ID: 929652207

View in Genome Browser
Species Human (GRCh38)
Location 2:43691601-43691623
Sequence GGGACCTGCCCCATCTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 4, 1: 18, 2: 24, 3: 44, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929652203_929652207 2 Left 929652203 2:43691576-43691598 CCAGCTTGAAGGTTGGGTTTCAC 0: 2
1: 7
2: 37
3: 58
4: 164
Right 929652207 2:43691601-43691623 GGGACCTGCCCCATCTGCCTAGG 0: 4
1: 18
2: 24
3: 44
4: 299
929652199_929652207 15 Left 929652199 2:43691563-43691585 CCAGGGACTGTTTCCAGCTTGAA 0: 1
1: 6
2: 9
3: 29
4: 185
Right 929652207 2:43691601-43691623 GGGACCTGCCCCATCTGCCTAGG 0: 4
1: 18
2: 24
3: 44
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929652207 Original CRISPR GGGACCTGCCCCATCTGCCT AGG Intronic
900148922 1:1169809-1169831 GGGGACTGCCCCATCTCCCCAGG - Intergenic
900570263 1:3354871-3354893 CGGTCCTGCCTCTTCTGCCTGGG - Intronic
901490548 1:9594363-9594385 GGGATCTCCCCCAGCAGCCTCGG - Intronic
901727114 1:11250533-11250555 TGTTCCTTCCCCATCTGCCTTGG + Intronic
902084081 1:13844286-13844308 GTGACCTGCCCCTTCTCTCTAGG + Intergenic
902604035 1:17558898-17558920 GGGCCCTTCCCCAGCTTCCTCGG + Intronic
902924947 1:19689892-19689914 GGGACCCACCCCGTCTGCCTAGG - Intronic
903028022 1:20443330-20443352 GACCACTGCCCCATCTGCCTGGG - Intergenic
903263749 1:22144317-22144339 GGCACCTGTCCCACCTCCCTAGG + Intergenic
903634710 1:24803846-24803868 GCGAGCTGCCTCATCTTCCTTGG + Intronic
905215204 1:36401732-36401754 GGCATCTGCCCCTTCTGCCTAGG + Intergenic
905220937 1:36446996-36447018 GGAAGCTGCAACATCTGCCTTGG + Intronic
905241194 1:36582594-36582616 GGGACCTGCCCCCACTCCCATGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906132594 1:43469398-43469420 GAGCCCTGCCCCTTCTGCATTGG - Intergenic
906140147 1:43529576-43529598 GGGACCTACCCCCACTGCCCTGG - Intronic
906484841 1:46226252-46226274 TGGACCTGCCACCTCCGCCTTGG - Intergenic
909388759 1:75092483-75092505 GGGGCATTCCCTATCTGCCTAGG + Intergenic
909666091 1:78134900-78134922 AGGACTTGCCCCAGCTGTCTGGG - Intronic
909963689 1:81880837-81880859 GGACCCTTCCCTATCTGCCTAGG + Intronic
911804958 1:102194499-102194521 GGGACCTTTCCTATATGCCTAGG - Intergenic
913670037 1:121088729-121088751 GTGAGGTGCTCCATCTGCCTGGG + Exonic
914021802 1:143876127-143876149 GTGAGGTGCTCCATCTGCCTGGG + Intergenic
914660288 1:149784078-149784100 GTGAGGTGCTCCATCTGCCTGGG + Exonic
916683031 1:167121514-167121536 GGGATCTGCCTCATCCGCCCTGG - Intronic
917504588 1:175616294-175616316 GGGATGTCCCCCACCTGCCTTGG + Intronic
919838375 1:201592123-201592145 GGAAGCTGCCCCACCTGCATGGG + Intergenic
920627187 1:207613556-207613578 GGGATCTGCCCCATCTGCCTAGG + Intronic
920920458 1:210293483-210293505 TGGAGCTGCTCCCTCTGCCTCGG - Intergenic
921928440 1:220732832-220732854 GGGACCTCCCCTTTCTGGCTGGG + Intergenic
923088513 1:230720495-230720517 GGGACCCGCCCCATCTGCCTAGG - Intergenic
924317877 1:242817303-242817325 GGACCCTCCCCTATCTGCCTAGG + Intergenic
924707182 1:246510508-246510530 GGGCCGGGCCCCACCTGCCTGGG + Intergenic
1064048709 10:12042486-12042508 GGTGCCTGCCCCACATGCCTGGG - Intronic
1066307638 10:34162071-34162093 GGACCCTTCCCTATCTGCCTAGG - Intronic
1067420901 10:46146326-46146348 GGGACATGTGCCATCTACCTGGG + Intergenic
1067490729 10:46698947-46698969 GGGACATGTGCCATCTCCCTGGG + Intergenic
1067506240 10:46852791-46852813 GGGACATGTGCCATCTACCTGGG + Intergenic
1067603932 10:47641420-47641442 GGGACATGTGCCATCTCCCTGGG - Intergenic
1067702228 10:48582188-48582210 GGGATCTGCCCTCTCTGACTTGG + Intronic
1067713760 10:48671546-48671568 AGGACCTGTCCCTTCCGCCTGGG + Intergenic
1068393999 10:56437618-56437640 GGGACATGTGCCATCTCCCTGGG - Intergenic
1068889480 10:62133796-62133818 AGCACTTGCACCATCTGCCTTGG - Intergenic
1069156603 10:65037623-65037645 GGGACCTGCCCTATCTGCCTAGG - Intergenic
1069486875 10:68828987-68829009 GGGAGCTGACACACCTGCCTGGG - Intronic
1069769940 10:70891798-70891820 GGACCCACCCCCATCTGCCTAGG + Intergenic
1069834982 10:71302602-71302624 GGGACCCGGCTCAGCTGCCTAGG - Exonic
1070289086 10:75103274-75103296 TGGACCTGTCCCATCGGCCTTGG - Intronic
1070858724 10:79630560-79630582 GGGACATGTGCCATCTACCTGGG + Intergenic
1073206842 10:101774202-101774224 GAGCCCTGCCCCAGCCGCCTGGG + Intronic
1074541311 10:114367409-114367431 GGGATTTGGCCCATCTGTCTGGG + Intronic
1074884910 10:117685834-117685856 GGGCCCTGCCCTACATGCCTGGG - Intergenic
1075690920 10:124393629-124393651 GGGACCGCCCCTATCAGCCTAGG + Intergenic
1075875180 10:125800175-125800197 GGACCCTTCCCTATCTGCCTAGG - Intronic
1077207127 11:1350045-1350067 TGGACCTGGCTCCTCTGCCTGGG + Intergenic
1077217411 11:1400739-1400761 AGGACCTGCCGGCTCTGCCTGGG + Intronic
1077275659 11:1706302-1706324 GGACCCACCCCCATCTGCCTGGG - Intergenic
1078047164 11:7925863-7925885 GGAACCCACCCCATCTGCCTAGG - Intergenic
1078468642 11:11569624-11569646 GGGCTATGTCCCATCTGCCTGGG + Intronic
1078476995 11:11639194-11639216 GGGAGCTGCTCCATCAGCTTGGG + Intergenic
1079112464 11:17612541-17612563 GGAACCTGCCCCATCTTCCTAGG + Intronic
1080851997 11:36078269-36078291 GGGACCTACCCCTTCTGCCTAGG + Intronic
1083944970 11:65918749-65918771 GGGAACCGCCCCATTGGCCTCGG - Intronic
1085298850 11:75446608-75446630 GGGACAGGCCACATCTGCATAGG + Intronic
1085507787 11:77069988-77070010 GGGACCTGGCCCCTTTGCCTTGG - Intronic
1085709280 11:78814320-78814342 GGGACCTGCCACTGCTTCCTGGG - Exonic
1086343871 11:85875358-85875380 GGGACCGGCCCCATCTGCCTAGG + Intronic
1087483554 11:98733062-98733084 GGACCCAGCCCTATCTGCCTAGG - Intergenic
1088890548 11:114040937-114040959 GGGACCTCCCCAATCTACCCAGG - Intergenic
1089335607 11:117721013-117721035 GGGGATTGCCACATCTGCCTTGG - Intronic
1089374272 11:117983434-117983456 GGGACCCGCCCTATCTGCCTAGG - Intergenic
1089745557 11:120614403-120614425 GGGGCCTGTCCCATGTGCATGGG + Intronic
1090079624 11:123603272-123603294 GCCACCACCCCCATCTGCCTTGG - Intronic
1091137999 11:133210118-133210140 GGGACGTGCCTCATTTGGCTGGG + Intronic
1091283642 11:134396285-134396307 CAGACATGGCCCATCTGCCTTGG - Intronic
1091445080 12:540419-540441 GGGAGCTGTTCCCTCTGCCTGGG + Intronic
1092013883 12:5140274-5140296 GGACCCTTCCCTATCTGCCTAGG + Intergenic
1092244581 12:6856453-6856475 GAGGCCTGGCCCCTCTGCCTCGG + Intronic
1094574860 12:31675738-31675760 GAGACCTGATCCACCTGCCTTGG + Intronic
1097245889 12:57607347-57607369 AGCACCTGCCCCATCTGTCTGGG + Exonic
1097357275 12:58615780-58615802 GTGCCCTGCAGCATCTGCCTTGG - Intronic
1097822528 12:64142621-64142643 AGGACCTGCCCCACCTCCCCAGG + Exonic
1099402359 12:82215806-82215828 GGACCCTCCCCTATCTGCCTAGG - Intergenic
1099574533 12:84362701-84362723 GGGACCGGCCCCTTCTGCCCAGG - Intergenic
1103518040 12:121520217-121520239 GGGACCTGTCTTATGTGCCTAGG + Intronic
1104598266 12:130134505-130134527 GGGTTCTGCTCCCTCTGCCTGGG + Intergenic
1104899492 12:132180988-132181010 GGGACCTGCCCCATCCCCGACGG + Intergenic
1104991225 12:132624880-132624902 GGGCTCTCCCTCATCTGCCTCGG - Intronic
1105479048 13:20756602-20756624 GGGACCCACCCCATCTGCCTAGG - Intronic
1105780691 13:23702888-23702910 GAGAGCTGCCCTCTCTGCCTTGG - Intergenic
1106234228 13:27848219-27848241 GGGAGCTGCTCCCTCTGCCATGG - Intergenic
1106571861 13:30934702-30934724 GGGAGCTGCCCCTTCTGAGTTGG + Intronic
1106610164 13:31271202-31271224 GGGCCCTTCCCTATCTGCCTAGG + Intronic
1107356284 13:39571167-39571189 GGGACCTGCCCTATCTGTCTAGG - Intronic
1107670678 13:42743552-42743574 GGGCTCTGCCACAGCTGCCTGGG + Intergenic
1109510701 13:63368244-63368266 GCGACCTGCCCTGTCTTCCTAGG + Intergenic
1111213367 13:85109361-85109383 GGGCCCATCCCTATCTGCCTAGG + Intergenic
1111254309 13:85645533-85645555 GGACCCTCCCCTATCTGCCTAGG + Intergenic
1112486744 13:99827129-99827151 AGACCCTGCCTCATCTGCCTGGG - Intronic
1112571166 13:100594884-100594906 GGGACCTGCCCTACCTGCCTAGG - Intergenic
1113021735 13:105894992-105895014 GGGCCCTGCCCCCTCAGCGTGGG - Intergenic
1114483563 14:23049525-23049547 GACCCCTGCCCCACCTGCCTCGG - Intronic
1114539920 14:23447470-23447492 GAGATCTGCCCCATCTCACTGGG + Intergenic
1114949452 14:27730416-27730438 AACACCTGCCCCAGCTGCCTAGG - Intergenic
1116114049 14:40625428-40625450 GGACCCGGCCCTATCTGCCTAGG + Intergenic
1117385953 14:55212933-55212955 GGACCCTCCCCTATCTGCCTAGG + Intergenic
1117499509 14:56338117-56338139 GTGCCCTGCCCTATCTGCATTGG + Intergenic
1118648034 14:67858764-67858786 TGGCCCTACCCTATCTGCCTAGG + Intronic
1119427551 14:74545622-74545644 GGCCACTGCCCCATCTGGCTTGG - Intronic
1121014352 14:90539309-90539331 AGCGCCTGCACCATCTGCCTTGG + Exonic
1121631188 14:95422942-95422964 GGGCCCTGCCACTTCTGACTTGG + Intronic
1122556603 14:102583988-102584010 GGGCCATGCCTCATGTGCCTGGG + Intergenic
1122913358 14:104844415-104844437 GGGCCCTGCTTCCTCTGCCTGGG + Intergenic
1124003751 15:25780173-25780195 GTGCCCTCCCCCATCGGCCTCGG - Intronic
1124096151 15:26650527-26650549 GGTACCCACCCCATCTGTCTAGG - Intronic
1124203474 15:27698104-27698126 GGGAGCTGCCCATTTTGCCTGGG - Intergenic
1124622169 15:31280018-31280040 GGGCTCTATCCCATCTGCCTGGG + Intergenic
1125574147 15:40743976-40743998 TGGGGCTGGCCCATCTGCCTGGG - Intronic
1126225716 15:46266887-46266909 GGGACCCGCACCATCTGCCTAGG - Intergenic
1128549990 15:68591755-68591777 TGGGCCTTTCCCATCTGCCTGGG + Intronic
1128984086 15:72206696-72206718 GGGGCCTGCCCCATCCCCCAGGG - Intronic
1129172218 15:73815125-73815147 AGGGCCTGCCCCCTCTTCCTGGG - Intergenic
1129454174 15:75667636-75667658 GGGGCCTGCCCCTTCCACCTGGG + Intergenic
1129607394 15:77031542-77031564 AGCACCTGCCCCCTCTGCCGGGG + Intronic
1130856155 15:87841599-87841621 GGGACCTGCCCCCTCCACCCAGG + Intergenic
1131473838 15:92719200-92719222 GGGAGCTGTCCCATATGACTGGG + Intronic
1132393108 15:101453277-101453299 TGGCCCTGCCCCATGTGCCCAGG + Intronic
1133753311 16:8742073-8742095 CGGAACAGACCCATCTGCCTTGG + Intronic
1134123426 16:11600437-11600459 GGGACCCGGCCCATCTGCCTAGG - Intronic
1135230916 16:20706906-20706928 GGGCCCTTTCTCATCTGCCTGGG - Intronic
1135926757 16:26701683-26701705 GGGATCCGCCCCATCTGTCAAGG - Intergenic
1136023251 16:27453480-27453502 GGTGACTGCTCCATCTGCCTGGG + Intergenic
1137256362 16:46778371-46778393 GGGACCTGCCTCTTCTGCCCAGG - Intronic
1138152387 16:54670601-54670623 GGGACTCACCCCATCTACCTAGG + Intergenic
1138584766 16:57962650-57962672 GAGACCTGCCCCAGCCCCCTGGG + Intronic
1138743395 16:59335891-59335913 GGGGCCTTCCCCATCTGCCAAGG + Intergenic
1139742673 16:69048943-69048965 AAGGCCGGCCCCATCTGCCTGGG - Intronic
1140926619 16:79590004-79590026 GGGACCCGCCCCCTCTGTCTGGG + Intronic
1142197149 16:88744207-88744229 GGCTCCTGCCACACCTGCCTGGG + Intronic
1142286206 16:89172501-89172523 GGACCCTGCCGCAGCTGCCTGGG + Intronic
1203093264 16_KI270728v1_random:1229920-1229942 GGGCCCTGCCCCACCTGCTCGGG - Intergenic
1142596686 17:1033161-1033183 GGGCCCCGACCCACCTGCCTTGG - Intronic
1145267175 17:21385514-21385536 GGGACCTGGCCGCTCTGACTGGG - Intronic
1145982804 17:29023954-29023976 GGCCCCTGCCCCACCTGCCTGGG - Intronic
1146000627 17:29128268-29128290 GGGACTTGACTCCTCTGCCTGGG + Intronic
1146684953 17:34835304-34835326 GGAACGTGCCCCATCTGGCTGGG - Intergenic
1147311746 17:39599648-39599670 GGGACCTGACCTAGCAGCCTTGG + Intergenic
1147537111 17:41328172-41328194 GGGTCAGGCCCCACCTGCCTGGG - Intergenic
1149218598 17:54388816-54388838 GGGACCTGCCCCATCTGTCTAGG - Intergenic
1149218855 17:54390751-54390773 GGGACCCGCCCCATCTGCCTAGG + Intergenic
1150631737 17:66884923-66884945 GGGGCCTGCCTCATCTCCCTTGG - Intronic
1151727762 17:75894493-75894515 CCGACCTTCCCCATCTCCCTGGG + Intronic
1151728299 17:75896888-75896910 CTGACCTGCGCCATCTGCCTGGG - Exonic
1151729923 17:75905023-75905045 GGCCCCTGCACCGTCTGCCTCGG + Exonic
1151892038 17:76956658-76956680 TGCAGCTGCCCCAGCTGCCTTGG + Intergenic
1152379413 17:79934671-79934693 GGGACCTGCCCAGCCAGCCTTGG + Exonic
1152475004 17:80512279-80512301 GGGACCTGGACCACCTGCCATGG + Intergenic
1153307863 18:3649313-3649335 GGGACCTGTGGCATCTGCCAGGG - Intronic
1153576963 18:6532124-6532146 GGACCCTTCCCTATCTGCCTAGG - Intronic
1153704235 18:7728715-7728737 GGACCCTTCCCTATCTGCCTAGG + Intronic
1153723959 18:7936644-7936666 GGGAACTCCCCCATCTGCCCTGG - Intronic
1153821702 18:8837632-8837654 GGGACCTGCCCCATCTGCCTAGG + Intergenic
1153979772 18:10298706-10298728 GGGCCCTGCCTCATCTGCACAGG + Intergenic
1156816389 18:41316696-41316718 GGAACCTCCCCTATCTGCCTAGG - Intergenic
1158639281 18:59189439-59189461 GGACCCTTCCCTATCTGCCTAGG + Intergenic
1159507367 18:69354632-69354654 TGGACCTGCCCCAGATGCCCTGG + Intergenic
1159940313 18:74401992-74402014 TGGACCTGCCATATCAGCCTTGG - Intergenic
1160283601 18:77518005-77518027 GGGACCTTCCACCTGTGCCTCGG - Intergenic
1160757496 19:765278-765300 GGGGCCTCCTCCATCAGCCTGGG - Intergenic
1160848971 19:1180606-1180628 AGGAGGTGCCCCCTCTGCCTGGG - Intronic
1162222574 19:9190287-9190309 GGGACCCACCCCATCTGCCTGGG + Intergenic
1162392230 19:10396459-10396481 GGGCCCTACACAATCTGCCTCGG + Intronic
1162479487 19:10920330-10920352 AGCACCTGCCCCCTCTGCCAGGG - Intronic
1163086030 19:14980018-14980040 GGGACCCGCTCCAGCAGCCTCGG + Intronic
1164035305 19:21449147-21449169 GGGAACTGCCCCATGTGCCAAGG - Intronic
1164082864 19:21875710-21875732 GTGACCTTCCTCTTCTGCCTGGG + Intergenic
1164190846 19:22915829-22915851 GTGACCTTCCTCTTCTGCCTGGG + Intergenic
1165000572 19:32758544-32758566 GGGACCCACCCCATCTCGCTAGG + Intronic
1166069163 19:40377403-40377425 TGGCCCTGACCCCTCTGCCTGGG - Intronic
1166120122 19:40681283-40681305 TGGCCCTGACCCCTCTGCCTGGG - Intronic
1166793036 19:45409095-45409117 GGGAGCTGCCAGAGCTGCCTGGG - Exonic
1167597371 19:50434880-50434902 AGGCCCTGCCCCATCCGCCCAGG - Intronic
1167612182 19:50512877-50512899 GAGCCCTGCCCCTTCTGTCTTGG - Intronic
1167747062 19:51358106-51358128 GGGAGCTGCCCCATTTGGCCTGG + Intronic
1168304059 19:55424834-55424856 GGGCCCTGGCTGATCTGCCTGGG + Intergenic
1168344910 19:55645503-55645525 GGAATCTGCGCCATCTTCCTGGG + Exonic
925048169 2:790117-790139 GGGACCTGTCCCCTCTGCTCAGG - Intergenic
925119145 2:1403871-1403893 GGTGGCTGCCCCATCAGCCTGGG + Intronic
925156863 2:1655599-1655621 GGGACCTGCCCCTCCTTACTGGG + Intronic
925376611 2:3390164-3390186 GGGACCGCCCCTGTCTGCCTAGG + Intronic
925595896 2:5555399-5555421 GGGAGCTGCCCCCACAGCCTGGG + Intergenic
925683156 2:6444420-6444442 GGGACCCATCCCATCTGCCTAGG + Intergenic
926225768 2:10965935-10965957 GGGACCTTCTCCATTTGACTGGG - Intergenic
926889929 2:17630222-17630244 TGGACCCACCTCATCTGCCTAGG + Intronic
927200570 2:20575689-20575711 CGGGCCTGGCCCATGTGCCTGGG + Intronic
927514132 2:23662102-23662124 TGGAGCTGCCCCATCCTCCTGGG - Intronic
927602534 2:24456757-24456779 GTGTCCTTCCCCAGCTGCCTGGG - Intergenic
929652207 2:43691601-43691623 GGGACCTGCCCCATCTGCCTAGG + Intronic
931102309 2:59015756-59015778 GGGACCTGCCCTATCTGCCTAGG + Intergenic
931549438 2:63425969-63425991 GTGACCTGACCCTTCTGTCTAGG - Intronic
932002581 2:67898188-67898210 GGTAGCTACCCCATCAGCCTGGG + Intergenic
933195817 2:79388255-79388277 GTGACCTACTCCATCAGCCTCGG - Intronic
934928271 2:98397197-98397219 GGGAACTTCCCCATCAGCCAGGG - Exonic
936089053 2:109489240-109489262 GGGACCATCCCCATCACCCTTGG - Intronic
936427601 2:112434317-112434339 GGGACCAGCCCCAGCTGTCAGGG + Intronic
936992014 2:118376654-118376676 GGCTCCTGCTCCACCTGCCTGGG + Intergenic
937331453 2:121032797-121032819 AGGACCCTCCCCATCTTCCTGGG - Intergenic
939262601 2:139829602-139829624 GGGACTTGCCCCATCTGCCTAGG + Intergenic
940173181 2:150850350-150850372 GGACCCACCCCCATCTGCCTAGG + Intergenic
941928473 2:170918168-170918190 GGGGGCTCCCCCGTCTGCCTAGG + Intergenic
941978412 2:171430702-171430724 GGACCCACCCCCATCTGCCTAGG - Intronic
943583465 2:189711717-189711739 GGTACCTGCTTCATCTCCCTGGG + Intronic
943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG + Intergenic
944843691 2:203647199-203647221 GGGGCCCGCCCCATCTGCCTAGG + Intergenic
945233974 2:207617470-207617492 CTGGCCTGTCCCATCTGCCTTGG - Intronic
945567088 2:211414104-211414126 GGACCCTTCCCTATCTGCCTAGG + Intronic
945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG + Intronic
946325742 2:218984009-218984031 GGGATCCTCTCCATCTGCCTTGG + Intronic
946347035 2:219118962-219118984 GGGACTTGAACCATCTGCTTTGG + Intronic
946414311 2:219531943-219531965 GGGGCCTGGGCCCTCTGCCTGGG + Intronic
948432716 2:237930233-237930255 GGGTTCTGCCCCATCTGCCTAGG - Intergenic
948868769 2:240788000-240788022 TGGTCCCGCCCCATCTGCCAGGG + Intronic
1169118217 20:3081008-3081030 GGGCCATCCCCCATCTGGCTGGG - Intergenic
1170076928 20:12429749-12429771 GGGGCTCACCCCATCTGCCTAGG - Intergenic
1170244514 20:14205676-14205698 GGACCCTGCCCTATCTGCCTAGG + Intronic
1170444968 20:16416992-16417014 GGGATCTGCCCCACCTTCTTGGG - Intronic
1171328804 20:24319068-24319090 TGGACCTGCCTCATCTGCCCAGG - Intergenic
1172182246 20:33010663-33010685 GGGAGATGCCCCTTCTGCTTGGG + Intronic
1172363559 20:34331990-34332012 GGGACCTGCCCCGTCTGCCTAGG - Intergenic
1172578883 20:36031073-36031095 GGCAGCTGCCCCATCTGGATGGG - Intergenic
1173437210 20:43044072-43044094 GGGTCCTGCTCCATCTGCCTTGG - Intronic
1174169155 20:48605468-48605490 GGGACCTGTGACAGCTGCCTAGG - Intergenic
1174280423 20:49435065-49435087 GGGACAGGCCTCATCTGCCATGG - Intronic
1174386075 20:50189391-50189413 GGGAGCTGCCCCAATGGCCTAGG + Intergenic
1174558950 20:51416358-51416380 AGGACCTGCCGGCTCTGCCTGGG + Intronic
1174891281 20:54397947-54397969 GATACCCGCCCCATCTGCCTAGG - Intergenic
1176374630 21:6080890-6080912 GGGACCAGCCCCAGCTGTCAGGG - Intergenic
1176997879 21:15578143-15578165 TGGAATTGCCTCATCTGCCTTGG + Intergenic
1177775285 21:25560513-25560535 GGGACGTGCCCCACCTGGGTGGG + Intergenic
1177900876 21:26913755-26913777 GGGACCTGCCCCATCAGCCTAGG - Intergenic
1178996471 21:37405225-37405247 GGGACCCACAGCATCTGCCTGGG - Intronic
1179400026 21:41075393-41075415 GGGACCCACCCTTTCTGCCTAGG - Intergenic
1179748845 21:43457355-43457377 GGGACCAGCCCCAGCTGTCAGGG + Intergenic
1183079381 22:35446896-35446918 GTGTCCTGCCCCAACTGCCCAGG + Intergenic
1183210854 22:36450188-36450210 GGGACCTGCCCCATCCCCTCAGG + Intergenic
1183283111 22:36943515-36943537 AGGACCTGCCCCATCTGCATAGG + Intergenic
1183506585 22:38212645-38212667 GATGGCTGCCCCATCTGCCTAGG + Intronic
1184851759 22:47125091-47125113 GGGCGCTGCCCCATGGGCCTGGG - Intronic
1184889251 22:47369395-47369417 GGCTTCTGCCCCATCTGCCATGG + Intergenic
1184940645 22:47762230-47762252 TGGTTCTGCCCCACCTGCCTTGG - Intergenic
950158586 3:10742438-10742460 GGAACCTACACCAACTGCCTGGG + Intergenic
950515402 3:13461716-13461738 GGGACCTTCCTCCTCTGCCAAGG - Intergenic
950554968 3:13689877-13689899 GGGACTTGCCATTTCTGCCTGGG + Intergenic
951822086 3:26825067-26825089 GGCCCCTCCCCTATCTGCCTAGG - Intergenic
952016105 3:28959071-28959093 GGGAACCGCCCCTTCTGCCCAGG - Intergenic
952080121 3:29747921-29747943 GGACCCTTCCCTATCTGCCTAGG + Intronic
952596848 3:35028363-35028385 GGAATCTTCCCCATTTGCCTGGG + Intergenic
953466558 3:43126752-43126774 GGGAACTGACTCATCTGCCTTGG + Intergenic
954388975 3:50259135-50259157 GGGCCCTGCCCCAGCGGCCCTGG + Exonic
954644492 3:52122622-52122644 GGGACCTACCCCACCTCCCTGGG + Intronic
954692283 3:52401996-52402018 AGGACCTGGCCCTTCTGCCTGGG - Exonic
954737892 3:52721893-52721915 GGAACCTGCCCCATCTGCCTAGG - Intronic
954792693 3:53144756-53144778 GAGCCCTGCCCCATCTGTCCAGG + Intergenic
954849509 3:53588475-53588497 GGGAGATGCTCCTTCTGCCTGGG + Intronic
958592438 3:96175184-96175206 GGACCCTCCCCTATCTGCCTAGG - Intergenic
959468726 3:106721877-106721899 GGCACCTGTCCCATCTGCCTAGG + Intergenic
961324695 3:126103267-126103289 GGGCCCGGCCCCATCTGCTGAGG + Intergenic
962687766 3:137863636-137863658 GGGAACTGCCCCATCTCACAAGG + Intergenic
962763855 3:138543163-138543185 AGGACCTGCCCCTTCTGCCTAGG + Intronic
965087190 3:164113940-164113962 GGGACCTGCCCCTTCACCCAGGG - Intergenic
966838571 3:184069016-184069038 GGGACCATCCCTGTCTGCCTAGG - Intergenic
968484086 4:850381-850403 GGGACCATCCCCTTCTCCCTCGG - Intronic
968524138 4:1047335-1047357 AGGACCTGCCCCTGCAGCCTGGG - Intergenic
968564821 4:1306048-1306070 GGGCCCTGCCCAATCTGCTGAGG - Intronic
968829200 4:2923484-2923506 GGTACCTGGCTCATCTCCCTGGG - Intronic
968829561 4:2925926-2925948 GCGGGCTGCCCCATCTGCCATGG + Intronic
968900164 4:3427162-3427184 TGTGCCTGCCCCACCTGCCTGGG - Intronic
969340063 4:6535026-6535048 GGGGCCTCACCCATCGGCCTGGG + Intronic
969450795 4:7271877-7271899 GGGACCTGCCTCTGCAGCCTGGG - Intronic
970483475 4:16501216-16501238 GGGGCTTGCACCATCTGCCCTGG + Intergenic
970714655 4:18907664-18907686 GGGACCTCCCCCCTCAGCCAAGG + Intergenic
974203345 4:58669025-58669047 GGACCCTCCCCTATCTGCCTAGG - Intergenic
978054557 4:104247848-104247870 GTGACCTGCCCCTTCTCTCTAGG + Intergenic
978216250 4:106208183-106208205 GGGACTTGCCCCATCTGCCTAGG - Intronic
979899910 4:126202594-126202616 GGGACCTGCCCCATCTGCCCAGG + Intergenic
984486947 4:180382635-180382657 TGGGCCTGGCCCATCTCCCTTGG + Intergenic
984501621 4:180565740-180565762 AGGATCTGCCCCTTCTCCCTCGG + Intergenic
985101268 4:186460719-186460741 GGGACCTGCCCCTATTGGCTAGG + Intronic
985634809 5:1030817-1030839 GGGAGCTGCCCACCCTGCCTTGG + Intronic
985718130 5:1474323-1474345 GTGTCCTGCCACATCTGCCCTGG - Intronic
987147855 5:15010229-15010251 GAGACCTGCCCCAGGTGCCATGG + Intergenic
987652959 5:20767927-20767949 GGAACCGCCCCTATCTGCCTAGG + Intergenic
988093231 5:26569223-26569245 GGGGCCTGCCCCATTCACCTAGG + Intergenic
988681661 5:33489642-33489664 GGTCCCACCCCCATCTGCCTCGG + Intergenic
988742606 5:34093557-34093579 GGAACCGCCCCTATCTGCCTAGG - Intronic
988782779 5:34538468-34538490 GGGCCCACCCCTATCTGCCTAGG + Intergenic
990177019 5:53119145-53119167 GGGACCCACCCCAACTGCCTAGG + Intergenic
992251081 5:74876518-74876540 AGGACCTGCTCCGTCTGTCTTGG - Intergenic
993761564 5:91802414-91802436 GGACCCTCCCCCATCTGCCTAGG - Intergenic
993938016 5:94026794-94026816 TGGACCCGCCCCATCTGCCTAGG + Intronic
994273605 5:97809682-97809704 GGGACCCACCCCATCTGCTTAGG + Intergenic
994937334 5:106271951-106271973 GGGGCCTGCCCCAACTCACTGGG - Intergenic
995898854 5:117046243-117046265 GGGCACTGCCCCATCTGCCAGGG - Intergenic
999120682 5:149207146-149207168 TGCTCCTGCCCCAGCTGCCTGGG + Intronic
1000636067 5:163645096-163645118 GGGACCTGCCCCATCTGCCTAGG - Intergenic
1001579920 5:172791524-172791546 GGGTCCTACCCCCACTGCCTTGG + Intergenic
1002200525 5:177525261-177525283 GATACCTGACCCATCAGCCTGGG + Intronic
1002306610 5:178287276-178287298 GGGAGCTGCCCGGACTGCCTGGG + Intronic
1002603383 5:180368091-180368113 GGTGCCTCCCCCATCTGCCCAGG + Intergenic
1006082486 6:31575414-31575436 GGGCCCTGCACCTTCTGTCTCGG - Intergenic
1006637993 6:35474185-35474207 GGGGGGTGCCCCATCTTCCTGGG + Exonic
1008716283 6:54294009-54294031 GTGACCTGCCCCTTCTACCTGGG + Intergenic
1008895681 6:56552014-56552036 TGTAACTGCCCCACCTGCCTGGG + Intronic
1009355812 6:62742051-62742073 GTGACCTGCCCCTTCTCTCTAGG - Intergenic
1013778458 6:113704373-113704395 GCGACAGGCCCCATCTGCCCAGG - Intergenic
1016199978 6:141395009-141395031 GGGACCTGCCCCTTCTGCCCAGG - Intergenic
1016680269 6:146820914-146820936 GGGCCCGCCCCTATCTGCCTAGG + Intergenic
1017451955 6:154562644-154562666 GGGAAATGCCAGATCTGCCTTGG + Intergenic
1018529550 6:164748153-164748175 GGCACCTGCCCTATCTGCCTAGG + Intergenic
1019076258 6:169390358-169390380 GGGACCCACCCCATCTGCCTGGG + Intergenic
1019076914 6:169395185-169395207 GGGACCTGCCCCACCTGCGTGGG + Intergenic
1019525638 7:1479275-1479297 GGGACCTGCCGCCACTCCCTGGG + Intronic
1019600993 7:1883708-1883730 TGGACCTGCACCCTCTGCCTCGG - Intronic
1019970414 7:4536173-4536195 GTCACCTGCCCTATCTTCCTTGG + Intergenic
1021015341 7:15525219-15525241 GGGCCCACCCCTATCTGCCTAGG - Intronic
1021103604 7:16611895-16611917 GGAAAGTGCCCCATGTGCCTGGG - Intronic
1021115792 7:16745062-16745084 GGACCCTCCCCTATCTGCCTAGG + Intergenic
1021386433 7:20036156-20036178 GGTACCTGTCCCATCTGCCTAGG + Intergenic
1022438610 7:30413650-30413672 GGGACCTGTCCCATTTACCTAGG - Intergenic
1022804158 7:33805147-33805169 GGCCCCTGCTCCATCAGCCTAGG + Intergenic
1022980718 7:35602393-35602415 GGGACCCGCCCCATCGGCCTAGG + Intergenic
1023677198 7:42643016-42643038 GGACCCAGCCCCATCTGTCTAGG - Intergenic
1023773118 7:43577737-43577759 GGACCCTTCCCTATCTGCCTAGG + Intergenic
1023839547 7:44088633-44088655 GGGGCCTGCCCCTGCTGCCCTGG + Intergenic
1023976237 7:45032319-45032341 GGAACCTGCCCCTTCTACCTGGG - Intronic
1024743687 7:52383091-52383113 GGGACCCTCCCCATCTGCCTAGG + Intergenic
1025829648 7:65038274-65038296 GGGACCCGACCCAGCTGCCGCGG - Intergenic
1028128997 7:87147892-87147914 GGGACCTGTCCCATCCACCAAGG + Intergenic
1028496049 7:91462742-91462764 GAAACCCGCCTCATCTGCCTAGG - Intergenic
1029107957 7:98193828-98193850 GGGAACCTCCCCATCCGCCTTGG + Exonic
1030114375 7:106051908-106051930 GGGCCCTCCCCTATCTGCCTAGG + Intergenic
1030593503 7:111508890-111508912 GGGACCCACCCTATCTGCCTAGG + Intronic
1031173994 7:118325611-118325633 GGGACCTGCCCCATCTGCCTAGG + Intergenic
1031667626 7:124504149-124504171 GGGACCCGCCCCATCTGCCTAGG + Intergenic
1034537020 7:151731722-151731744 GGGACCTGTGCCAACAGCCTAGG + Intronic
1034717317 7:153255666-153255688 GGCACCTGCCCCATCTGCCTAGG - Intergenic
1035102982 7:156416534-156416556 AGGGACTGCCCCTTCTGCCTGGG + Intergenic
1035449218 7:158964901-158964923 GGGACCTGCCCAAGCTACATGGG + Intergenic
1035852902 8:2939133-2939155 GGGACCTTCCCGATTTCCCTGGG - Intronic
1035862450 8:3044645-3044667 GGGACCTCAAACATCTGCCTCGG + Intronic
1037301968 8:17461281-17461303 GGGACCTACGCCATCTACCTAGG + Intergenic
1038520302 8:28226655-28226677 GGGACCCGCCCCATCTGCCTAGG - Intergenic
1039701157 8:39963049-39963071 GGACCCTTCCCTATCTGCCTAGG + Intronic
1039983508 8:42428707-42428729 TGGACCTGTCCCAGCGGCCTGGG + Intronic
1040768910 8:50949861-50949883 GGGACCTGCCACATCTGAGAAGG - Intergenic
1040994186 8:53384872-53384894 GGGCTCTTCCCTATCTGCCTAGG + Intergenic
1041351562 8:56952484-56952506 GGACCCTTCCCTATCTGCCTAGG - Intergenic
1043687501 8:83106508-83106530 GGTACCCACCCCATCTGCATAGG - Intergenic
1044149210 8:88752628-88752650 GGGACCCGCCCCTTCTGCCTAGG + Intergenic
1047201435 8:122770975-122770997 GGAACCTGAACCATCTCCCTGGG - Intergenic
1047537717 8:125734699-125734721 GGAACCCACCCCATCTGCCTAGG - Intergenic
1048485882 8:134847343-134847365 GGGACCTGCCCTATTTTCCTAGG - Intergenic
1049465774 8:142750673-142750695 GGGAACTGCCCCATCAGGCCGGG - Intronic
1049574838 8:143385225-143385247 GGGTCCTGTCCCATCTGCCCAGG + Intergenic
1050718732 9:8560987-8561009 GGATCCTGCCCCATCTGACTAGG - Intronic
1053476354 9:38384754-38384776 GGGACCACTCCTATCTGCCTAGG - Intergenic
1056084112 9:83128250-83128272 GGGATCTGCCCCATCTGCCTAGG - Intergenic
1056475080 9:86945838-86945860 GGGACCTGCCCTATGGGCCTGGG - Exonic
1056850138 9:90076719-90076741 GGGACTTGGCACATCTGCCCTGG - Intergenic
1060516289 9:124267797-124267819 GGTCCCTGCCCCGTCTTCCTGGG + Intronic
1060618767 9:125044092-125044114 GGGACCTGTCACAACTGACTGGG + Intronic
1060784798 9:126442663-126442685 GGGACCTGCTCTTTCAGCCTGGG - Intronic
1061627710 9:131851222-131851244 GGGACCCGCTCCATCTTCCGTGG - Intergenic
1061907392 9:133705624-133705646 AGCACCTGCCCCATCTGCCCTGG + Intronic
1062085012 9:134643848-134643870 GTGCCCTGCCCCAGCTGTCTAGG - Intronic
1062700582 9:137899808-137899830 GGCACCTGACCCACCTGCCCCGG + Intronic
1186068161 X:5788836-5788858 GGAACCTGCACCTTCTCCCTGGG - Intergenic
1190094383 X:47467117-47467139 GGGAGCTGCCCCCACTCCCTAGG + Intronic
1190298468 X:49042445-49042467 GGGATCTGCCCCAGCTGGGTAGG + Intronic
1190705544 X:53023880-53023902 GGGACCCGCCCCATCTGCCTAGG - Intergenic
1191754219 X:64576889-64576911 GGGGACTCACCCATCTGCCTAGG - Intergenic
1192583031 X:72300424-72300446 GGAAACAGCTCCATCTGCCTGGG - Intronic
1195323766 X:103741706-103741728 GCGACCTCACCCAGCTGCCTTGG + Intergenic
1197526869 X:127575174-127575196 GGGACCTGCCCCTCCCACCTCGG - Intergenic
1198408867 X:136345598-136345620 GGGACCTGACTCAGGTGCCTTGG - Exonic
1199649224 X:149937659-149937681 GGGACCCTCCACATCTGTCTGGG + Intronic
1199716661 X:150511783-150511805 GGAAGCTGCCCCAACTCCCTAGG - Intronic
1201221354 Y:11773814-11773836 GGACCCTCCCCTATCTGCCTAGG + Intergenic
1201552833 Y:15236921-15236943 GAGACCTGCCCCATCAACGTGGG + Intergenic