ID: 929654240

View in Genome Browser
Species Human (GRCh38)
Location 2:43714775-43714797
Sequence TATGAGGCTCTCTGAGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929654240_929654244 -6 Left 929654240 2:43714775-43714797 CCCATTCCTCAGAGAGCCTCATA 0: 1
1: 0
2: 1
3: 18
4: 158
Right 929654244 2:43714792-43714814 CTCATAATCTATTAAAAAAGAGG 0: 1
1: 0
2: 2
3: 47
4: 407
929654240_929654245 -5 Left 929654240 2:43714775-43714797 CCCATTCCTCAGAGAGCCTCATA 0: 1
1: 0
2: 1
3: 18
4: 158
Right 929654245 2:43714793-43714815 TCATAATCTATTAAAAAAGAGGG 0: 1
1: 0
2: 4
3: 42
4: 618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929654240 Original CRISPR TATGAGGCTCTCTGAGGAAT GGG (reversed) Intronic
901254247 1:7807607-7807629 GATGAGGTACTCTGAGGAACTGG - Intronic
901306566 1:8237094-8237116 TAGGGGGGTCTCTGGGGAATGGG + Intergenic
901617516 1:10553532-10553554 TTTGAGACTCTCTGAAGAAAGGG + Intronic
902545502 1:17187003-17187025 CATGAGGCTTTCAGAGGAATGGG - Intergenic
905210282 1:36369429-36369451 GCTTAGGCTCACTGAGGAATTGG - Intronic
905339191 1:37266648-37266670 TCTGAGTCTCTCTGAAGGATGGG - Intergenic
910036516 1:82795692-82795714 TATGAGTCACCCTGAGGAAGAGG - Intergenic
910155306 1:84211010-84211032 TATGAGAATCTCTGGGGAAGAGG + Intronic
914986389 1:152460758-152460780 TCTTAGGGTCTCTGAGGACTGGG - Intergenic
917252666 1:173078958-173078980 TCTGAGGCTCCATGAGCAATGGG + Intergenic
922977628 1:229798532-229798554 TATGAGGCACTCTCAAGATTTGG - Intergenic
923867776 1:237958711-237958733 TCTGAGGCTCTCAGAGACATTGG + Intergenic
1063171549 10:3514267-3514289 TATGAGGCTCTTTCAGGGAGAGG + Intergenic
1065009144 10:21405982-21406004 GATGTGGCTCTCAGTGGAATGGG - Intergenic
1065797292 10:29319199-29319221 GATGAGAGTCTTTGAGGAATTGG + Intergenic
1065945869 10:30605163-30605185 GATGAGAGTCTTTGAGGAATTGG - Intergenic
1067071452 10:43135623-43135645 TATGGGGCTCATGGAGGAATAGG + Intergenic
1067169861 10:43897797-43897819 TGTGGGGCTCTTTGAGCAATGGG - Intergenic
1069273433 10:66559752-66559774 GAAGAGGATCACTGAGGAATTGG - Intronic
1070052188 10:72900149-72900171 TATGAGGCTCTCTCAAGAAGAGG + Intronic
1071615580 10:87072431-87072453 TCTGACACTCTCTGTGGAATGGG + Intronic
1074333984 10:112549948-112549970 TGTGAGGTCCTCTGAGGTATTGG + Intronic
1077440566 11:2566905-2566927 GATGGGGCTCTCAGAGGGATTGG + Intronic
1078887818 11:15522907-15522929 TAGGAGGCTCTCTGAGAAAGGGG - Intergenic
1079737630 11:24016488-24016510 AAGGAGGCTCTCTGAATAATTGG + Intergenic
1082912596 11:58393684-58393706 CATGGAGCTCTCTGGGGAATAGG + Intergenic
1084615060 11:70230298-70230320 TTTGAGGTTCTCTGTGGCATCGG - Intergenic
1090119270 11:124007662-124007684 TATGAGGCTATCTTAGGGATTGG + Intergenic
