ID: 929637517

View in Genome Browser
Species Human (GRCh38)
Location 2:43539642-43539664
Sequence ATGTGAGGTTACCATGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929637517 Original CRISPR ATGTGAGGTTACCATGTGAA TGG Intronic
903842624 1:26254966-26254988 TTGTTAGTTTACCTTGTGAATGG + Intronic
905940950 1:41862893-41862915 ACTTGGGGTTACCATCTGAAAGG - Intronic
905984686 1:42268931-42268953 ATGTAAGGTTATAATGAGAATGG + Intronic
908987991 1:70048572-70048594 ATGTGAGGTAATAATGTGTATGG - Intronic
910595801 1:88979127-88979149 AGGTCATGTTACCATGGGAAAGG + Intronic
911140483 1:94496259-94496281 ATGAGAGGTTACCAGGGGCAAGG - Intronic
911286031 1:95993915-95993937 ATGTTATGTTAACATGTAAAAGG - Intergenic
912068019 1:105770984-105771006 ATGGGGGTTAACCATGTGAATGG + Intergenic
914244414 1:145875075-145875097 ATGAGAGCTTACCCTGTGAGTGG - Intronic
915473975 1:156141610-156141632 ATGTGAGGTGACCACGTGTGTGG - Intergenic
915985266 1:160458260-160458282 ATGTGAGGTCAACATGGAAAGGG - Intergenic
916649655 1:166822883-166822905 ATTTGATGTTATCATGAGAAGGG + Intergenic
917194924 1:172455013-172455035 TTGTGAGGCTACCAAGTAAAGGG - Intronic
917829798 1:178869260-178869282 CTGTGAGTTTACCATCTGAAAGG - Intronic
919838052 1:201590227-201590249 AAGTGAGGTAATCAGGTGAATGG + Intergenic
920864248 1:209738478-209738500 ATGTGTGGATTCCATGTGAATGG + Intergenic
923166147 1:231364443-231364465 ATGTGATGTTATCATCTGGAAGG + Exonic
924733856 1:246737067-246737089 ACATGAGGTTACCATTTTAAAGG - Intronic
1064183822 10:13142944-13142966 GTGTGAGGAGAGCATGTGAATGG + Intergenic
1064550068 10:16491679-16491701 ATCTGAGGCTACCTTGTGATTGG + Intronic
1065572308 10:27083728-27083750 ATGGAAGGTAACCATGTAAAGGG - Intronic
1067420534 10:46141649-46141671 ATGTGAACTGAACATGTGAAGGG + Intergenic
1067425487 10:46207884-46207906 ATGTGAACTGAACATGTGAAGGG - Intergenic
1067505877 10:46848115-46848137 ATGTGAACTGAACATGTGAAGGG + Intergenic
1067983609 10:51116164-51116186 ATGTGAGGTCAGTTTGTGAATGG + Intronic
1068502583 10:57858489-57858511 CTGTTAGGTTTCCATGTCAATGG - Intergenic
1073647082 10:105316293-105316315 ATGAGAGCTTATCATGTGACTGG - Intergenic
1077913273 11:6592997-6593019 ATTTGAGGCAACCAGGTGAATGG + Intronic
1079918427 11:26400193-26400215 ATGTGAGGTCATCAGGAGAAAGG + Intronic
1080612858 11:33919880-33919902 AAGTGTGGTTTCCATTTGAATGG - Intergenic
1080946957 11:36983902-36983924 ATTTGAGGTTATTATTTGAAAGG - Intergenic
1084764022 11:71295808-71295830 ATGTGAAGTCACCGTGTAAAGGG + Intergenic
1085157573 11:74310793-74310815 ATGTGAGGTTTACATGTCATTGG - Intronic
1087202648 11:95361419-95361441 ATGGTAGGTAACCATGTGATAGG - Intergenic
1087512466 11:99115018-99115040 ATGTGAGGTTACACTGGAAAAGG + Intronic
1087782528 11:102316710-102316732 ATGTCAGGTTTCCCTGAGAATGG + Intergenic
