ID: 929636052

View in Genome Browser
Species Human (GRCh38)
Location 2:43521645-43521667
Sequence CCTGAATAGCAGCTATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929636052 Original CRISPR CCTGAATAGCAGCTATAGCC TGG (reversed) Intronic
901756961 1:11447197-11447219 CCTGAGTAGCAGCTATCCCCTGG - Intergenic
903769629 1:25755760-25755782 CCTGCCTAGAAGCTACAGCCAGG + Intronic
917567683 1:176229788-176229810 CCTGACTGGCAGCTCCAGCCGGG + Intergenic
920207631 1:204304240-204304262 CCTGAATAGCAGGGATAGCAGGG - Intronic
920834931 1:209502023-209502045 CCTGAATTGCAGCTATACCCTGG - Intergenic
922050623 1:221987094-221987116 CCTCAAGTGCAGCTACAGCCTGG - Intergenic
1063285962 10:4688725-4688747 CCTGGCTGGCAGCAATAGCCTGG + Intergenic
1067519068 10:46981400-46981422 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1067643177 10:48070434-48070456 ACTCAGTAGCAGCTGTAGCCAGG + Intergenic
1072322895 10:94268342-94268364 CCAGAATAGCAACTAGAGCAGGG - Intronic
1072422834 10:95303896-95303918 CCTGAACAGCAGCTACAGGATGG + Intergenic
1073850886 10:107616874-107616896 CCTCAGTTGCAGCAATAGCCTGG - Intergenic
1076075768 10:127532758-127532780 TCTGAATAGCACCAATAACCTGG - Intergenic
1076583684 10:131531649-131531671 CCTGAACAGCAGCTATGGAAAGG - Intergenic
1081783858 11:45732708-45732730 GCTGGAAAGAAGCTATAGCCAGG + Intergenic
1083933723 11:65859694-65859716 CCGGCATAGCAGCTAGAGGCCGG + Intronic
1084889374 11:72229126-72229148 CCTGAAAGGCAGCTATGGGCTGG + Exonic
1097015652 12:55984770-55984792 CCTAAAAAGCAGCCACAGCCTGG - Intronic
1098592936 12:72235660-72235682 CCTGAATCCAATCTATAGCCTGG - Intronic
1099193844 12:79591102-79591124 CCTACATAGGAGCTACAGCCAGG + Exonic
1102584460 12:113913403-113913425 CCTGCACAGCAGGAATAGCCTGG - Intronic
1104014942 12:124955604-124955626 CTTCAAAAGCAGCTTTAGCCGGG - Intronic
1106121188 13:26861268-26861290 CCTGGATAGCAGATGTACCCTGG - Intergenic
1106529149 13:30572002-30572024 CCTGAATAGCAGATATTACTTGG + Intronic
1109862962 13:68224673-68224695 CCAGAAGAGGAGCTATACCCTGG - Intergenic
1110015041 13:70389483-70389505 CCTAAATAACATCTATAGTCAGG + Intergenic
1110874101 13:80488484-80488506 CATCAATACCAGCTATAGCCTGG + Intergenic
1113538276 13:111085036-111085058 CCTCTATAGCCTCTATAGCCTGG + Intergenic
1115026257 14:28750372-28750394 CGTCAATAGCAGCAATAGCAAGG + Intergenic
1116541958 14:46110313-46110335 AGTGAATATCAGCAATAGCCAGG + Intergenic
1119322803 14:73741633-73741655 CCTGCAGAGGAGCGATAGCCTGG - Intronic
1120439632 14:84520229-84520251 AGTGAATATCAGCGATAGCCAGG - Intergenic
1124868727 15:33519676-33519698 CCTCAATCCCAGCTATAGACCGG - Intronic
1128438304 15:67677916-67677938 CCTCAATGGCAGTTATTGCCTGG - Intronic
1131577181 15:93603787-93603809 TCTGAATAGCTGCTGTGGCCTGG - Intergenic
1138483321 16:57318510-57318532 CCAGAATAGCAGGAATAGCTGGG + Intergenic
1141538698 16:84700785-84700807 CCTGAACAGTAGCTAAAGCTTGG + Intronic
1152023078 17:77791642-77791664 CTTGAATTGCAGCCATAGGCTGG + Intergenic
1153483827 18:5575235-5575257 CCTCAATAGCTGATATAGCTTGG + Intronic
1153598597 18:6755681-6755703 CCTGGACAGCAGGTATAACCTGG + Intronic
1156305494 18:35874828-35874850 CCTGTATAGTGGTTATAGCCTGG - Intergenic
1156690403 18:39700538-39700560 CCTGAATATCAGGTATTGTCTGG - Intergenic
1157483397 18:48070340-48070362 CCTGAATCCCAGCTGTAGGCTGG + Intronic
1158411515 18:57210028-57210050 CCTGAATTGCATTTACAGCCGGG + Intergenic
926788853 2:16549222-16549244 CCTGAATAACAGCCAAAGGCAGG - Intergenic
928441284 2:31294335-31294357 CATGGATAACAGCTAAAGCCAGG - Intergenic
928673393 2:33625924-33625946 CATCAATAGCAGCTTTTGCCAGG - Intergenic
929636052 2:43521645-43521667 CCTGAATAGCAGCTATAGCCTGG - Intronic
932343794 2:70982719-70982741 CCTGGATAGCAGCTGTCCCCTGG - Intronic
939227427 2:139381814-139381836 ACTCAATAGCACCTGTAGCCAGG + Intergenic
