ID: 929657786

View in Genome Browser
Species Human (GRCh38)
Location 2:43751397-43751419
Sequence CCCCCCAGTAAGTTTACAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929657786 Original CRISPR CCCCCCAGTAAGTTTACAAG AGG Intronic
902042222 1:13501052-13501074 GCCCACAGCAAGTTTACATGAGG - Intronic
906529072 1:46512824-46512846 CCCCCTAGTAAGTCTACGTGTGG + Exonic
906716810 1:47976109-47976131 GCCCCCAGGAAGCTTACAGGTGG - Intronic
908811519 1:67986497-67986519 CCCATCAGGAAGTTTAAAAGAGG - Intergenic
913551881 1:119924332-119924354 GCCCCCAGTAAGGTAACAACGGG + Intronic
916182360 1:162097002-162097024 CCCTCCAGCAATCTTACAAGTGG - Intronic
920123689 1:203676890-203676912 CTTCCCAGAAAGTTTACAAGAGG + Intronic
924514473 1:244754572-244754594 CCTCCCAGTAAGATCACAGGTGG + Intergenic
1066294769 10:34044427-34044449 CCCAACAGGATGTTTACAAGAGG + Intergenic
1068651658 10:59528904-59528926 TCCCCCAGTCAGGTTACACGGGG - Intergenic
1072388733 10:94960047-94960069 CCTCCCAGTTAGGCTACAAGGGG + Intronic
1075907400 10:126093583-126093605 CTGCCCAGTGAGTTTACATGTGG + Intronic
1083652741 11:64212632-64212654 CCCCCAAGCAAGTGTACAGGAGG - Intronic
1091112740 11:132985315-132985337 ACCACCAGTAAGCTTAGAAGAGG - Intronic
1093451102 12:19315387-19315409 ACCCCCAGTATGTTAAAAAGTGG - Intronic
1095362195 12:41355914-41355936 CCCCACTGTGATTTTACAAGTGG + Intronic
1095641484 12:44490758-44490780 ACCCTCAGTAAGCTTCCAAGTGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1102349582 12:112182503-112182525 CCCAGGAGTCAGTTTACAAGGGG + Intronic
1111396704 13:87675403-87675425 CCCCCCAGTAACTTTGGAACAGG + Exonic
1117200955 14:53389587-53389609 CTCCCAAGTAGGATTACAAGTGG - Intergenic
1117793424 14:59365157-59365179 CACCCCAGTCAGTGTGCAAGGGG - Intronic
1119214316 14:72856843-72856865 CCCCTCAGTAACTGTGCAAGAGG + Intronic
1144248629 17:13393831-13393853 AGCCCCAGTAAGTTTTCAAGTGG + Intergenic
1147388825 17:40097119-40097141 CCCCCCTGGGAGTCTACAAGTGG - Exonic
1148112158 17:45151119-45151141 CCCCCCAGTAAGGCTGGAAGAGG + Exonic
1149133796 17:53340575-53340597 TCTCCCAGTTAGTTTACACGGGG - Intergenic
1155531977 18:26776601-26776623 CCAACCAGTAAGTTCAAAAGAGG + Intergenic
1157046186 18:44104255-44104277 CCCCCCAGTGGGATTACCAGAGG - Intergenic
1157616537 18:48990814-48990836 CCCCTCAGTGAGCTTCCAAGAGG + Intergenic
1161166038 19:2788100-2788122 ACCACCAGAAAGTTTTCAAGAGG - Intronic
1164357880 19:27463551-27463573 CCTCCCAGTTAGGCTACAAGAGG - Intergenic
1164611839 19:29637629-29637651 GCCCCCAGTCAGCTTACCAGGGG + Intergenic
1167217577 19:48175038-48175060 CCACCCAGTAAGCTTTCAGGTGG - Intronic
929445550 2:41998186-41998208 CTCCCCAGGGAGTTTCCAAGCGG - Intergenic
929657786 2:43751397-43751419 CCCCCCAGTAAGTTTACAAGAGG + Intronic
941765401 2:169291219-169291241 GCCCCCAGTAGGGTTATAAGAGG + Intronic
946108541 2:217393495-217393517 CCCCCCACTCAGTTTAAATGGGG + Intronic
1169111969 20:3039993-3040015 CCCCTCTGGAAGTTTACAGGAGG + Intergenic
951695639 3:25443188-25443210 GCCCCCATCAAGTTTACTAGAGG - Intronic
953901011 3:46844175-46844197 GCCCACATAAAGTTTACAAGAGG - Intergenic
966072392 3:175894980-175895002 ACCCCCAGTAATTTTATATGAGG + Intergenic
969886540 4:10220324-10220346 CCCCCCAGGAATTTTATGAGGGG - Intergenic
973050049 4:45585374-45585396 GCCCCCAGAAAGCTTACATGGGG + Intergenic
995749195 5:115436467-115436489 CTCCTCAGTAAGTTATCAAGAGG - Intergenic
1000782454 5:165499137-165499159 CCCATCAGTAATTTTACGAGGGG - Intergenic
1004420356 6:15464238-15464260 CCCCTCTGTGATTTTACAAGTGG + Intronic
1005333977 6:24775106-24775128 CCACCCAGTAAGTGGGCAAGAGG + Exonic
1013443612 6:110197910-110197932 GACCCCAGCAATTTTACAAGTGG - Intronic
1022790861 7:33687744-33687766 CCACCCAGTATGTTTAACAGAGG + Intergenic
1042484235 8:69333694-69333716 CTCCCCAGCACATTTACAAGGGG + Intergenic
1056098615 9:83278918-83278940 CTCCCCAGTAAGGGTACAATTGG + Intronic
1058763459 9:108159312-108159334 ATCCCCAGTGAGGTTACAAGAGG + Intergenic
1061074510 9:128332937-128332959 GCGCTCAGTAAGTTTTCAAGTGG + Exonic
1186279982 X:7981824-7981846 CTCCCAAGGAAGTTTGCAAGTGG + Intergenic
1192061377 X:67830720-67830742 TCTCCCAGTCAGTTTACACGGGG - Intergenic
1193124543 X:77857294-77857316 CCTCCCAGTAAGATTCAAAGGGG + Intronic
1195374411 X:104212937-104212959 TCTCCCAATAAATTTACAAGTGG + Intergenic
1200150578 X:153949469-153949491 GCCCCCAGTCATTTGACAAGAGG + Intronic
1200879170 Y:8194175-8194197 CCCCCCAGTTAGGCTACACGGGG - Intergenic
1201306669 Y:12556470-12556492 TCCCCCAGTATGTTTCCAGGCGG - Intergenic