1087948292 11:104192154-104192176 ATGTGAGGTGGTGATGTGAATGG + Intergenic
1088182063 11:107123756-107123778 ATGTGAGGTTATCATGAGACTGG - Intergenic
1088324464 11:108587371-108587393 ATCTGAGGAAACCAGGTGAAGGG - Intronic
1090030654 11:123203350-123203372 ATGTGAGGTAAGCATGATAAAGG + Intergenic
1091003854 11:131934098-131934120 ATGTATAGTTACCATGTGCACGG + Intronic
1091120524 11:133053860-133053882 AAGTGAAGTTGCCATGTGGATGG - Intronic
1094436835 12:30430242-30430264 AGGTGAGGTTAACAAGTGATGGG - Intergenic
1094447363 12:30546220-30546242 AGGTGAGGTTCCCAGGTGAATGG + Intergenic
1095533421 12:43217921-43217943 AAGTCATGTTAACATGTGAAAGG + Intergenic
1097462139 12:59874778-59874800 ATTTTAGATTATCATGTGAATGG + Intergenic
1097508848 12:60509915-60509937 ATTTGAGGTTACCATGAGGCTGG - Intergenic
1097799305 12:63895650-63895672 ATGGGAGGTTACTAGGTTAAAGG - Intronic
1099930855 12:89072803-89072825 ATGTGTGTTTAGCATTTGAATGG - Intergenic
1112241096 13:97681972-97681994 ATGTGAAGTGCCCATGTGAAGGG - Intergenic
1112803719 13:103139189-103139211 ACTTGAGGTTACGCTGTGAAGGG + Intergenic
1112853741 13:103738464-103738486 ATTTGAAGTTACGGTGTGAATGG + Intergenic
1114783518 14:25568049-25568071 ATTTGAGGTTACCATGAGGCTGG + Intergenic
1116473166 14:45308820-45308842 GTGTGAGTTTACAATGTGATAGG + Intergenic
1118352854 14:64986209-64986231 ATGTAAGGTTTCCAAGGGAAGGG + Intronic
1118657183 14:67965215-67965237 ATGTGAGGTTTCCAGCTGAGAGG - Intronic
1120819745 14:88901074-88901096 ATGTGAGGTGACCCTGCTAAGGG + Intergenic
1121516614 14:94556423-94556445 GAGTGAGGTTCCCATGTCAATGG + Intergenic
1122860872 14:104581876-104581898 CTGTGAGGCTGCCGTGTGAATGG + Intronic
1123431306 15:20219334-20219356 ATGTGTGGTTACCATATGGCTGG + Intergenic
1124005411 15:25792204-25792226 ATGTGGGGTTGACATGAGAAAGG - Intronic
1127077949 15:55346576-55346598 ATGGGTTGTTACTATGTGAAAGG + Intronic
1128272364 15:66321854-66321876 AAGTGAGATTACCAAGTCAAAGG + Intronic
1129666769 15:77583557-77583579 ATGTGAGGACACCATGAGAAGGG + Intergenic
1131592522 15:93765258-93765280 ATGTGAGCATAGCATGTCAATGG + Intergenic
1133489457 16:6252920-6252942 TTGTGTGCTTACCATGTGACAGG + Intronic
1134374317 16:13656799-13656821 CTGTGAGGTAGCCAAGTGAAAGG + Intergenic
1135096065 16:19565742-19565764 TAGTGAGGTTCCCTTGTGAATGG + Intronic
1136853336 16:33631890-33631912 ATGTGTGGTTACCATATGGCTGG - Intergenic
1138375421 16:56560396-56560418 ATGTGAGCTTCACATGTGCAGGG - Intergenic
1139136932 16:64215922-64215944 ATGTGAGGACACAATGAGAAGGG - Intergenic
1140510451 16:75503819-75503841 CTGTGAGCTTACCAAGTGATAGG + Intergenic
1140794253 16:78421651-78421673 ATGGGAGGTTGCTATGGGAATGG + Intronic
1203114931 16_KI270728v1_random:1480335-1480357 ATGTGTGGTTACCATATGGCTGG - Intergenic
1142995909 17:3760334-3760356 ATGTAAGGGTAGCATGTGTAGGG + Intronic
