ID: 929637662

View in Genome Browser
Species Human (GRCh38)
Location 2:43541708-43541730
Sequence CTTTAGTCCAGGAGGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929637662_929637665 -7 Left 929637662 2:43541708-43541730 CCACATCACCTCCTGGACTAAAG 0: 1
1: 0
2: 2
3: 19
4: 177
Right 929637665 2:43541724-43541746 ACTAAAGCAATTCTCTCGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 154
929637662_929637668 11 Left 929637662 2:43541708-43541730 CCACATCACCTCCTGGACTAAAG 0: 1
1: 0
2: 2
3: 19
4: 177
Right 929637668 2:43541742-43541764 CTTGGGCCTCCCAAAGTGCTGGG 0: 199
1: 12937
2: 229427
3: 271603
4: 168697
929637662_929637666 -6 Left 929637662 2:43541708-43541730 CCACATCACCTCCTGGACTAAAG 0: 1
1: 0
2: 2
3: 19
4: 177
Right 929637666 2:43541725-43541747 CTAAAGCAATTCTCTCGCTTGGG 0: 1
1: 1
2: 29
3: 475
4: 3911
929637662_929637667 10 Left 929637662 2:43541708-43541730 CCACATCACCTCCTGGACTAAAG 0: 1
1: 0
2: 2
3: 19
4: 177
Right 929637667 2:43541741-43541763 GCTTGGGCCTCCCAAAGTGCTGG 0: 61
1: 7563
2: 152768
3: 245429
4: 198545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929637662 Original CRISPR CTTTAGTCCAGGAGGTGATG TGG (reversed) Intronic
900110166 1:1001916-1001938 CCGTAGCCCAGGAGGTGGTGTGG + Intergenic
902346046 1:15818458-15818480 CTTGAGCTCAGGAGGTGAAGAGG + Intergenic
902669294 1:17961546-17961568 TTTGAGGCCAGGAGGTGATCTGG - Intergenic
902777504 1:18684175-18684197 CTGGAGTCCAGGAAGAGATGGGG + Intronic
903387041 1:22933776-22933798 TTTGAGCCCAGGAGGTCATGAGG + Intergenic
906103545 1:43278184-43278206 CTTGAATCCAGGAGGTGTGGAGG + Intergenic
909824301 1:80108021-80108043 CATTATCCCAGGAGGGGATGAGG + Intergenic
911786700 1:101959113-101959135 CTTTTGACCAGGAGGTGTTCTGG + Intronic
913119823 1:115729473-115729495 CATTATTCCAGGAGGAGATCTGG + Intronic
914262230 1:146009020-146009042 CTTGAGCCCAGGAGGTCAGGAGG - Intergenic
916190892 1:162177161-162177183 TTTTAATCCAGGAGGTGATATGG + Intronic
916481209 1:165216120-165216142 CTGTTTTCCAGGGGGTGATGTGG + Intronic
916971139 1:170017674-170017696 TTTAAGTCCAGGAGGTGATGTGG + Intronic
918350823 1:183653893-183653915 CTTGTGTCTAGGAGATGATGTGG - Intronic
918629134 1:186694742-186694764 CTTTAGATCAGGAGGTCATAAGG + Intergenic
1063866056 10:10366884-10366906 CTTTGGTCCAGTATGTGATCAGG + Intergenic
1064021861 10:11815431-11815453 TTATAGTCCAGGAGGGGTTGGGG - Intergenic
1066027952 10:31384055-31384077 CTTGAATACAGGAGGTGGTGAGG - Intronic
1067385055 10:45811259-45811281 CTTAAGCCCAGGAGGGGTTGAGG + Intergenic
1070989077 10:80715555-80715577 CTTTACTCCACAGGGTGATGGGG + Intergenic
1072078694 10:92005953-92005975 CTTGAGTCCAGGAGAGGCTGAGG - Intronic
1072625919 10:97111938-97111960 CTTTAATCCTGAAAGTGATGGGG - Intronic
1073989565 10:109247027-109247049 CTTTAGTCCAGTGGGAGATATGG + Intergenic
1074541784 10:114371177-114371199 CTTCTGTCCAGCAGCTGATGAGG - Intronic
1075147038 10:119891444-119891466 CTTCAATCCAGGAGGTACTGTGG - Intronic
1077193872 11:1269542-1269564 CTTCAGTCCAGGTGGTCTTGTGG - Intergenic
