ID: 929650529

View in Genome Browser
Species Human (GRCh38)
Location 2:43676319-43676341
Sequence CTGTCCTAACGCCTGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929650529_929650533 -6 Left 929650529 2:43676319-43676341 CCATTTTCCAGGCGTTAGGACAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 929650533 2:43676336-43676358 GGACAGTGTGCCAGGGTCAAAGG 0: 1
1: 0
2: 0
3: 14
4: 198
929650529_929650540 16 Left 929650529 2:43676319-43676341 CCATTTTCCAGGCGTTAGGACAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 929650540 2:43676358-43676380 GCAGCCTGGGACCGGGTCCTGGG 0: 1
1: 1
2: 0
3: 21
4: 307
929650529_929650541 17 Left 929650529 2:43676319-43676341 CCATTTTCCAGGCGTTAGGACAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 929650541 2:43676359-43676381 CAGCCTGGGACCGGGTCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 321
929650529_929650539 15 Left 929650529 2:43676319-43676341 CCATTTTCCAGGCGTTAGGACAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 929650539 2:43676357-43676379 GGCAGCCTGGGACCGGGTCCTGG 0: 1
1: 0
2: 2
3: 35
4: 362
929650529_929650534 2 Left 929650529 2:43676319-43676341 CCATTTTCCAGGCGTTAGGACAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 929650534 2:43676344-43676366 TGCCAGGGTCAAAGGCAGCCTGG 0: 1
1: 0
2: 3
3: 27
4: 298
929650529_929650538 9 Left 929650529 2:43676319-43676341 CCATTTTCCAGGCGTTAGGACAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 929650538 2:43676351-43676373 GTCAAAGGCAGCCTGGGACCGGG 0: 1
1: 0
2: 2
3: 31
4: 285
929650529_929650535 3 Left 929650529 2:43676319-43676341 CCATTTTCCAGGCGTTAGGACAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 929650535 2:43676345-43676367 GCCAGGGTCAAAGGCAGCCTGGG 0: 1
1: 0
2: 3
3: 106
4: 314
929650529_929650537 8 Left 929650529 2:43676319-43676341 CCATTTTCCAGGCGTTAGGACAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 929650537 2:43676350-43676372 GGTCAAAGGCAGCCTGGGACCGG 0: 1
1: 1
2: 3
3: 25
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929650529 Original CRISPR CTGTCCTAACGCCTGGAAAA TGG (reversed) Intronic
900536333 1:3179530-3179552 CCGTCCCAACACCTGGAAACAGG + Intronic
901870001 1:12132947-12132969 CTGTCCTCCCAGCTGGAAAATGG - Intronic
916326846 1:163571107-163571129 CAGTCTTATCGCCTGTAAAATGG + Intergenic
917512066 1:175676949-175676971 CAGTCCTCTCACCTGGAAAATGG - Intronic
918197308 1:182234517-182234539 CTTTTCTAGCACCTGGAAAATGG - Intergenic
918413535 1:184284864-184284886 CTGATCTAAAGCCTGGAATAGGG + Intergenic
920580045 1:207097952-207097974 CTCTCCTACCTCCAGGAAAATGG + Intronic
924530326 1:244888431-244888453 ATGTCCTAATTCCTGCAAAAGGG + Intergenic
1070979714 10:80634380-80634402 CTCTCCTACCGCCTGCAGAAAGG + Intronic
1078601742 11:12738236-12738258 CTGCCTTAAAGCATGGAAAATGG + Intronic
1079940126 11:26670303-26670325 CTTTCCTTAGCCCTGGAAAAAGG + Exonic
1080916567 11:36666319-36666341 CTGTCCCAACAGCAGGAAAACGG + Intergenic
1081197981 11:40184853-40184875 CTGTCCTAAGAGGTGGAAAATGG - Intronic
1082807175 11:57458685-57458707 CTGTCCTGCCTCCTGGAAATAGG + Intergenic
1084732856 11:71084547-71084569 CTGTTCTAGCACCTGGAGAATGG - Intronic
1087158991 11:94930955-94930977 ATGTCCTAACCCTTGGATAAAGG - Intergenic
1090793092 11:130109273-130109295 CTGTTCTAGCTCCTGGGAAAAGG + Intronic
1090992470 11:131831425-131831447 ATGTCCTCATGGCTGGAAAATGG + Intronic
1091856319 12:3743432-3743454 CTCTCCACACGCCTGTAAAATGG - Intronic
1093569811 12:20654077-20654099 CAGGACTAATGCCTGGAAAATGG + Exonic
