ID: 929661448

View in Genome Browser
Species Human (GRCh38)
Location 2:43789466-43789488
Sequence GGTGCTTTGATGCATTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929661448 Original CRISPR GGTGCTTTGATGCATTTTGA GGG Intronic
901004845 1:6166675-6166697 GGTACTTGGAGGCATTTTGGGGG - Intronic
901955492 1:12782168-12782190 GGTGCTTTGATACACTTTTGAGG + Intergenic
901978861 1:13018218-13018240 GGTGCTTTGATACACTTTTGAGG + Intronic
902003220 1:13210720-13210742 GGTGCTTTGATACACTTTTGAGG - Intergenic
902022445 1:13356470-13356492 GGTGCTTTGATACACTTTTGAGG - Intergenic
903138948 1:21327085-21327107 GGTGCTTTGAAGCATCTACAGGG - Intronic
905350479 1:37342860-37342882 GGTGTGGTTATGCATTTTGAAGG - Intergenic
905978941 1:42205259-42205281 GGTTGTTTGCTACATTTTGATGG - Intronic
910469011 1:87530816-87530838 AGTGATTTGATTCATTTTGAGGG + Intergenic
912186800 1:107287042-107287064 GGTTTTCTGAGGCATTTTGAAGG + Intronic
912815013 1:112821991-112822013 GGGGATCTGATGCCTTTTGATGG + Intergenic
913023654 1:114812456-114812478 GGTGCTTTGGTTCATTGTTAAGG + Intergenic
914243354 1:145867598-145867620 GGTGCTTTGCTTCATATTCATGG - Intronic
916661284 1:166924317-166924339 GGTCATTTGGTGCATTTTAAAGG - Intronic
918106370 1:181418762-181418784 GGTGATCTGATACATTTTGAGGG - Intronic
918831373 1:189403623-189403645 AATACTTTGATTCATTTTGAAGG - Intergenic
920934964 1:210423698-210423720 AGGTCTTTGATCCATTTTGAGGG + Intronic
921757262 1:218873168-218873190 GGTACTGAGATACATTTTGAAGG + Intergenic
922174766 1:223188890-223188912 GGTGCTTTGTGGCATATTGACGG + Intergenic
922868338 1:228880068-228880090 GGTGCTTTCATGCATTCTCCTGG + Intergenic
923992885 1:239458665-239458687 GATTCTTGAATGCATTTTGAAGG + Intronic
1063193084 10:3716456-3716478 GTTGCTTTGCTCCGTTTTGAAGG - Intergenic
1067941956 10:50664421-50664443 GGTGGTTTTGTGTATTTTGACGG - Intergenic
1068189181 10:53627981-53628003 AGTTCTTTGATGCTATTTGAGGG - Intergenic
1070863198 10:79689372-79689394 GGTGGTTTTGTGTATTTTGACGG - Intergenic
1071041210 10:81309871-81309893 GGTGCTTTTATCCAGTTTGTGGG - Intergenic
1072205198 10:93197538-93197560 AGTGTTTGCATGCATTTTGAGGG + Intergenic
1072472597 10:95726739-95726761 TGTGTTTTGGTGCATTTTGGGGG + Intronic
1073009390 10:100347752-100347774 GGTGCTTTTATGAATTATGCGGG + Intronic
1077925111 11:6673921-6673943 GGTACTGTGATGAATTTTGCAGG + Intergenic
1079725747 11:23878709-23878731 GTTGCTTTGTTTCATTTTCATGG - Intergenic
1080556182 11:33419394-33419416 GGTTCTTGGATCCATTTTGTAGG + Intergenic
1081075900 11:38673092-38673114 GCTGCTTTGATGGTTTTAGAAGG + Intergenic
1081540902 11:44033903-44033925 TTTGCTTAGATGTATTTTGATGG - Intergenic
1081648853 11:44809593-44809615 GGTGCATTGCTGAATCTTGAGGG + Intronic
1085329010 11:75631721-75631743 GGTGCTTTGATATATTTAGGAGG + Intronic