1082761414 11:57130574-57130596 CTTTGGTACAGAAGGTGATTTGG + Intergenic
1083470056 11:62878368-62878390 CTTGAGTCCAGGAGTTTGTGAGG - Intronic
1083552671 11:63601893-63601915 CTTGAACCCAGGAGGTGGTGGGG + Intronic
1083730115 11:64648315-64648337 CTTCAGTGCAGGTGGTGCTGGGG + Exonic
1089048859 11:115528438-115528460 CTTTAGCCCAGCATGTCATGCGG + Intergenic
1090875038 11:130781404-130781426 CTTTAGTTCAGTGGGTGATTTGG - Intergenic
1095926715 12:47585959-47585981 TTTTAGGCCAGGAGGTGATAAGG + Intergenic
1096515923 12:52155267-52155289 CCTTTTTCCAGGAGGTCATGGGG + Intergenic
1096657461 12:53100624-53100646 CCTTACTTCAGCAGGTGATGTGG + Intronic
1097390321 12:59003950-59003972 TTTTATTCCAGAAGGTGAGGAGG - Intergenic
1097968081 12:65602917-65602939 CCCTAGTCCAGGAGGTGAGGAGG - Intergenic
1098280383 12:68856394-68856416 CCTGATTCCAGGTGGTGATGTGG + Exonic
1099285796 12:80713189-80713211 CCTTAGTCCAGGAGTTGATAAGG + Intergenic
1102672875 12:114634733-114634755 CTTGAGTCCAGGAGTTCAAGAGG + Intergenic
1104365541 12:128173299-128173321 CTGGAGTCCTGGAGGAGATGTGG - Intergenic
1106106437 13:26737443-26737465 CTTTAGTCCATGATGTGGTATGG + Intergenic
1107517754 13:41148162-41148184 CTTGAGCCCAGGAGGTCATGAGG + Intergenic
1107717791 13:43217603-43217625 CTTTACTCCAGCAAGTGAGGGGG - Intronic
1109999032 13:70169880-70169902 ATTGATTCCAGGAGGTGGTGTGG - Intergenic
1110141280 13:72132412-72132434 TTTTAGTGCAGGAAGTGTTGAGG - Intergenic
1111250233 13:85591913-85591935 CTTTAATCCAGGAGGTCAGTAGG - Intergenic
1111966405 13:94866398-94866420 CTTCAGCCCTGGAGGAGATGAGG - Intergenic
1112516394 13:100056752-100056774 CTTTTTTCAGGGAGGTGATGGGG - Intergenic
1118232806 14:63969422-63969444 CTTGAATCCAGGAGGTGGAGGGG - Intronic
1118298305 14:64590907-64590929 TGATAGTCCAGGAGTTGATGTGG - Intergenic
1118390746 14:65293354-65293376 ATTCAGACCAGAAGGTGATGGGG + Intergenic
1118719819 14:68586073-68586095 CCATAGGCTAGGAGGTGATGGGG - Intronic
1118811255 14:69275776-69275798 CTTGAGTCTGGGAGGTCATGAGG + Intronic
1120319300 14:82939005-82939027 TTTTAATCCGGGATGTGATGGGG + Intergenic
1127440441 15:59001213-59001235 CTTTAGTGGAGTAGGTGAGGAGG + Intronic
1128517656 15:68352914-68352936 CTTTAGACCATGAGGTTCTGAGG + Intronic
1131351555 15:91705487-91705509 CATTTATCCTGGAGGTGATGGGG - Intergenic
1133066381 16:3210345-3210367 CTTTGGTTATGGAGGTGATGTGG + Intergenic
1134421404 16:14093892-14093914 CTTTTTTCCAGGAGCTGATAAGG - Intronic
1135142737 16:19935621-19935643 CTTTACTCCAGGAAGTGTGGGGG + Intergenic
1135510458 16:23078474-23078496 CTCTAGCCCATGAGGTGAGGCGG + Intronic
1136580269 16:31147385-31147407 CATCAGGGCAGGAGGTGATGAGG - Intronic
1137874602 16:51984151-51984173 GTTTAATTCAGGAGCTGATGGGG - Intergenic
1137968402 16:52959383-52959405 CTTGAGCCCAGGAGGTGGAGTGG - Intergenic
1140625107 16:76784043-76784065 CTTAAGAGCAGGGGGTGATGTGG - Intergenic
1141751822 16:85963312-85963334 CTTGAGCCCAGGAGGTCAAGGGG + Intergenic
1142788994 17:2248411-2248433 TTTTAGTCCAGGAGGTGTTGTGG - Intronic
1144283908 17:13753679-13753701 CTTTAGTTCTGGAGGTTATTAGG + Intergenic