1090207726 11:124895215-124895237 TATGAGGGGCTCTGAGGGAGAGG + Intronic
1090407685 11:126486965-126486987 TATGAGGCTCGTTGAGGAGGTGG - Intronic
1092840755 12:12539035-12539057 AATCAGAATCTCTGAGGAATGGG + Intronic
1094350160 12:29515450-29515472 GAGGGGCCTCTCTGAGGAATGGG - Intronic
1094775683 12:33724522-33724544 TATGAGGCTCTGTAGGGACTCGG - Intergenic
1094798146 12:34000421-34000443 AATGGGGATCTCTGAGGAATTGG - Intergenic
1095033971 12:37333517-37333539 TTTGAAGCCCTTTGAGGAATTGG - Intergenic
1095034450 12:37342619-37342641 TTTGAAGCCCTTTGAGGAATTGG - Intergenic
1095034823 12:37349393-37349415 TTTGTAGCTCTTTGAGGAATTGG - Intergenic
1095110912 12:38294509-38294531 AATGGGGATCTCTGAGGAATTGG - Intergenic
1097383867 12:58926018-58926040 TCTGAGGTTCTCAAAGGAATGGG - Intergenic
1101469602 12:104984234-104984256 GATGTGGCTCTCAGTGGAATGGG + Intergenic
1101767541 12:107716166-107716188 TATGAGGTTTTCAGAGGAAAAGG + Intergenic
1102312227 12:111854653-111854675 TATGTGGTTCTCAGTGGAATGGG + Intronic
1102953716 12:117046362-117046384 TATGCAGCTCTCTGGGGACTTGG + Intronic
1105801904 13:23912614-23912636 TGTGAGGCTTTGTGAGCAATAGG + Intergenic
1107171778 13:37350850-37350872 TATGTTGCTCCCTGAGGAACTGG - Intergenic
1107534017 13:41311009-41311031 TATGAGGCGTTCTGATGCATAGG + Intergenic
1108772460 13:53720978-53721000 GGTGAGGCTCTCTGATGATTTGG - Intergenic
1109595511 13:64548728-64548750 TAAGAGGCTCTCAGAGGAGAAGG - Intergenic
1111170509 13:84520970-84520992 TATGAGGCTTTCAGAGGAGTAGG - Intergenic
1114000682 14:18239942-18239964 TATGAGGCTTTCTTTGGAAACGG - Intergenic
1115062878 14:29215161-29215183 TGTGAGGCTCTTTCAAGAATGGG - Intergenic
1118057328 14:62093476-62093498 TATGAGGCAGTGTGAGGAAGAGG - Intronic
1119989795 14:79183445-79183467 TATGGGGTTCTCAGAGGACTTGG - Intronic
1120316104 14:82895440-82895462 TGTGAGGCTCTTAGAGGAACAGG + Intergenic
1122141457 14:99665378-99665400 TATGGGGCTGTCTCTGGAATGGG + Intronic
1125278241 15:38016380-38016402 TATCAGGCTCTGTGGGCAATGGG + Intergenic
1125415237 15:39445282-39445304 CCTGGGGCTCTCTGAGGGATGGG + Intergenic
1126742913 15:51796274-51796296 TATAAGCCTCTCTGAGGACAAGG + Intronic
1129077182 15:73007317-73007339 TATGTGGCTCTCTGAGTCCTCGG + Intergenic
1129891186 15:79073061-79073083 CATGAGGCTCTCTGTTGCATTGG - Intronic
1133672570 16:8038366-8038388 GATGAGGCTCTCTGATGGAATGG + Intergenic
1134744009 16:16573369-16573391 TATGGAGCCCTCTGAGGATTCGG - Intergenic
1135001471 16:18780383-18780405 TATGGAGCCCTCTGAGGATTCGG + Intergenic
1135967294 16:27046729-27046751 TTTGAAGGTCACTGAGGAATTGG - Intergenic
1136451038 16:30354472-30354494 TTTCAGGTTCTCTGAGGAATGGG - Intronic
