ID: 929635740

View in Genome Browser
Species Human (GRCh38)
Location 2:43519516-43519538
Sequence GATTGTATGGGACCATGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929635740 Original CRISPR GATTGTATGGGACCATGATG AGG (reversed) Intronic
900748531 1:4378057-4378079 GATTGGATGAGACCATGAACAGG + Intergenic
901096621 1:6686012-6686034 GACTGTATTGGACAATAATGAGG - Intronic
901152900 1:7115890-7115912 GATTGGATGGGCACATGAGGAGG + Intronic
909742331 1:79045636-79045658 GATTTTATAGGCCCAGGATGGGG + Intergenic
914739827 1:150455036-150455058 GATTGTATGTGCCCTTGATATGG + Intronic
914995944 1:152543470-152543492 GATTTTATGGGCCCAGGATGTGG - Intronic
915186790 1:154112767-154112789 GATTGGATGAGACCAGGAGGCGG + Intronic
917449825 1:175138177-175138199 GAGTGTCTGGGGCCATGATCTGG + Intronic
921323557 1:213967804-213967826 GATTGTGGGGGGCCAGGATGAGG + Intergenic
924373029 1:243375108-243375130 CATTATATGGGAGCATGAGGTGG + Intronic
1063131850 10:3185274-3185296 GATTTTATGGGTACAGGATGGGG - Intergenic
1066535414 10:36385636-36385658 CGTTGGATGGGACCAGGATGTGG + Intergenic
1070663790 10:78329071-78329093 GATTGCAGGAGTCCATGATGTGG + Intergenic
1071096156 10:81977644-81977666 GATTATATGGTACCATAATGTGG - Intronic
1074397293 10:113108427-113108449 GATTGAATGGGGCCATTGTGGGG + Intronic
1074783667 10:116820310-116820332 CATTTTTAGGGACCATGATGGGG + Intergenic
1075975656 10:126691838-126691860 GATTTTATGGGTACAGGATGTGG + Intergenic
1077512174 11:2973378-2973400 GATTATTTGGGTCTATGATGAGG - Intronic
1079242816 11:18732713-18732735 GATTGTATGGCAGCCTGATCTGG - Intronic
1084405178 11:68967947-68967969 GGTTGTATGAGACGATGAGGAGG + Intergenic
1093503225 12:19836122-19836144 GTTTTTATAGGACCAGGATGGGG - Intergenic
1093712152 12:22339720-22339742 GTTTATATGGGAACAGGATGGGG - Intronic
1095680638 12:44971429-44971451 GATTGATTGTTACCATGATGAGG + Intergenic
1096011477 12:48220036-48220058 AATTGTATGGGACCTCGAGGGGG + Intergenic
1096347856 12:50866322-50866344 GATTGTGTGGGAGCTGGATGAGG + Intronic
1099473041 12:83074640-83074662 GTTTGTATGGGACCTGGGTGAGG - Intronic
1103728290 12:123009916-123009938 GCTTGTATGCGCACATGATGGGG + Exonic
1104334543 12:127880990-127881012 CATTGCATGTGACCATGATGAGG - Intergenic
1105540555 13:21312519-21312541 GATTGAATGGGGATATGATGAGG - Intergenic
1105685617 13:22778117-22778139 GTTCCTCTGGGACCATGATGTGG + Intergenic
1106611349 13:31285028-31285050 AATTCTTTGCGACCATGATGGGG + Intronic
1109882167 13:68494048-68494070 GCTTTTTTGGGACCATGATGAGG + Intergenic
1110828898 13:80007166-80007188 AATTGTATCTGACCAGGATGTGG + Intergenic
1114574508 14:23700044-23700066 GATTTTATGGGAATAGGATGGGG + Intergenic
1115265141 14:31492962-31492984 GATTGTGTGGGACCTGGGTGAGG + Intronic
1116592814 14:46801281-46801303 GATTCTATGACACCATGATTTGG - Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1125110434 15:36025952-36025974 GGGTGTATGGGTCCATGATGGGG + Intergenic
1126325720 15:47474883-47474905 GATTCTATGGTACGATGTTGCGG + Intronic
1128206050 15:65852862-65852884 GATTGTTTGAGCCCAGGATGTGG + Intronic
1131691432 15:94831670-94831692 GTTTGTATAGGTCCAGGATGGGG - Intergenic
1132202863 15:99967109-99967131 AATTGCATGGGAATATGATGGGG - Intergenic
1135630836 16:24034661-24034683 GATGGGGTGGGACCATGAAGAGG - Intronic
