ID: 929646915

View in Genome Browser
Species Human (GRCh38)
Location 2:43637332-43637354
Sequence GGCCGCAGCGCCCGATGTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929646915_929646926 24 Left 929646915 2:43637332-43637354 CCGGGACATCGGGCGCTGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 929646926 2:43637379-43637401 GGTGAGAAAGCCCGGGGACGAGG 0: 1
1: 0
2: 2
3: 13
4: 152
929646915_929646924 17 Left 929646915 2:43637332-43637354 CCGGGACATCGGGCGCTGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 929646924 2:43637372-43637394 ATAGACAGGTGAGAAAGCCCGGG 0: 1
1: 0
2: 0
3: 27
4: 236
929646915_929646920 3 Left 929646915 2:43637332-43637354 CCGGGACATCGGGCGCTGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 929646920 2:43637358-43637380 GACCCGCTGCTGAGATAGACAGG 0: 1
1: 0
2: 1
3: 8
4: 48
929646915_929646925 18 Left 929646915 2:43637332-43637354 CCGGGACATCGGGCGCTGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 929646925 2:43637373-43637395 TAGACAGGTGAGAAAGCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 116
929646915_929646927 25 Left 929646915 2:43637332-43637354 CCGGGACATCGGGCGCTGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 929646927 2:43637380-43637402 GTGAGAAAGCCCGGGGACGAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
929646915_929646928 26 Left 929646915 2:43637332-43637354 CCGGGACATCGGGCGCTGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 929646928 2:43637381-43637403 TGAGAAAGCCCGGGGACGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 133
929646915_929646923 16 Left 929646915 2:43637332-43637354 CCGGGACATCGGGCGCTGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 929646923 2:43637371-43637393 GATAGACAGGTGAGAAAGCCCGG 0: 1
1: 0
2: 0
3: 29
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929646915 Original CRISPR GGCCGCAGCGCCCGATGTCC CGG (reversed) Exonic
900342453 1:2195319-2195341 GGTCGCAGAGCCCGGGGTCCAGG - Intronic
900414870 1:2530314-2530336 GGCCGCGGCGCCCGGACTCCAGG - Intergenic
906318008 1:44800511-44800533 GGCCGCCGCGCCCGCTCCCCCGG + Exonic
910449019 1:87328609-87328631 GGCCGCAGCCCCCGACGCCTGGG + Exonic
913131092 1:115838881-115838903 AGCCGCGGCGCCCGAGGGCCTGG + Exonic
913186229 1:116373080-116373102 GGCCGCAGCAGGCGCTGTCCGGG + Intronic
921909079 1:220528279-220528301 GGCGGCGGCGCCCGATCCCCCGG - Intronic
1063138927 10:3239726-3239748 GGCCGCAGCACCCTACGCCCCGG + Intergenic
1067145632 10:43691793-43691815 GGCTGCAGCCCCTGAAGTCCTGG + Intergenic
1073812397 10:107164825-107164847 GGACGCGGCGCCCGGAGTCCCGG - Intergenic
1073884170 10:108019356-108019378 GGCTTCAGCGCCCCATTTCCAGG - Intergenic
1076675534 10:132145760-132145782 GGCCCCAGCTCCCTCTGTCCAGG - Intronic
1077360101 11:2137085-2137107 GGCTGCAGGGCCCGAGGCCCAGG + Intronic
1078317341 11:10304648-10304670 GGCCACAGCTCCCCAGGTCCAGG + Intergenic
1080592656 11:33736815-33736837 GGCCGCATAGCCCGATAGCCAGG - Intergenic
1080802058 11:35618520-35618542 GGCCGAAGCGCCCGAAGCCCCGG + Exonic
1081989194 11:47328566-47328588 GGCGGCAGCGCCCGGCGTCAGGG - Intronic
1090526925 11:127546964-127546986 GTCTGAAGTGCCCGATGTCCAGG - Intergenic
1102646930 12:114409602-114409624 GGCTGCAGGGCCCGCAGTCCGGG - Intergenic
1113484323 13:110643187-110643209 GGCCGCAAGGCCCAATGTCTGGG - Intronic
1126738145 15:51751903-51751925 GGGCGCAGCGCCTGGTCTCCCGG - Intronic
1128453868 15:67822182-67822204 GGCCGCTGCGCCCCCTGCCCAGG + Intronic
1132548345 16:543880-543902 GGCCACAGCACCTGCTGTCCTGG - Intronic
1136483183 16:30555448-30555470 GGAAGCAGCGCCCGCAGTCCGGG + Exonic
1138390686 16:56668154-56668176 GTCCGCACCGCCCGCGGTCCCGG + Intronic
1139421400 16:66851513-66851535 GGCCTCAGCACCTGATGGCCTGG + Exonic
1142036064 16:87862718-87862740 GGCCCCAGCGCCAGGTGTCTGGG - Intronic
1144776504 17:17787634-17787656 GGCCGCAGGGCCCACAGTCCAGG - Intronic
1144869921 17:18363169-18363191 AGCCGCAGCGCCCCAGTTCCAGG - Intronic