1137097375 16:36326735-36326757 TTTGAGGCTCACGGTGGAATTGG + Intergenic
1137940631 16:52680327-52680349 GATGAGCCTCTGTGAGGAATGGG - Intergenic
1139579227 16:67862412-67862434 GAGTAAGCTCTCTGAGGAATAGG - Intronic
1140175644 16:72656912-72656934 CATGAGCCACTCTGAGGAATGGG + Intergenic
1140917734 16:79508891-79508913 TATGAGGCTTCCTTTGGAATGGG + Intergenic
1141626146 16:85262216-85262238 TCTGACACTCTCTGAGGAAAGGG - Intergenic
1144610964 17:16714961-16714983 CAGGAGGCTATCTGAGGAAAAGG - Intronic
1144901774 17:18600404-18600426 CAGGAGGCTATCTGAGGAAAAGG + Intergenic
1144929298 17:18845656-18845678 CAGGAGGCTATCTGAGGAAAAGG - Intronic
1145130729 17:20345668-20345690 CAGGAGGCTATCTGAGGAAAAGG - Intergenic
1147350872 17:39842203-39842225 AATGAGGCTCCCTGAAGAAATGG + Intronic
1151010961 17:70495276-70495298 CATGAGGTTCTCTGAGGAACAGG + Intergenic
1151225158 17:72642303-72642325 AAGGAGGCTCTTTGAGGACTGGG - Intergenic
1151479569 17:74362138-74362160 TTTCAGGCTCTCTGCAGAATAGG + Intergenic
1153753470 18:8257244-8257266 AATGGGGTTCTCTGAGGAAATGG + Intronic
1155100041 18:22601835-22601857 TATCAGAATCTCTGAGGAAGGGG - Intergenic
1155822203 18:30391543-30391565 TTTGAGGCTCTCAAGGGAATAGG + Intergenic
1156717998 18:40035614-40035636 TCCCAAGCTCTCTGAGGAATAGG + Intergenic
1167324622 19:48816451-48816473 CATGTGGCTCTCTTAGGAAAAGG - Intronic
929065770 2:37973697-37973719 TATGTGGCTGTCTAAGGAAACGG + Intronic
929654240 2:43714775-43714797 TATGAGGCTCTCTGAGGAATGGG - Intronic
932117533 2:69066953-69066975 TAAGAACCTCTCTGAGGACTTGG - Intronic
934792375 2:97072373-97072395 TATGAGGCTCTCTAAGTCAAGGG - Intergenic
934814244 2:97311336-97311358 TATGAGGCTCTCTAAGTCAAGGG + Intergenic
934823450 2:97397147-97397169 TATGAGGCTCTCTAAGTCAAGGG - Intergenic
935880435 2:107559516-107559538 TGTGAGTCCCCCTGAGGAATGGG - Intergenic
935936028 2:108183773-108183795 TGTGAGGCACTGTGAGGAACTGG - Intergenic
938243659 2:129761558-129761580 TCTGAGGACCTCTGAGGGATAGG + Intergenic
938931783 2:136092937-136092959 TATGAGGTTTTTTGAGAAATGGG - Intergenic
939147349 2:138431831-138431853 TGTGAGGCTCTCCTAGGAAGTGG - Intergenic
939302207 2:140358762-140358784 TATGAGGTTCTCTGATGACTTGG - Intronic
939807907 2:146796199-146796221 TATTAGGCAGTCTTAGGAATGGG - Intergenic
939833999 2:147106052-147106074 TTTGAGTCTCTGTGAGGATTAGG - Intergenic
941365844 2:164610243-164610265 TATGAGTCTCTCAGAGCAAGAGG - Intronic
944024140 2:195143371-195143393 GATGTGGCTCTCAGTGGAATGGG + Intergenic
945990874 2:216394312-216394334 TTTGGGGGTCTCTGAGGACTGGG + Intergenic
948191869 2:236065505-236065527 CATCAGGCTCTCTCTGGAATAGG + Intronic