1089625461 11:119748273-119748295 GGTGCTTTAGTGCAACTTGAAGG + Intergenic
1092994859 12:13940261-13940283 GTTACTTAGATCCATTTTGATGG + Intronic
1093303139 12:17478613-17478635 GGTGTTTTGGTTCTTTTTGATGG - Intergenic
1095548091 12:43396243-43396265 GGTGCTTAAATGAGTTTTGAAGG - Intronic
1096804551 12:54132486-54132508 GGCTCATTGATCCATTTTGAGGG + Intergenic
1098257286 12:68629852-68629874 GGTGTTTTGATTTGTTTTGAGGG + Intronic
1098602515 12:72348771-72348793 GGTACTTTGATGGATATAGATGG + Intronic
1099632282 12:85165766-85165788 GCTGATTTGATGCATTTTAATGG + Intronic
1100679924 12:96907603-96907625 GGTACTTGGATGCATTTTACAGG + Exonic
1102380371 12:112460414-112460436 GGTTATGTGATGCATTTTTAAGG - Intronic
1106063298 13:26317306-26317328 TTTCCTTTCATGCATTTTGATGG - Intronic
1107742557 13:43467223-43467245 GGAGCCTTCATGCATTTTGATGG - Intronic
1107861199 13:44662441-44662463 GGTGCTTGTATGCATTTGGGAGG - Intergenic
1108559592 13:51628932-51628954 GTTTCTGTGATCCATTTTGATGG + Intronic
1110077151 13:71260653-71260675 TGTGCATTTTTGCATTTTGAAGG - Intergenic
1111983043 13:95037237-95037259 GGTGCTTTCATTGATTTTTATGG - Intronic
1115405765 14:33014219-33014241 GATGCTAAGATGCATTTTTATGG + Intronic
1116739900 14:48741085-48741107 TGTGAATTTATGCATTTTGACGG - Intergenic
1118229448 14:63934090-63934112 GGTTCTTTATTGCATTTAGAGGG + Intronic
1118600923 14:67471055-67471077 GGAGGTTTGATGCCTTATGAGGG + Exonic
1123504249 15:20923167-20923189 GCAGCTTTGATGCAGCTTGAAGG - Intergenic
1123561494 15:21496864-21496886 GCAGCTTTGATGCAGCTTGAAGG - Intergenic
1123597738 15:21934144-21934166 GCAGCTTTGATGCAGCTTGAAGG - Intergenic
1126377636 15:48012285-48012307 GGTGCCTTCAGGAATTTTGAGGG - Intergenic
1128729537 15:70011556-70011578 GATGCTTTGCTGCATTTCGCAGG + Intergenic
1202969839 15_KI270727v1_random:223988-224010 GCAGCTTTGATGCAGCTTGAAGG - Intergenic
1132629357 16:909387-909409 TGTGCTTTGGTGCACTGTGAGGG - Intronic
1133709992 16:8392084-8392106 GATGCTTTGGTGCATGGTGATGG - Intergenic
1134562159 16:15220000-15220022 GGTGCTTTGTTTTATTTTGTTGG - Intergenic
1134922697 16:18131626-18131648 GGTGCTTTGTTTTATTTTGTTGG - Intergenic
1135280236 16:21147963-21147985 GGTGGTTTGAGGGATTTTCAAGG + Intronic
1135992890 16:27228556-27228578 GGTGCTGTGATGGATCTGGAGGG - Intronic
1135992928 16:27228668-27228690 GGTGCTGTGATGGATCTGGAGGG - Intronic
1137906813 16:52331703-52331725 GGGGTTTTGCTGCATTTGGAAGG + Intergenic
1138010916 16:53379334-53379356 GGAGCTTTGATTCGTTTTTATGG + Intergenic
1138184352 16:54964758-54964780 TTTGCCTGGATGCATTTTGAGGG + Intergenic
1138377565 16:56576385-56576407 GGTGCTTTGTTTTATTTTGGTGG - Intergenic
1138667836 16:58586815-58586837 GGTGATTATCTGCATTTTGATGG - Intronic
1144002174 17:11065293-11065315 GGTGCTTTTATGCCTGGTGATGG + Intergenic