1096453529 12:51766243-51766265 CTTTCCTAACTCTAGGAAAAGGG - Intronic
1100749990 12:97687844-97687866 CTGCACTACAGCCTGGAAAATGG + Intergenic
1102843441 12:116151425-116151447 CTGTCCTAACACCTTGCTAATGG - Intronic
1103276840 12:119718882-119718904 ATCTCCTAACTCCTGGAAACTGG + Intronic
1104747765 12:131220878-131220900 CTGTCCTAACGCCGGCACAGAGG - Intergenic
1105434714 13:20366419-20366441 CTCTCCTCACCCCTGGGAAAAGG + Intergenic
1108080697 13:46731887-46731909 CTGTCCTAAGGCGTTGAGAATGG - Intronic
1109851470 13:68070803-68070825 CTGCTCTATCTCCTGGAAAAAGG - Intergenic
1114688246 14:24555408-24555430 CTATTCTAAGGTCTGGAAAATGG - Intergenic
1115641307 14:35337216-35337238 TTGTCCTCATGGCTGGAAAAGGG - Intergenic
1118325893 14:64780130-64780152 CTGTCCTACCCACTGCAAAAGGG + Intronic
1119068203 14:71552111-71552133 CTGTCCTAAAGCCTGGGGAAAGG - Intronic
1124090837 15:26598673-26598695 CTTTCCAAATGCTTGGAAAATGG - Intronic
1125514871 15:40312865-40312887 GATTCCTAAAGCCTGGAAAAAGG + Intergenic
1130425553 15:83794887-83794909 CTGTACTCAAGCCTGGACAACGG - Intronic
1133836196 16:9369645-9369667 ATGTTCTAACCCCTGGAAATAGG + Intergenic
1134811994 16:17175622-17175644 CTGTCCTCTCTCATGGAAAATGG + Intronic
1135493264 16:22928873-22928895 CTGTCCTAACGTCTTGGGAATGG - Intergenic
1138346493 16:56323516-56323538 CTTTCCTAATGCCTGGAACTTGG - Intronic
1138914119 16:61442119-61442141 CTGCCCAAACCCCTGGCAAACGG - Intergenic
1140247717 16:73266537-73266559 CTGTCTTCACGTCTGCAAAATGG - Intergenic
1140893959 16:79308854-79308876 CTTTCCTAACGCCCAGAAATGGG + Intergenic
1141932538 16:87215748-87215770 CTCTCCTAACACCTGCAGAAAGG - Intronic
1142899921 17:3005427-3005449 GTGTCCTACCTTCTGGAAAACGG - Exonic
1145882405 17:28361848-28361870 CTGTCTTATCTTCTGGAAAAGGG - Exonic
1149886823 17:60348426-60348448 CTCTCCAAAGGCCAGGAAAAGGG + Intronic
1156410316 18:36821958-36821980 CTTTCATAAAGCCTGGAAGAAGG + Intronic
1157719881 18:49915509-49915531 CTGTCTTATGGCCTGGGAAAGGG + Intronic
1158378438 18:56900805-56900827 ATGGCCTAACCCTTGGAAAATGG - Intronic
1159254383 18:65927032-65927054 CTTTCCTAAACCCTGGTAAATGG - Intergenic
1161786712 19:6331021-6331043 CTGTTTTATCACCTGGAAAATGG + Intronic
1163804740 19:19388608-19388630 ATGGCCTCACGGCTGGAAAATGG - Intronic
925628183 2:5862789-5862811 CTGAGCTAAGTCCTGGAAAAAGG + Intergenic
927759258 2:25737263-25737285 CTCCCCTAAGGCCTGGAAAGTGG + Intronic
928071860 2:28225108-28225130 CTTTCCTGAAGCCTGGATAAAGG + Intronic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
937674614 2:124576364-124576386 CTGTCGTGATGCCTGGAAGAGGG + Intronic
937983632 2:127628886-127628908 CTGGCCTCACGTCTGTAAAATGG - Intronic
942556403 2:177176438-177176460 CTAGCCTAAGGCCTGGAAGAGGG - Intergenic
944789692 2:203111992-203112014 TTGTCCACATGCCTGGAAAAAGG + Exonic
946007821 2:216540653-216540675 CTGTCCTAAGGCCTAGATCAAGG + Intronic
946442813 2:219711199-219711221 CTTTCCTAGCTTCTGGAAAAAGG + Intergenic
947452269 2:230219899-230219921 CTGTCCCAGCCCCTGGAAAGGGG - Exonic
948662983 2:239518172-239518194 CTGTCCAATCGCCTGGAAGCTGG - Intergenic
1170494753 20:16914380-16914402 GTGTCCTAACTCCTAGAACAAGG + Intergenic
1172071517 20:32260772-32260794 CTGGCCTAACCTCTGGAAAATGG + Intergenic
1173585010 20:44175784-44175806 CTGACCCAAGGCCTGGAAATGGG - Intronic
1175184067 20:57167969-57167991 CTGGCCTTCAGCCTGGAAAATGG + Intergenic
1181783301 22:25208185-25208207 CTGTCCTTAGGCCTTGAACAGGG - Intergenic
1185197088 22:49478364-49478386 CTGTTCTCACTCCTGTAAAATGG + Intronic
950686259 3:14620648-14620670 GTGTCCTAGCAACTGGAAAAGGG - Intergenic