1147031882 17:37645017-37645039 GTGTGAGGTGAGCATGTGATGGG + Intergenic
1149556512 17:57577193-57577215 TTGTGAAGTTACCAAGAGAAAGG + Intronic
1150553233 17:66230393-66230415 AAGTGAGGTGTCCATGTGATTGG - Intronic
1150627044 17:66848465-66848487 ATATGAGGTGACCGTGTGCAGGG - Intronic
1154237068 18:12616155-12616177 ATGTGACTTTACCTTGGGAAGGG - Intronic
1155648462 18:28110957-28110979 AAATGAGGTTAGCATGAGAAAGG + Intronic
1157088502 18:44607304-44607326 CTGTGAGTTTATGATGTGAAGGG + Intergenic
1159924266 18:74253133-74253155 ATGAGATGTGACGATGTGAAAGG + Exonic
1159940417 18:74402804-74402826 ATGAGAGGCCACCAGGTGAAAGG + Intergenic
1168011460 19:53537014-53537036 AGCTGAGGTAACCAGGTGAAAGG + Intronic
929408308 2:41667949-41667971 ATGTGAGGTTGTCAGGGGAAAGG - Intergenic
929637517 2:43539642-43539664 ATGTGAGGTTACCATGTGAATGG + Intronic
930370379 2:50493802-50493824 TTGTGAATTTCCCATGTGAAGGG - Intronic
930691165 2:54366508-54366530 ATGTGAGTTTTCAATCTGAAGGG + Intronic
932548676 2:72743353-72743375 ATGTGAGGTTACATTATGTAGGG - Intronic
933171350 2:79129393-79129415 ACATGAGGTTCCCATGTGGAAGG + Intergenic
934576900 2:95408014-95408036 ATGTGTGTTTGCCATGTGGAGGG - Intronic
934639165 2:96016498-96016520 ATGTGTGTTTGCCATGTGAAGGG - Intergenic
934794480 2:97088913-97088935 ATGTGTGTTTGCCATGTGAAGGG + Intronic
934924551 2:98372917-98372939 CTGTCAATTTACCATGTGAAGGG - Intronic
935813179 2:106819932-106819954 ATTTGAGGTTACCATGAGGTTGG - Intronic
938446271 2:131382032-131382054 AGATGAGGTTAACATGTGGATGG + Intergenic
939190029 2:138906116-138906138 ATGTGCAGGTACAATGTGAATGG - Intergenic
942068088 2:172290796-172290818 GTATTAGGTTACCATTTGAATGG - Intergenic
944283056 2:197920453-197920475 ATATGAAGTTACCATTTCAAAGG - Intronic
944293335 2:198033427-198033449 ATGTGAGGGTACCATGAAGACGG + Intronic
945605437 2:211924079-211924101 GTGTGGGGTTTCCATGAGAATGG - Intronic
945700120 2:213159271-213159293 ATGTGATTTTCCTATGTGAAGGG + Intergenic
945701677 2:213178329-213178351 TTGTGAGGATACCATTTGCAAGG + Intergenic
946810921 2:223524856-223524878 ATTTGAGGTTACATTGTGATGGG + Intergenic
947300877 2:228687544-228687566 ATGTCAGGTTTCCAAGGGAAGGG - Intergenic
948398261 2:237663445-237663467 ATGTGAGGACACAATGGGAAGGG + Intronic
1169608921 20:7356794-7356816 ATGTGAGGTTTCCACATAAAAGG - Intergenic
1170956955 20:20990165-20990187 ATGTGAGCTTACCATGTTCTAGG + Intergenic
1171762033 20:29212673-29212695 ATTTGAGGGTACCATGGAAAAGG + Intergenic
1172747464 20:37223481-37223503 TTGAGTGCTTACCATGTGAAAGG - Intronic
1172843969 20:37918799-37918821 AGGGGAGGTTACCAGGAGAAGGG - Intronic
1175963648 20:62649352-62649374 AGGTGAGATTAGCATGTGAAGGG - Intronic
1182651070 22:31851674-31851696 ATGTGAGGTGAGCATGTTAGGGG + Intronic