948696127 2:239733768-239733790 CATGAGTCTCTGTGAGGATTGGG - Intergenic
948707597 2:239804740-239804762 TCTGAGGCTCTCTGAGTGAGGGG + Intergenic
948924804 2:241088632-241088654 AATGAGGCTCTCTGTGGATAGGG + Exonic
1169440646 20:5631220-5631242 AATGAGTCTCTCTGAGCATTTGG + Intergenic
1171576723 20:26334282-26334304 TATGAGGCTTTCTTTGGAAAAGG + Intergenic
1174202179 20:48814407-48814429 TAGAAGGCTCTCTGAGGAAGCGG + Intronic
1174711260 20:52707700-52707722 ACTGAGGTTCTCTGAGGAACAGG - Intergenic
1180425195 22:15170741-15170763 TATGAGGCTTTCTTTGGAAACGG - Intergenic
1180651652 22:17382196-17382218 TATTAGTCTCTATGAGGAAGGGG - Intronic
950202582 3:11055559-11055581 TCTGAGGGCCTCTGAGAAATGGG - Intergenic
950488261 3:13285482-13285504 GCTGAGGCTCTTTGAGGAAGAGG - Intergenic
955355243 3:58225648-58225670 TTTCAGGCCCTCTGAGGACTGGG + Intergenic
956273985 3:67477797-67477819 TCTGCTGCTCTTTGAGGAATGGG - Intronic
957259686 3:77884891-77884913 CAAAAGTCTCTCTGAGGAATTGG + Intergenic
958010363 3:87870616-87870638 CATGGGGCTGCCTGAGGAATTGG + Intergenic
958105312 3:89065045-89065067 CATGAGCCTCTCTGAGGAGAAGG - Intergenic
958405076 3:93747321-93747343 TGTGAGGCATTCTGAGGAAATGG - Intergenic
963313813 3:143737337-143737359 TATGATGTTCTCACAGGAATTGG + Intronic
964883042 3:161445726-161445748 TATCAGGCTCCCTGTGGAAGAGG + Intergenic
964893409 3:161564115-161564137 AATGAGGCTCTGTGATGACTAGG + Intergenic
967370064 3:188734535-188734557 TTTGTTGCTCCCTGAGGAATTGG - Intronic
967980443 3:195062106-195062128 TCTGGGGCTCTCTGTGGGATCGG + Intergenic
968520699 4:1033541-1033563 TGTGAGCCTCCTTGAGGAATGGG + Intergenic
969954086 4:10870427-10870449 GAGAAGGCTTTCTGAGGAATGGG + Intergenic
971355274 4:25889742-25889764 TTTGAGGCTCTTTGAGGGTTAGG + Intronic
974080180 4:57203914-57203936 TATTAGGCTATTTGAGGATTGGG - Intergenic
976553354 4:86422006-86422028 AATGTACCTCTCTGAGGAATTGG - Intronic
984766162 4:183402124-183402146 TATGCAGCTGTCTGAGGAGTGGG - Intergenic
986180736 5:5390854-5390876 TATGAGGCGCTCTCAGGACCTGG + Intergenic
987707398 5:21473683-21473705 TATGAGGCGCTCTCAGGACCCGG - Intergenic
989513663 5:42317564-42317586 CTTGAGGATCTCTGAGGGATGGG - Intergenic
990023163 5:51153787-51153809 TAAGAGGCAATCTGACGAATAGG + Intergenic
993939615 5:94042702-94042724 TATAAGGCTTTCTTAAGAATTGG + Intronic
998395304 5:141814356-141814378 TTCCAAGCTCTCTGAGGAATTGG + Intergenic
998602338 5:143597832-143597854 TATGAGGCACTGCTAGGAATGGG - Intergenic
1000297940 5:159928529-159928551 AATGGGGCTCTAGGAGGAATGGG - Intronic
1000460900 5:161517006-161517028 TAGGAGCCTCTCTGACAAATTGG - Intronic
1000626537 5:163545685-163545707 CATGAGGAACTCTGAGGAAGAGG - Intergenic