1136753345 16:32662253-32662275 GTTTATATGGGCCTATGATGAGG - Intergenic
1136814768 16:33208112-33208134 GTTTATATGGGCCTATGATGAGG + Intronic
1136821244 16:33318192-33318214 GTTTATATGGGCCTATGATGAGG + Intergenic
1136827807 16:33374731-33374753 GTTTATATGGGCCTATGATGAGG + Intergenic
1136832873 16:33473502-33473524 GTTTATATGGGCCTATGATGAGG + Intergenic
1138472416 16:57248375-57248397 TATTAAATGGGACCCTGATGTGG - Intronic
1140947013 16:79778017-79778039 GATAGTATGTGCCCTTGATGTGG - Intergenic
1202993344 16_KI270728v1_random:31086-31108 GTTTATATGGGCCTATGATGAGG + Intergenic
1143851059 17:9812462-9812484 GATAGTATGGGACCCTGGGGAGG - Intronic
1148449028 17:47762186-47762208 GATTGCTTGGGACCAGGAAGTGG + Intergenic
1151031091 17:70740072-70740094 GGGTGTATGGGAACATTATGGGG + Intergenic
1151752868 17:76051292-76051314 GATTCTTTGGGACGATAATGTGG - Intronic
1152227925 17:79101358-79101380 GACTGTATGGGGCCATGAGAGGG + Intronic
1158829738 18:61264004-61264026 GATTGTGTGGGAGCTGGATGAGG + Intergenic
929149473 2:38734612-38734634 GATTGTATGTGACAAGGCTGGGG + Exonic
929396198 2:41525638-41525660 GACGGTATGGCACCATGGTGTGG + Intergenic
929635740 2:43519516-43519538 GATTGTATGGGACCATGATGAGG - Intronic
935261049 2:101356245-101356267 GTTTATATGGGCCCAGGATGTGG + Intronic
937891228 2:126940478-126940500 GATTTTATGGGCACAGGATGGGG + Intergenic
939457836 2:142461413-142461435 AATTAAATGGGAACATGATGGGG + Intergenic
939858344 2:147388252-147388274 GATTTTTTTGGACCATGATTTGG - Intergenic
939931115 2:148234593-148234615 GAGTTTATGGAACCATGAAGTGG + Intronic
943532823 2:189107459-189107481 GTTTTTATGGGACCATGTTTTGG + Intronic
1168961613 20:1873964-1873986 GATTCTATAGGTCCAGGATGGGG + Intergenic
1169436208 20:5594155-5594177 GATGGTCTGGGACCATGCTGTGG - Intronic
1174805707 20:53602778-53602800 GATTGGCTGGGACCATGGTGTGG - Intronic
1176733103 21:10519964-10519986 GATTGGCTGGGACCATGGTGTGG + Intergenic
1178097839 21:29234724-29234746 GTTTGTATGGGGGCAGGATGGGG + Intronic
1179213018 21:39341717-39341739 TATAATATGGGACCATTATGTGG - Intergenic
1183213970 22:36467453-36467475 GATTGGAAGGGACCAAGATGAGG + Exonic
951455574 3:22888617-22888639 GTTTGTATGGGATTAGGATGGGG - Intergenic
956000331 3:64723176-64723198 GATTGAATGTGACCAGAATGAGG + Intergenic
956639667 3:71403762-71403784 GATTGTTTGGGCCCAAGAGGTGG + Intronic
958770649 3:98421814-98421836 GATTGTGTGGGAACTGGATGAGG + Intergenic
959800360 3:110487050-110487072 GTTTGGATGGGACCATTAGGTGG - Intergenic
962275627 3:134011370-134011392 GATTCAGTGGGCCCATGATGTGG + Intronic
962329900 3:134468619-134468641 GATTGCAAAGGCCCATGATGGGG - Intergenic
965349736 3:167597970-167597992 GACTTTGGGGGACCATGATGGGG + Intronic
971902869 4:32684598-32684620 GATTGTTTGGGAATGTGATGGGG - Intergenic
972104368 4:35463313-35463335 GTTTGTATGGGCACAAGATGGGG - Intergenic
976883630 4:89960661-89960683 GTTTTTATGGGAACAGGATGGGG + Intergenic
977357820 4:95969138-95969160 GATTTTATGGGTACAGGATGGGG - Intergenic
977525564 4:98141901-98141923 GAGTGTCTGGGAACATGATTGGG - Intronic
978143026 4:105339093-105339115 GAATGTATGGGAATATGCTGTGG - Intergenic
982518422 4:156381808-156381830 GGCTATATTGGACCATGATGTGG + Intergenic
989387486 5:40867886-40867908 GATTTTATGGGCACAGGATGGGG + Intergenic