951292745 3:20893606-20893628 CTGTCCTAAGACCTAGAATAAGG + Intergenic
954685851 3:52369765-52369787 CAGTCCTCAGGCCTGGAGAAAGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
957562713 3:81844062-81844084 GTTTCCTAACTGCTGGAAAAGGG + Intergenic
959898927 3:111638238-111638260 CTGGCATAATGCCTGGCAAATGG - Intronic
970145951 4:13035907-13035929 TTGTCCTAACACCTGGGAAAGGG + Intergenic
972066326 4:34950439-34950461 CTGTCCTGAAGGCTGGAAATAGG + Intergenic
972354206 4:38265098-38265120 CTTTCCTGAAGACTGGAAAAAGG + Intergenic
973549402 4:52017607-52017629 TTTTCATAATGCCTGGAAAAAGG + Exonic
982314829 4:154021613-154021635 CAGTCCTAACCCCAGGAACATGG - Intergenic
983314184 4:166106552-166106574 CTGCCCTAACTGGTGGAAAAAGG + Intergenic
983359032 4:166704455-166704477 ATGTCCTAATGCCAGGAAAATGG - Intergenic
986817138 5:11425316-11425338 CTATCCTAATGCCTGGAAAGGGG + Intronic
986842884 5:11718158-11718180 CTGTCGTAGTGCCTGGAATATGG - Intronic
987197479 5:15541579-15541601 CTGTACTTCAGCCTGGAAAACGG - Intronic
991283258 5:64940105-64940127 CTGTTCACATGCCTGGAAAAGGG - Intronic
992558522 5:77927605-77927627 CTTTCCTGAGGGCTGGAAAATGG + Intergenic
993483263 5:88450822-88450844 CTCTCCTAAAGCCTCTAAAAGGG - Intergenic
993844361 5:92922199-92922221 AACTCCTAACTCCTGGAAAATGG + Intergenic
996706206 5:126501440-126501462 CTGTCGTGAGGCCTGCAAAAGGG - Intergenic
1000381648 5:160635019-160635041 CTGTTCTAAGTCCTGGAAATGGG + Intronic
1000746125 5:165036138-165036160 CTGTGCTAAAGCTTTGAAAAAGG - Intergenic
1001079161 5:168654260-168654282 CTGGCCTAATTCCTGGAAAATGG - Intergenic
1002705123 5:181155632-181155654 CTCTGCTCAGGCCTGGAAAAAGG + Exonic
1003989807 6:11474416-11474438 CTTTCCTACCTCCAGGAAAAAGG - Intergenic
1004427600 6:15516951-15516973 CTGACCAAACACCTGGAACATGG - Intronic
1005087746 6:22024228-22024250 CTGTTATAACGTCTGCAAAATGG - Intergenic
1006375775 6:33670990-33671012 CTGTTCCAATGCCTGGGAAAGGG + Intronic
1007024591 6:38557604-38557626 TTGTCATAATGCCTGGAAGAAGG - Intronic
1008288133 6:49679596-49679618 CTGACCTAAGGCATGGAATATGG - Intergenic
1011902910 6:92322796-92322818 CTGTCTCTATGCCTGGAAAATGG + Intergenic
1014825543 6:126045613-126045635 CTCTCCAAACGCCCAGAAAAGGG - Intergenic
1022614610 7:31916521-31916543 CTGTTCTCACACCAGGAAAATGG - Intronic
1022993844 7:35733730-35733752 CAGTGCTAAGGCCTGGAATAAGG + Intergenic
1033027565 7:137790759-137790781 CTGTATTATCACCTGGAAAATGG + Intronic
1033638941 7:143241992-143242014 CTATTCTAATGCCTGCAAAATGG - Intergenic
1033903241 7:146168984-146169006 ATGTACGAAAGCCTGGAAAAAGG - Intronic
1035552818 8:543653-543675 CATTCCTAACTCATGGAAAATGG - Intronic
1036219536 8:6909755-6909777 TGGCCCTAAAGCCTGGAAAAGGG - Intergenic
1039019325 8:33187661-33187683 CTGCCCTACCTCCTGGAAACTGG - Intergenic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1047334581 8:123923257-123923279 CTGTCCCATCACCTAGAAAATGG - Intronic
1048565094 8:135588059-135588081 CTGTGCTAACTCCTGGTAAATGG - Intronic
1057078257 9:92152356-92152378 CTGTTCTAACAACTGAAAAACGG + Intergenic
1059705873 9:116822787-116822809 CTGTCCTAAGCCCTGGAACTTGG + Intronic
1060246427 9:121950419-121950441 CTGTCCCAAAGCCTGACAAAGGG + Intronic
1186666510 X:11722311-11722333 CTGTCCGAAAGCCAGGAAGAGGG + Intergenic
1187871017 X:23765517-23765539 CTGTCCCAATGCTTTGAAAATGG - Intronic
1190825677 X:54016023-54016045 GTGTCCTAAGGTCTTGAAAAAGG + Intronic
1196569559 X:117249433-117249455 CTGTGTTAATGCTTGGAAAAAGG + Intergenic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic