGG + Intergenic
1169757349 20:9057344-9057366 AAAGAATCCTTTGGAAATCTTGG + Intergenic
1170036918 20:11999233-11999255 TTGGATGTCTTTGGAAATCTGGG + Intergenic
1171723182 20:28587054-28587076 GTTGATTCTTTTGGAAAACTTGG + Intergenic
1171754863 20:29096053-29096075 GTTGATTCTTTTGGAAAACTTGG - Intergenic
1171787789 20:29486494-29486516 GTTGATTCTTTTGGAAAACTTGG + Intergenic
1171860162 20:30392902-30392924 GTTGATTCTTTTGGAAAACTTGG - Intronic
1174144708 20:48443642-48443664 GTAAATTCCTTTGGAAATGTTGG + Intergenic
1177417434 21:20812626-20812648 ATGAAGTCCTTTGGACAGCTGGG - Intergenic
1180296744 22:10945704-10945726 GTTGATTCTTTTGGAAAACTTGG + Intergenic
1180411864 22:12619856-12619878 GTTGATTCTTTTGGAAAACTTGG - Intergenic
1183742641 22:39677398-39677420 GTGGAGCTCTTTGGGAAGCTGGG + Exonic
1185082064 22:48715014-48715036 TTAGAGTCCATTGTAAATCTAGG + Intronic
951141000 3:19159877-19159899 GTGGAGTCAGTTGGAAATATGGG + Intronic
952467254 3:33602564-33602586 GTGAAGCCTTTTGGAGATCTGGG - Intronic
952530563 3:34258142-34258164 GCAGAGTCCTGTGGAATTCTGGG + Intergenic
954280284 3:49572451-49572473 GTGGTATCCTTTGGAACTCAAGG + Intronic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
964940103 3:162148899-162148921 GTAGAGACAATTGGAAATCTTGG + Intergenic
969277918 4:6149448-6149470 GTGGAGTCCCAGTGAAATCTAGG + Intronic
971992549 4:33918423-33918445 GTCTAGTCATTTAGAAATCTTGG - Intergenic
973070526 4:45852585-45852607 GAGGAGTCCTTTGGTTTTCTAGG + Intergenic
977012055 4:91648529-91648551 GTGGCTTCCTTTTGAAATTTAGG + Intergenic
983252893 4:165364971-165364993 GTGGAGCCCTGAGGAAATCCAGG + Intronic
983770874 4:171547387-171547409 GTGCAGACATTTTGAAATCTAGG + Intergenic
985280308 4:188280000-188280022 GTAGAGTACTTGGGAAGTCTGGG + Intergenic
985438329 4:189956730-189956752 GTTGATTCTTTTGGAAAACTTGG - Intronic
986257500 5:6112445-6112467 GTGGTTTCCTTAGGAAATATTGG - Intergenic
993785128 5:92122749-92122771 GCAGAGTCATTTGTAAATCTTGG + Intergenic
995702151 5:114948140-114948162 GTTAAGTCTTTTGGAATTCTGGG + Intergenic
996397699 5:123030029-123030051 TTGCTGTCCTTTGGAAAGCTGGG - Intronic
997992246 5:138554301-138554323 CTGGAGTACTTTGGAAATCCTGG + Intergenic
998786155 5:145711293-145711315 GTGGAGGCCATTAAAAATCTTGG + Intronic
1000967263 5:167673023-167673045 TTGGAATCTTTTGGAATTCTGGG - Intronic
1007776575 6:44227400-44227422 GTGGTGTCCTTTGGAATTGGGGG + Intronic
1014004873 6:116406639-116406661 ATGGAGTCCTTTATAAAGCTGGG + Intronic
1017483110 6:154877671-154877693 GTGGAGTCCTTTATCAATTTGGG + Intronic
1019119379 6:169791014-169791036 CTGGAGTCCCTAGGAAATCCAGG - Intergenic
1021782498 7:24119750-24119772 GTCGGGGCCTTTGGAAACCTTGG + Intergenic
1024695925 7:51856644-51856666 GTTAACTGCTTTGGAAATCTTGG + Intergenic
1030297979 7:107947870-107947892 GTGGGGACATTTGGAAATTTGGG - Intronic
1031421426 7:121556578-121556600 GTGGAGTCATGTGGTAGTCTAGG - Intergenic
1035788610 8:2283183-2283205 GTGGACTCGTTTGGAAAACGAGG + Intergenic
1035804195 8:2438522-2438544 GTGGACTCGTTTGGAAAACGAGG - Intergenic
1037917176 8:22779604-22779626 GAAGAGTCCTTTGGAAGGCTGGG + Intronic
1038083855 8:24172555-24172577 CTGCTGTCCTTTGAAAATCTTGG + Intergenic
1039053677 8:33516575-33516597 GTGGACTGCCTTGGAAATCTAGG + Intergenic
1039837420 8:41267924-41267946 GTGAAGTCATTTTGAAATGTAGG - Intronic
1039880795 8:41624376-41624398 CTGTTGTCCTGTGGAAATCTGGG + Exonic
1045457672 8:102397648-102397670 GTGGAGTGCAATGGCAATCTCGG - Intronic
1047255340 8:123209644-123209666 GCTGAGGCCTTTGGAAAGCTGGG - Exonic
1047660705 8:127033090-127033112 GTGGAGTTCTTTGTATATTTTGG - Intergenic
1049950273 9:636814-636836 CTGGAGTCCAATGGCAATCTCGG - Intronic
1051211258 9:14747020-14747042 GTGCAGTTCTTTGGAAATGAGGG + Exonic
1053747299 9:41211720-41211742 GTTGATTCTTTTGGAAAACTTGG - Intergenic
1054339031 9:63838485-63838507 GTTGATTCTTTTGGAAAACTAGG + Intergenic
1054479986 9:65653640-65653662 GTTGATTCTTTTGGAAAACTTGG + Intergenic
1056844016 9:90021970-90021992 ATGGTCTCCTTTGGAAATCCAGG - Intergenic
1058543640 9:106038165-106038187 GTGGAGGCTTTAGGAAATCAAGG + Intergenic
1058999506 9:110333967-110333989 TTGGACTCCTTTGCACATCTTGG + Intronic
1061494279 9:130962846-130962868 GTGGCGTCCCTAGGAAAACTTGG - Intergenic
1202783432 9_KI270718v1_random:22499-22521 GTTGATTCTTTTGGAAAACTTGG - Intergenic
1202803605 9_KI270720v1_random:26873-26895 GTTGATTCTTTTGGAAAACTTGG + Intergenic
1186256417 X:7725961-7725983 GTGCTGTCATTTGGAAATGTGGG - Intergenic
1188988927 X:36793257-36793279 GGGGAGTCATTAGGAAATGTAGG - Intergenic
1190946662 X:55101521-55101543 GTGGAATCCTTTTGAAAACATGG - Intronic
1192189689 X:68983318-68983340 ATGGAGTCCCTGGAAAATCTGGG - Intergenic
1192549068 X:72039541-72039563 GTGGTGTCTGTAGGAAATCTTGG + Intergenic
1195566777 X:106347962-106347984 GTGGAGTCCATGGGCATTCTAGG + Intergenic
1196538293 X:116873806-116873828 GTGGAGACCTTAGGAAATCATGG + Intergenic
1200309784 X:155066295-155066317 GAGGAGTTCTGTGGAAATGTAGG + Intronic