1148755659 17:49971824-49971846 GCCCGCAGCGCCCGAGGCCACGG + Intronic
1150675747 17:67245034-67245056 GGCCGCCGCGCCCGGGGTCCGGG + Intronic
1152092413 17:78254364-78254386 GCCCGGAGCGCCCCATGTACCGG + Intergenic
1152457209 17:80423331-80423353 GCCCCCTGTGCCCGATGTCCTGG - Intronic
1152676756 17:81645237-81645259 GGCCCCAGAGCCCGATGGCCAGG - Exonic
1152751207 17:82063206-82063228 GGGCCCAGCCCCAGATGTCCTGG - Intronic
1156799827 18:41096590-41096612 TGCCGCAGTGCCTTATGTCCAGG + Intergenic
1158404310 18:57147363-57147385 GGCCGCCGCCCCCGCTGGCCCGG - Exonic
1159578276 18:70206008-70206030 CGCCGCGGCGCCCGCTGGCCTGG + Intergenic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1160873184 19:1286135-1286157 GGCCGCCGCGCTCGCTCTCCCGG - Exonic
1162030931 19:7916959-7916981 GGCCCCAGCGCCCGGATTCCAGG - Intronic
1162393534 19:10403704-10403726 AGCCCCAGCGCCCGATGACGCGG - Intronic
1162410484 19:10502602-10502624 GGCCGTGGCGCCCGTTTTCCTGG + Intronic
1163559387 19:18009938-18009960 TGCCACAGCGCCCGCTGCCCGGG - Exonic
1163826865 19:19528898-19528920 GGCGGCAGCGCCCGGCGCCCGGG + Exonic
1166883023 19:45940414-45940436 GGCCGCAGCTTCCGGCGTCCTGG - Exonic
1168270528 19:55247374-55247396 GGCCGCCTCGCCTGAGGTCCAGG + Intronic
927145762 2:20164612-20164634 GGCCACAGCGGCAGATGTCCTGG + Intergenic
929646915 2:43637332-43637354 GGCCGCAGCGCCCGATGTCCCGG - Exonic
942278089 2:174336927-174336949 AGCCGCGGCGCCCGATATCATGG - Exonic
948755364 2:240156547-240156569 GGCCTCCGCCCACGATGTCCAGG + Intergenic
1175312431 20:58020964-58020986 GCCCGCAGTGGCAGATGTCCAGG + Intergenic
1175872695 20:62215935-62215957 GGCAGCAGGGCCAGATGCCCAGG + Exonic
1178916480 21:36708120-36708142 GGCTGCAGCGCCAGATGGCGAGG - Intronic
1180109853 21:45642829-45642851 GGCCGCAGCGCCCGGCGGGCAGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181165898 22:20982739-20982761 AGTCCCAGAGCCCGATGTCCCGG + Intronic
1182380394 22:29883101-29883123 GGGCGCTGAGCCCGGTGTCCGGG - Intergenic
1184679161 22:46061308-46061330 GGCCGCAGAGCCCCCTCTCCCGG + Intronic
953457444 3:43054301-43054323 GGCCGCATCACCCGAAGCCCAGG + Intronic
954539722 3:51385400-51385422 GGCCGCAGCGCCCGGCTGCCCGG - Exonic
954618604 3:51983293-51983315 GGCCGCGGCGGCCGCTGCCCGGG + Exonic
968512852 4:1003058-1003080 GGCTGCAGAGCCCGTTGTCCAGG - Exonic
968718396 4:2178967-2178989 GGCCACAGTGCCAGAGGTCCTGG - Intronic
969584128 4:8082229-8082251 GGCCCCAGGGCCCGACGTGCTGG + Intronic
970537193 4:17041809-17041831 GGCCTCAGCGCACGATGACCAGG + Intergenic
972686775 4:41360336-41360358 TGCCGCAGCGCCCGCTCCCCCGG + Intronic
978503578 4:109433950-109433972 AGCCGCAGCGCCCGCGGGCCCGG + Exonic
985784153 5:1885517-1885539 GGCCCCAGCGCCTGGGGTCCGGG + Intronic
985865142 5:2508726-2508748 AGCCCCAGCGACCCATGTCCGGG - Intergenic
987235372 5:15936772-15936794 GGCCGCAGTGCGCGATGCTCAGG - Exonic
995831749 5:116361838-116361860 GGCCGCAGCTCTCGCTGGCCCGG + Intronic
1000995323 5:167952730-167952752 GGCCCCAGCGCCCAATGACCTGG + Exonic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1020461445 7:8433814-8433836 GGCCGCAGCGCCCCCTTCCCGGG - Intergenic
1021959919 7:25860811-25860833 GGCCGCAGCACCCGGCCTCCAGG + Intergenic
1022503194 7:30895211-30895233 AGCAGCACCGCCTGATGTCCAGG + Intergenic
1033357119 7:140608965-140608987 GGTCGCAGAGGCCAATGTCCTGG + Intronic
1034385556 7:150737931-150737953 GGCAGCAAAGCCCGCTGTCCTGG - Intronic
1035050783 7:155998074-155998096 GGGCGCAGGGCCCGCTGTGCAGG + Intergenic
1038783031 8:30584781-30584803 GGCCTCAGAGCCAGATGGCCTGG + Intronic
1039432413 8:37535215-37535237 GGTAGCAGCGCCCTGTGTCCTGG - Intergenic
1044973895 8:97644794-97644816 GGCCGCGGCCCCCGACGACCTGG + Exonic
1049777627 8:144413857-144413879 GGCCGCAGGGCCCGTCCTCCAGG + Exonic
1052295481 9:26892637-26892659 GGCCGCAGCGCTCGCGGCCCCGG - Exonic
1062044183 9:134417573-134417595 GGCCGCAGGGCCCCAGGCCCCGG - Intronic
1203771974 EBV:54100-54122 GGCCGAGGCGGCCGAGGTCCGGG - Intergenic
1200084800 X:153598919-153598941 GGCCGCGGCGCCGCCTGTCCTGG + Intronic