1004625433 6:17371957-17371979 TCTGATGCTTTCTGAGGAAATGG - Intergenic
1005847617 6:29793412-29793434 GATGAAACCCTCTGAGGAATGGG + Intergenic
1005867821 6:29949384-29949406 GATGAAACCCTCTGAGGAATGGG + Intergenic
1006207876 6:32365478-32365500 GATGAGGCTTTCTGATGAGTGGG + Intronic
1006884749 6:37371834-37371856 TAAGAGGCTCTCTGGGGAAGTGG + Intronic
1007907487 6:45476970-45476992 GATGAGGCTGCATGAGGAATGGG + Intronic
1009020828 6:57946829-57946851 TATGAGGCGCTCTCAGGACCTGG + Intergenic
1009895624 6:69745814-69745836 GATGAGGCTTTCTGTAGAATGGG - Intronic
1012371429 6:98512013-98512035 TATAAGACTTTCTGATGAATTGG + Intergenic
1014045002 6:116875821-116875843 TCTGAGGCTTTCGGAGGACTGGG + Intergenic
1014926826 6:127281996-127282018 TATGATAGTCTCTGGGGAATAGG + Intronic
1015067992 6:129054183-129054205 TATGAGCCTCTCAGGGGAATAGG + Intronic
1021220093 7:17965602-17965624 TAAGGGGCTTTCTGAGGAAAAGG - Intergenic
1021651048 7:22833676-22833698 TGTAAGGCTCTGTGAGGAAAAGG + Intergenic
1021793540 7:24229865-24229887 CATGATGCTGTCTGAGCAATTGG + Intergenic
1023347571 7:39287072-39287094 TGTGAGTCTCTATGAGGAACAGG + Intronic
1023643272 7:42282944-42282966 TATGAGGCTCTCTGAGCAGCTGG + Intergenic
1026188981 7:68107233-68107255 TGTGCGGCTCTCTGAGACATGGG + Intergenic
1028220203 7:88188296-88188318 TATGTGGCTCTCAGAGAAAGAGG + Intronic
1032462829 7:132124640-132124662 AAGGAGGCTCTGTGAGGGATGGG - Exonic
1033408388 7:141092877-141092899 TATGGGGCTCTCTGAGGAAGAGG + Intronic
1034346684 7:150389576-150389598 TATGAGTCTATCTGGGGAAAGGG - Intronic
1034963995 7:155380420-155380442 GATAAGGCTCTATGAGGAATTGG - Intergenic
1037040758 8:14229226-14229248 AATGAGCATCTCTGAGGCATTGG + Intronic
1037659310 8:20913332-20913354 CATGAGGCATCCTGAGGAATGGG + Intergenic
1041417074 8:57622575-57622597 CCTGAGGCTCTGTTAGGAATGGG + Intergenic
1047809186 8:128389813-128389835 TCTGAGGCTCACTGAGTAAGTGG + Intergenic
1052387720 9:27841666-27841688 TATGAGGCTATATGATAAATAGG + Intergenic
1054703103 9:68433975-68433997 TTTGAGGGTCTCTTAGGAACTGG - Intronic
1056153416 9:83811142-83811164 CATGAGGCGCTATGAGGCATAGG + Intronic
1056299317 9:85225653-85225675 TATGAGGCCCTCTGAAGATGAGG + Intergenic
1056794217 9:89646472-89646494 TAGGAGGCTCTTTGAAAAATAGG + Intergenic
1060026185 9:120173923-120173945 ACTGAGGCTCTGTGAGGAAAAGG + Intergenic
1061409119 9:130409056-130409078 TGGGAGGATATCTGAGGAATGGG - Intronic
1189829764 X:44959527-44959549 TATGAAGCTCTCAGAGGAGTAGG + Intronic
1190253363 X:48744267-48744289 TAAAAGGCTCTCTGAAGGATAGG + Intergenic
1195179744 X:102346089-102346111 GAGGAGGCTCTCTAAGGATTTGG - Intergenic
1201080963 Y:10245373-10245395 TTTGAGGCTTACTGAGGAAAAGG - Intergenic