943261377 2:185667762-185667784 CCTTAGTTGCAGCAATAGCCTGG + Intergenic
944213298 2:197228738-197228760 TCTGAAGAGCAGTTACAGCCTGG + Intronic
944409951 2:199430253-199430275 CCAGAATAGCAGCAGTACCCTGG + Intronic
947787762 2:232839312-232839334 CATGACTAGAAGCTACAGCCTGG + Intronic
1169796581 20:9469381-9469403 TCTGAATAGCAGCAACAGTCAGG + Intronic
1170158685 20:13291258-13291280 CCAGAAAAGCTGCAATAGCCAGG - Intronic
1170972249 20:21126426-21126448 CGTCAATAGCAGCTAAAGCCTGG + Intronic
1178730105 21:35094043-35094065 CTTGAGTGGCAGCTCTAGCCAGG + Intronic
1179553548 21:42158648-42158670 GTTGAATTGCAGCTATAGGCTGG + Intergenic
1182980130 22:34661989-34662011 CCTTAGTTGCAGCAATAGCCTGG + Intergenic
1183028723 22:35085894-35085916 CCAGGAGAGCAGCTTTAGCCAGG - Exonic
950620759 3:14203402-14203424 CCTGAATACCAGCTTGAGCAGGG - Intergenic
952494366 3:33902928-33902950 CCTTGATAGCAGCTGTACCCAGG + Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954370647 3:50168176-50168198 CCCGCATAGCATCTCTAGCCAGG - Intronic
954831730 3:53426748-53426770 CCAGCATAGCAGCTATAGTTGGG + Intergenic
965160200 3:165123432-165123454 CCTCAGTTGCAGCAATAGCCTGG + Intergenic
965784184 3:172318888-172318910 CTTCAATAGCAGCTATAGTGGGG - Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972253006 4:37324772-37324794 CCTGAAATGCAGCTGCAGCCTGG - Intronic
972804060 4:42509415-42509437 CCTGTATGGCCGCTATAGCGGGG - Intronic
979325870 4:119378868-119378890 CCTGAACAGCAGCTAAAGCAAGG - Intergenic
982848133 4:160276710-160276732 CCTGAAAAGGGGCTAAAGCCAGG + Intergenic
983243786 4:165264016-165264038 CCTGAAGAGCAGCTAAAGCAAGG - Intronic
984418141 4:179486776-179486798 ACTCAGTAGCAGCTTTAGCCAGG + Intergenic
985843502 5:2327233-2327255 CCCGAACAGCAGCCATAGTCTGG + Intergenic
988135901 5:27171660-27171682 CTTGTATAGCAATTATAGCCAGG - Intergenic
989679385 5:44011573-44011595 CCAGAATAGTACCTATTGCCTGG - Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
995417202 5:111924785-111924807 CCAGTATAGCAGTTATAGCCTGG + Intronic
998129144 5:139642566-139642588 CCTGTACAGCCGCCATAGCCTGG + Intergenic
998971520 5:147597647-147597669 CCAGATTAGCTGCTATACCCAGG - Intronic
1007459179 6:42004821-42004843 CCAGGATAACAGCTATAACCTGG + Intronic
1007866883 6:44981126-44981148 GATGGATAGCAGCTATAGCTGGG - Intronic
1009245438 6:61231573-61231595 GCTGAATAGCAGAGATACCCAGG + Intergenic
1019131654 6:169881432-169881454 TCTGAATAGCAGCCATGGCTTGG - Intergenic
1020447574 7:8285401-8285423 CCAGACTAGCAGCTATGGCCAGG - Intergenic
1022713812 7:32878264-32878286 CTTTAATGGCAGCTATAGACAGG - Intronic
1022782137 7:33596635-33596657 CCAGAATAGGAGGTATAGCGAGG - Intronic
1025044428 7:55680886-55680908 CCTGAAGAGCAGCTAAAGAAGGG - Intergenic
1037684811 8:21129746-21129768 CCAGATTAGCAGCTAGTGCCTGG - Intergenic
1037953785 8:23037293-23037315 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1038074683 8:24058157-24058179 CCTGTATAGTGGCCATAGCCTGG - Intergenic
1038212826 8:25535763-25535785 CCTGAATAGAAGAAAAAGCCTGG - Intergenic
1040794569 8:51274692-51274714 CCTGAAAAGATGCTATAGCTGGG + Intergenic
1042627184 8:70770888-70770910 CCTGAAAGGCAGCTAAGGCCAGG - Intronic
1044451685 8:92342865-92342887 CCTGCATAGCTGGCATAGCCAGG + Intergenic
1045335414 8:101198605-101198627 CCTGACTGGCAGTTAGAGCCAGG + Intronic
1046264928 8:111818253-111818275 CCAGTACAGTAGCTATAGCCTGG + Intergenic
1047096565 8:121632680-121632702 ACTGAACAGCAGCTATAAGCTGG - Intronic
1051540893 9:18216374-18216396 CCTGATCAACAGCTATAACCTGG - Intergenic
1056313971 9:85370938-85370960 CATTAATACCAGCTATAACCAGG - Intergenic
1059048338 9:110895305-110895327 CCAGAACAGCTGCTACAGCCAGG + Intronic
1059440402 9:114303533-114303555 CATGAAAAGCACCTGTAGCCCGG - Intronic
1196011618 X:110893881-110893903 TCCAAATAGCAGCTATACCCAGG + Intergenic