1183142974 22:35961663-35961685 AGGTGAGGTTACCATGGAGATGG - Intronic
1184086415 22:42268657-42268679 ATGTGTGGATAACATGTGATTGG - Intronic
1184669045 22:46003320-46003342 ATGTGGGTTTACCCTGTGGATGG - Intergenic
950125918 3:10509731-10509753 ATGCGAGGCTTCCATGTGACTGG - Intronic
950847971 3:16033254-16033276 ATGTAAGGTCACCATCAGAAAGG + Intergenic
952563075 3:34618854-34618876 ATGTGGGGGTACGATGTTAAAGG - Intergenic
956223198 3:66925810-66925832 ATTTGAGGTTACCATGAGCCAGG - Intergenic
956402802 3:68897848-68897870 ACCTGAGGTAACCATGTCAAGGG - Intronic
957925675 3:86807397-86807419 ATTTGAGGTTACCATGAGGCTGG - Intergenic
959303086 3:104627532-104627554 ATGAGAGTTTACTATGTGACAGG - Intergenic
959756975 3:109910863-109910885 AGGTGAGGTTCCCAGGTCAATGG + Intergenic
959818769 3:110706892-110706914 ATTTGAGGTTACCATATACATGG + Intergenic
960067144 3:113386226-113386248 ATGTTTGGTTACCATTTGCATGG + Intronic
960741519 3:120838908-120838930 ATGTGAGGTCAAGAGGTGAATGG + Intergenic
961882732 3:130074015-130074037 ATGTGTGTTTACCCTGAGAAGGG + Intergenic
965168081 3:165222636-165222658 ATGTGAGATAATCCTGTGAATGG + Intergenic
970244688 4:14047908-14047930 AGGTGAGATTAACATGTAAATGG + Intergenic
970996085 4:22268916-22268938 AAGTGAGGTTCCCAGGTCAATGG - Intergenic
974224714 4:59024277-59024299 AGATGAGGTTAACATGTGAATGG - Intergenic
974267115 4:59599660-59599682 ATTTGAGGTTACCATGAGGCTGG - Intergenic
976138126 4:81960753-81960775 AGGTGATGTTAACATGTGACAGG - Intronic
976613347 4:87052024-87052046 ATGTGAGGTGTCTCTGTGAAAGG - Intronic
977662264 4:99603605-99603627 AGTTGAGGTTACCAGGTGTATGG + Intronic
978392493 4:108241902-108241924 ATGAGTGGTTACCATGGGGAAGG + Intergenic
980523523 4:133960860-133960882 GGGTGAGGTTACCAGGTCAATGG - Intergenic
988446049 5:31287182-31287204 ATGTGGGGAGAGCATGTGAAAGG + Intronic
990879805 5:60526680-60526702 ATGTGACGTGACCACATGAAAGG - Intergenic
990971671 5:61514060-61514082 GTGGGAGGTTACCATGTTCATGG - Intronic
991048551 5:62248342-62248364 ATGTGTGGTTACCATATGGCTGG + Intergenic
994353319 5:98770024-98770046 AGCTGAGGTTTTCATGTGAAGGG + Intronic
995744610 5:115390714-115390736 CTCTGAGGTGACTATGTGAATGG + Intergenic
996594464 5:125185199-125185221 ATGTCAGGGTACTATGTCAAGGG + Intergenic
997104962 5:131008141-131008163 ATTTGAGGTTACCCTGTGGCTGG - Intergenic
997193071 5:131957971-131957993 ATTTGAGGTTACCATGGTGAGGG + Intronic
998420293 5:141979138-141979160 GTGTGAGGTTGGCATCTGAAGGG + Intronic
1002463064 5:179386287-179386309 ATGTGATGTTATCATCTGCAAGG + Intergenic
1004420780 6:15467876-15467898 ATGAGAGGTTAAGATGTAAAAGG + Intronic
1006831974 6:36973890-36973912 ATGTGAGGTGACAAAGTGCAGGG - Intronic
1007164019 6:39815538-39815560 CTGTGAGCTTACTATGTGTAAGG - Intronic
1009395020 6:63189762-63189784 ATGTGAGGACACAATGAGAAGGG - Intergenic