990573621 5:57103983-57104005 GATTGTATGGGGCATTGATGTGG - Intergenic
995284285 5:110368967-110368989 GCTTTTATGGGTACATGATGAGG + Intronic
996288961 5:121829153-121829175 GATTGTGTGGGAGCTGGATGAGG - Intergenic
996650782 5:125873566-125873588 GATTTTATGGGCACAAGATGGGG + Intergenic
999484881 5:151985463-151985485 GATTGTGTGGCACCTGGATGAGG - Intergenic
1000470250 5:161631296-161631318 GTTTTTATGGGAACAAGATGGGG + Intronic
1000836556 5:166161714-166161736 GATTATATGGCAACATGATGAGG + Intergenic
1002475753 5:179464801-179464823 GTTTTTATGGGCCCAGGATGGGG + Intergenic
1003412661 6:5879299-5879321 GATTGAATGGGGATATGATGGGG + Intergenic
1005798101 6:29389922-29389944 CATTGTATGGGACTTTGAAGGGG - Intronic
1007283549 6:40730546-40730568 GATTGTCAGGGACCAGGAAGAGG + Intergenic
1009810728 6:68661846-68661868 GCCTTAATGGGACCATGATGAGG + Intronic
1015194509 6:130510550-130510572 GATTTTATGGGTACAGGATGGGG + Intergenic
1016639520 6:146333087-146333109 TATTATATGGGACAATGATCAGG + Intronic
1018099072 6:160420484-160420506 AAGTTTATGGGACCATAATGTGG - Intronic
1018425423 6:163675790-163675812 GAATGGATGGGAACATGATGAGG + Intergenic
1019423806 7:963773-963795 GGTTGTTTGGGACCAAGATGGGG + Intronic
1021256189 7:18395424-18395446 GCATGTATGGGACTATCATGTGG + Intronic
1027350474 7:77306488-77306510 GTTTGTATGGGAGCTGGATGAGG - Intronic
1027749726 7:82127731-82127753 AATTGTATGGTATCATGATCAGG + Intronic
1030546906 7:110907482-110907504 GTTTTTATGGGCACATGATGGGG + Intronic
1035702582 8:1647955-1647977 GATTGTCTGGGGGCAGGATGAGG - Intronic
1036520589 8:9488146-9488168 GAGTGTATGGGACCATTACAAGG - Intergenic
1038967664 8:32593430-32593452 GATTGTTTGAGCCCAGGATGTGG + Intronic
1041389721 8:57337846-57337868 GATATCATGGGACCCTGATGGGG - Intergenic
1041571785 8:59345246-59345268 GAATATATGGGACCCTGCTGGGG + Intergenic
1044352455 8:91183115-91183137 GATTGTATGGGAGCAGGCTGTGG + Intronic
1046277301 8:111980771-111980793 GATTGTCTGGGTGCCTGATGTGG + Intergenic
1046977452 8:120297542-120297564 GTCTGTATTGGCCCATGATGTGG - Exonic
1047202126 8:122776091-122776113 GTTTTTATAGGACCAGGATGAGG + Intergenic
1049402174 8:142433365-142433387 CGTGGGATGGGACCATGATGGGG - Intergenic
1052541932 9:29822627-29822649 GATTGTTTGAGCCCAGGATGCGG + Intergenic
1053580929 9:39403477-39403499 GTTTTTATAGGCCCATGATGGGG - Intergenic
1053845421 9:42231531-42231553 GTTTTTATAGGCCCATGATGGGG - Intergenic
1054102515 9:60962281-60962303 GTTTTTATAGGCCCATGATGGGG - Intergenic
1054583844 9:66944588-66944610 GTTTTTATAGGCCCATGATGGGG + Intergenic
1054928033 9:70607679-70607701 GATTCCATGGGTCTATGATGGGG + Intronic
1057810294 9:98252171-98252193 CATTGCATAGGACAATGATGAGG + Intronic
1058237311 9:102505820-102505842 GATAGTTTTAGACCATGATGTGG - Intergenic
1058321397 9:103636149-103636171 GATTTTATGGGTACAGGATGGGG - Intergenic
1059983274 9:119796595-119796617 GATTGTAGGGGGCCACGTTGAGG + Intergenic
1187045640 X:15646092-15646114 GAGTGTCTGGGACCATGAGTGGG + Intronic
1188594255 X:31878070-31878092 GATAGTATGGGAGGATGATAAGG - Intronic
1197796806 X:130306622-130306644 GATTGCATGGTTCCATGTTGGGG + Intergenic
1198667451 X:139040252-139040274 GATTAGATGAGGCCATGATGTGG - Intronic
1201351729 Y:13051329-13051351 GATTGTCAGGGACTATGGTGAGG + Intergenic