1145734574 17:27218367-27218389 CTTTGGTCTAGGAGGTGGAGGGG + Intergenic
1145984566 17:29036694-29036716 CTTCAGACCAGGAGGTGGAGGGG - Intronic
1146950126 17:36899934-36899956 CTTCAGCCCAGGAGGCGAAGAGG + Intergenic
1148155045 17:45418817-45418839 CTTGAGCCCAGGAGCTGAGGAGG + Intronic
1150415251 17:64982746-64982768 CTTTATTCCAGAAGGTTCTGGGG - Intergenic
1150439753 17:65181608-65181630 CTGCACCCCAGGAGGTGATGGGG + Intronic
1150796372 17:68240947-68240969 CTTTATTCCAGAAGGTTCTGGGG + Intergenic
1151617931 17:75226531-75226553 GATTAGGCCAGGAGGTGATTAGG - Intronic
1151902151 17:77023427-77023449 CTTGAATCCAGGAGGGGAGGTGG + Intergenic
1154096115 18:11416745-11416767 CATTAGACCAGTAGGTGCTGAGG + Intergenic
1154977833 18:21476200-21476222 CTTTTCTCCAGGAGATGCTGAGG + Intronic
1156836213 18:41558424-41558446 CTCTTGTCCAGGACGCGATGAGG - Intergenic
1157329960 18:46696476-46696498 CCTTGGTCCAGGGTGTGATGAGG - Intronic
1157336259 18:46739714-46739736 CTTCATTCCCGAAGGTGATGTGG - Intronic
1158215024 18:55091704-55091726 CTTGAGCCCAGGAGGTGGAGAGG - Intergenic
1161642044 19:5430338-5430360 AGTAAGTCCAGGAGGTGCTGGGG + Intergenic
1164527886 19:29025141-29025163 CTTGAGCCCAGGAGGTCAGGAGG + Intergenic
1165103309 19:33453103-33453125 CTTGAGTCCAGGAGTTGGAGAGG + Intronic
1165780475 19:38430771-38430793 CTGTAGTCCTGGGGGTGCTGAGG + Intergenic
1167381578 19:49141345-49141367 CTTTCATGCTGGAGGTGATGAGG - Intronic
1167623802 19:50573566-50573588 CTTGAGCCCAGGAGGTGTGGAGG + Intergenic
925329170 2:3044914-3044936 CTTTAGTCCAGGAGGGTTTGTGG + Intergenic
925329186 2:3044984-3045006 CTTTAGTCTAGGAGGGTTTGTGG + Intergenic
926079607 2:9973882-9973904 CATGAGTCCAGCTGGTGATGTGG - Intronic
926972058 2:18476005-18476027 CTTTAGCCCAGGAGTACATGTGG + Intergenic
927385539 2:22529371-22529393 CTTGAACCCAGGAGGTGAGGCGG - Intergenic
929458356 2:42082958-42082980 TCTTAGTCCAGTAGGTGATGGGG - Intergenic
929637662 2:43541708-43541730 CTTTAGTCCAGGAGGTGATGTGG - Intronic
931041728 2:58308611-58308633 TTTGACTCCAGGAGGTGATGTGG + Intergenic
932362697 2:71122213-71122235 CTTGAGCCCAGGAAGTGCTGAGG - Intronic
933794004 2:85905858-85905880 ATTTAGTTCAGGAGATAATGGGG - Intergenic
935249387 2:101248286-101248308 CTTTAGAAAAGGACGTGATGGGG + Intronic
937135270 2:119546249-119546271 CTTGATTCTAGGAGGTGATTAGG - Exonic
938256433 2:129863164-129863186 CTTGAACCCAGGAGGTGAGGAGG + Intergenic
940916030 2:159257080-159257102 CCTGAGCCCAGGAGGTCATGAGG - Intronic
942334243 2:174864779-174864801 CTTTAGTCCAGGAGTTATTGAGG + Intronic
942898103 2:181082682-181082704 CTTTAGTCCTTGAGTTCATGTGG - Intergenic
944325594 2:198400208-198400230 CTGGAGTCCATGAGATGATGAGG - Intronic
944596430 2:201265629-201265651 GCTTTGTCCTGGAGGTGATGAGG - Intronic
944848593 2:203693525-203693547 CTTTACTCCAGGATATGATGCGG - Intergenic
947629659 2:231643924-231643946 CTTGAGTCCAGGAGTTGGAGAGG + Intergenic
948148316 2:235724974-235724996 CCTTTCTCCAGGAGGTGAAGCGG - Intronic
1169381023 20:5107218-5107240 CTTGAGCCCAGGAGGTGAAGAGG + Intronic
1170328631 20:15183752-15183774 CTTTTGTTCAGGATGTGATTGGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173104852 20:40124166-40124188 TTTTAGGCCAGGAGGAGAGGAGG - Intergenic
1173826307 20:46049870-46049892 CTTTGATCCTGAAGGTGATGAGG - Intronic
1176149156 20:63580544-63580566 CTTGAGTGGAGGAGGTGATAGGG - Intergenic
1176937899 21:14887658-14887680 CTTAACTCTAGGAAGTGATGGGG + Intergenic
1177994545 21:28080714-28080736 CTCTAGCCCTGGAGTTGATGTGG - Intergenic
1179241256 21:39595064-39595086 CTTTAGCCCAGAAGGTTAGGAGG - Intronic
1179424211 21:41260459-41260481 CTTAGGGCCAGGAGTTGATGAGG + Intronic
1179875617 21:44265917-44265939 CTTTACTGCAGGAGGTTCTGGGG - Intergenic
1181098605 22:20523479-20523501 AAATAGTCCAGGAGGTGATGAGG - Intronic
1183258461 22:36778391-36778413 CTTGGGTCCATGAGGTGAAGGGG - Intergenic
1184592519 22:45494553-45494575 CCTCAGGCCAGGCGGTGATGGGG - Intergenic
1184987691 22:48146572-48146594 CTTGAGTGCAGGAGGTGCCGTGG + Intergenic
949703462 3:6786581-6786603 CTTTATTCCAGGAAGTGTTATGG + Intronic
951776115 3:26312197-26312219 CTTTACTCCAGGTGGAAATGTGG + Intergenic
951920161 3:27845719-27845741 CTTTCCTCCAGGTGGTGATTTGG - Intergenic
953033584 3:39193086-39193108 CTTTAGTGCAGAAGGGAATGGGG - Intergenic
954122063 3:48505181-48505203 TTCTTGGCCAGGAGGTGATGGGG - Intergenic
956494392 3:69808796-69808818 TTTTAGTGGAGGAGGTGAGGGGG + Intronic
964314897 3:155433499-155433521 CTTTATTCCAGTAGGTGAAAAGG + Intronic
964537999 3:157746873-157746895 CTCTAGCTCAGGAGGTCATGAGG - Intergenic
971505809 4:27365374-27365396 CTTGAATCCAGGAGGTGGAGGGG + Intergenic
973650856 4:52995856-52995878 TTTTAGACCAGGAGGTAATAGGG - Intronic
974317011 4:60295413-60295435 CATTAGTCGAGGATGAGATGAGG + Intergenic
976106719 4:81627134-81627156 CTTGAACCCAGGAGGTGAGGTGG - Intronic
976148946 4:82073460-82073482 ATTTTGTACAGGAGGTGAAGTGG - Intergenic
977935001 4:102791708-102791730 CTTGAGTCCAGGAGGTCGAGGGG + Intergenic
978974993 4:114858676-114858698 TTTGAGTCCAGGAGTTGATGTGG + Intronic
982735224 4:158999080-158999102 CTTGAGCCCAGGAGGTCAGGAGG + Intronic
982736257 4:159009902-159009924 CTTGAGTCCAGGAGGTTGGGAGG + Intronic
984753606 4:183302980-183303002 CTTGAGCCCAGGAGGTGGGGAGG + Intronic
987087903 5:14487228-14487250 CCTTAGTCCGGGATGTGCTGAGG + Intronic
987520319 5:18974002-18974024 CTTTTGCCCAGGTGGGGATGTGG - Intergenic
990649531 5:57882449-57882471 CCTTTGTTCAAGAGGTGATGTGG + Intergenic
991687943 5:69198859-69198881 CTTGATTCTAGGAGGTCATGGGG + Intronic
992232391 5:74676390-74676412 CTTCAGTCCAGAAGCTGAGGTGG - Intronic
994096989 5:95856514-95856536 CTTTTGTCTGGGAGGTGCTGGGG - Intronic
998227587 5:140338875-140338897 CTTTACCCCAGGAGGTGGAGGGG + Intronic
1000002930 5:157157250-157157272 CTCTACTCCAGCAGGAGATGGGG + Intronic
1006586041 6:35113503-35113525 CTTGAACCCAGGAGGTGAGGCGG + Intergenic
1007294451 6:40811342-40811364 CTACACTCCAGGAGGAGATGGGG + Intergenic
1010919903 6:81668486-81668508 CTTGAACCCAGGAGGTGAAGGGG + Intronic
1011585131 6:88916389-88916411 CTTGAGTCCAGGAGGTGGAGGGG + Intronic