1010470891 6:76227165-76227187 ATGTGATGATGCCATGGGAATGG + Intergenic
1011466539 6:87663379-87663401 ATCTGACTTTAGCATGTGAAGGG - Intronic
1011831502 6:91377357-91377379 ATCTGAGATTACCGTGTGACTGG + Intergenic
1012368258 6:98469759-98469781 GTGTAAGGTTCACATGTGAAGGG + Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1019059652 6:169247261-169247283 ATGTGGTGTTTGCATGTGAAAGG + Intronic
1020395965 7:7718072-7718094 ATGTGAAGTTAATAAGTGAATGG - Intronic
1025849985 7:65237489-65237511 CAGTGAGGTTACCATGGGGAGGG - Intergenic
1029955463 7:104634344-104634366 ATGTGAGGACACAATGAGAAGGG - Intronic
1030300197 7:107966846-107966868 ATGAGAGCTGATCATGTGAAAGG + Intronic
1031740106 7:125418764-125418786 AGGTGAGGTTCCCAGGTCAATGG - Intergenic
1031939255 7:127769992-127770014 ATGTGAGGTATCCTTCTGAATGG + Intronic
1034254869 7:149719463-149719485 AGGTGGGGTTACCAAGTGCAGGG + Intronic
1035793032 8:2325463-2325485 CTGTGAAGTTACCATGTGAAAGG + Intergenic
1035799772 8:2396242-2396264 CTGTGAAGTTACCATGTGAAAGG - Intergenic
1036666381 8:10745262-10745284 ATGGCAGGTAAGCATGTGAAAGG + Intronic
1038086907 8:24208253-24208275 ATAAGAGGTTACCAGCTGAAAGG + Intergenic
1038361948 8:26888350-26888372 ATGTGAGGTCCCCATGTGTGTGG + Intergenic
1039627914 8:39074547-39074569 GTGTGATGTGATCATGTGAATGG - Intronic
1039768563 8:40659052-40659074 AAGTGTGGTTACCATGCGAATGG - Intronic
1040704701 8:50111472-50111494 ATGTGAGGTCACAGTGAGAAGGG + Intronic
1040711536 8:50195136-50195158 AAGTGAGGTTCCCATGTCACTGG + Intronic
1041386357 8:57308769-57308791 AGGTGAGGTTCCCTTTTGAAAGG + Intergenic
1042588727 8:70373247-70373269 ATGTGAGAATACCAAGTGCAGGG - Intronic
1050309328 9:4336514-4336536 ATGTGAGGATGCCAAGAGAAAGG - Intronic
1051856167 9:21567915-21567937 TTGTGAGGTTTACATGTGAATGG - Intergenic
1055472024 9:76621469-76621491 ATGTGATGTTACCATCAAAAAGG + Intronic
1059072622 9:111154586-111154608 ATCTGAGGTTTCCCTGAGAAGGG - Intergenic
1060166425 9:121420468-121420490 ATTTGAGGTTACCATGAGGCTGG + Intergenic
1187487621 X:19719628-19719650 ATGTGAATTAGCCATGTGAAAGG + Intronic
1188793393 X:34433376-34433398 ATGTGAGTTTAAAATGTGATCGG + Intergenic
1191080641 X:56506065-56506087 GTGTGAGGTTTCCAGGTCAATGG - Intergenic
1192233605 X:69282607-69282629 ATGAATGTTTACCATGTGAATGG + Intergenic
1194237197 X:91399229-91399251 GGGTGAGGTTCCCATGTCAATGG - Intergenic
1194675931 X:96793604-96793626 ATGTGAGGATACAGTGAGAAGGG - Intronic
1196225188 X:113157907-113157929 AGGTGAGGTTCCCAGGTCAATGG + Intergenic
1197363568 X:125536446-125536468 GTGTGAGGTTCCCAGGTCAATGG - Intergenic
1198456535 X:136823082-136823104 AGGTCAGGTTCCCATGAGAAAGG + Intergenic
1198524128 X:137482990-137483012 AAGTGAGATTACCAGGTCAAAGG - Intergenic
1200898261 Y:8399825-8399847 ATGAGAGGTTATCCTGTTAACGG - Intergenic