1012022875 6:93947397-93947419 CTTTAATCAAGGTGGTGGTGGGG - Intergenic
1012447426 6:99321121-99321143 TTATAGTCCAGGGGGTGATGAGG - Intronic
1015758857 6:136635797-136635819 CTTGAGCCCAGGAGGTCAAGAGG + Intronic
1016769745 6:147835806-147835828 CTGGAGACAAGGAGGTGATGCGG - Intergenic
1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG + Intergenic
1022616705 7:31938947-31938969 CTTTGGTGCTGGAGGTGGTGAGG - Intronic
1027262906 7:76477714-76477736 CTTTAGCCCAGGAGACCATGGGG + Intronic
1027314289 7:76975823-76975845 CTTTAGCCCAGGAGGCCATGGGG + Intergenic
1028287783 7:89024925-89024947 TTTTTGTCCAGGAGGGAATGAGG + Intronic
1030535160 7:110757480-110757502 CTTTGTCCCAGGAGGTTATGTGG + Intronic
1031806398 7:126312540-126312562 CTTGTGTCCAGGAGGTAGTGCGG - Intergenic
1031923766 7:127619795-127619817 CTTTCGACCCAGAGGTGATGGGG + Intergenic
1033037722 7:137890566-137890588 CATTATTCCATGAGCTGATGTGG - Intronic
1033820127 7:145125253-145125275 CTTTTGTCCAGGAGGGAAAGTGG + Intergenic
1035420773 7:158727699-158727721 CTTGAGCCCAGGAGGTTAGGAGG - Intergenic
1037710231 8:21349514-21349536 CTTTAGTCCAGTGGCTCATGGGG + Intergenic
1038547901 8:28440182-28440204 CTTGAGCCCAGGAGGTTAAGGGG - Intronic
1038801771 8:30755672-30755694 CTTGAGCCCAGGAGGTCAAGAGG + Intronic
1040584739 8:48728145-48728167 ATTTAGTCTTGAAGGTGATGAGG - Intronic
1042282796 8:67072612-67072634 CTTGAGTCCAGGAATTGAAGGGG + Intronic
1046225024 8:111267193-111267215 CTTGAGTCCAGGAGTTCAAGAGG + Intergenic
1047387704 8:124425361-124425383 GCTTAGTCCAGAAGGTGATAGGG - Intergenic
1047867962 8:129049610-129049632 CTCTAGACCAGGAGGTCATAAGG + Intergenic
1048197346 8:132342897-132342919 TTATAGTGCAGTAGGTGATGGGG - Intronic
1048430566 8:134366839-134366861 CTGTGGACCAGGAGGTCATGTGG - Intergenic
1048973336 8:139657342-139657364 CATTAGTCACAGAGGTGATGAGG + Intronic
1049482171 8:142831044-142831066 GTTTAGGCCAGGAGGGGAAGTGG + Intergenic
1055063313 9:72093041-72093063 GTTTATTCCAGGTGGTCATGGGG + Intergenic
1055486108 9:76758366-76758388 TTTCAGTCCAGGAGGTGCTGAGG + Intronic
1059771074 9:117426421-117426443 CTGTAGTCAAGGCTGTGATGAGG + Intergenic
1060474099 9:123974263-123974285 CTTTATCCCTGAAGGTGATGAGG + Intergenic
1061142102 9:128773437-128773459 CTTGAGCCCAGGAGGTGGGGAGG + Intergenic
1062272346 9:135715214-135715236 TTTTAGCCCAGGAGATGTTGAGG - Intronic
1185728582 X:2443247-2443269 CTTGAGTCCAGGAGTTTAAGAGG - Intronic
1186028870 X:5345529-5345551 TTGGAGTCCAGGAGGTGAAGTGG - Intergenic
1187445863 X:19360434-19360456 CTTGAGCCCAGGAGGTGTGGAGG - Exonic
1187842392 X:23502241-23502263 CTTGAGCCCAGGAGGTAAGGAGG - Intergenic
1189257324 X:39650715-39650737 TTTTGGTCGGGGAGGTGATGAGG - Intergenic
1190118512 X:47641357-47641379 GTGAAGTCCAGGAGATGATGTGG + Exonic
1190591221 X:52003731-52003753 CCTGATTCCAGGAGCTGATGGGG - Intergenic
1191903743 X:66065516-66065538 CTTGAGTCCAGGAGCTCAAGAGG - Intergenic
1198613904 X:138432587-138432609 CTTTAGTGAAGAAGGTGATGAGG + Intergenic
1201342120 Y:12945743-12945765 CTTGAGTCCTGGAGGTGGAGTGG - Intergenic