1145183744 17:20776005-20776027 GGTGATATGACGCATGTTGAAGG + Intergenic
1145802912 17:27701974-27701996 AGTGTTTTTATCCATTTTGAAGG - Intergenic
1146988149 17:37242090-37242112 GATGCTTTGGGGCATTTTGTTGG - Intronic
1148988842 17:51647641-51647663 TGTGATTTCATGCATTTTCACGG + Intronic
1150553454 17:66232181-66232203 GGAGCTTTGGTGCCTTTCGATGG - Intronic
1158209919 18:55037548-55037570 GGTACTTTTCTGCATTTTTAAGG - Intergenic
1158912574 18:62080316-62080338 CATGCTTTGCTGCATTCTGAAGG + Intronic
1159431994 18:68363787-68363809 TGTGCTTTCATACATTTTCATGG - Intergenic
1159489653 18:69115005-69115027 GGTGCTTTTACCAATTTTGAGGG + Intergenic
1160301525 18:77685627-77685649 AGAGTTTTGTTGCATTTTGAAGG + Intergenic
1166066144 19:40360225-40360247 GGGGTCTGGATGCATTTTGAAGG - Intronic
1167772484 19:51529959-51529981 GGTGTTTTGCAGGATTTTGAAGG + Exonic
1168175074 19:54621715-54621737 GGGGGTTTGTTGCATTTTTAAGG + Intronic
925674052 2:6341319-6341341 AGTGAACTGATGCATTTTGAAGG - Intergenic
929044023 2:37773355-37773377 GGTTCTTTGTTGCATTCTGAGGG + Intergenic
929092481 2:38233127-38233149 CTTCCTTTGATGTATTTTGAGGG - Intergenic
929661448 2:43789466-43789488 GGTGCTTTGATGCATTTTGAGGG + Intronic
930238723 2:48913353-48913375 GTTGCTTTGAAGAATTTGGAGGG - Intergenic
930277842 2:49334443-49334465 GTTGCTGTGCTGCATTTTGAGGG + Intergenic
930685778 2:54306618-54306640 GATGCTTTGAAGCATTTTTGGGG - Intergenic
931041017 2:58300447-58300469 AGTGCTGTGATGCAGTTAGATGG + Intergenic
931312662 2:61096853-61096875 GGCCCCTTGATGCATTTTTAAGG - Intronic
932393445 2:71418476-71418498 GCTGCTTTGATACATTTTTAAGG + Intronic
937381640 2:121382846-121382868 GGTGCTGTGATCCAGTTGGATGG + Intronic
939306594 2:140419557-140419579 AGTACTTTGATACATTTTAAAGG + Intronic
939487052 2:142827380-142827402 GGTACTGTCATGCATTTTGATGG - Intergenic
941148155 2:161879719-161879741 GGCACTTACATGCATTTTGAAGG - Intronic
942591357 2:177550470-177550492 TGTGCTTTGACGTATCTTGAGGG - Exonic
944174537 2:196815338-196815360 GCTGTGTTGATACATTTTGAAGG - Intergenic
944180581 2:196888084-196888106 GGTGTTTTGATGGACTTTGATGG - Intronic
946525613 2:220516094-220516116 GGTTTTTGGATGCATTTTGCAGG + Intergenic
947520174 2:230839472-230839494 TTTCCTTTGATGTATTTTGAAGG - Intergenic
947938326 2:234026216-234026238 GGGGCTTTGATGGGTTTTGAAGG - Intergenic
1168785765 20:538951-538973 TGTCCTTAGATGCAGTTTGAAGG - Intronic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1175624481 20:60479014-60479036 GGTGCTGGGATGCATGTGGAGGG - Intergenic
1177530868 21:22356069-22356091 GAAGCTTTAATGCATTTTGTTGG + Intergenic
1177714050 21:24816396-24816418 GCTGCTTTGATTCATTTTTGGGG - Intergenic
1178934936 21:36853122-36853144 GGTGTTTTACTGCAGTTTGAAGG - Intronic
1180029441 21:45194733-45194755 GATTCTTTGATGCCTTTTCATGG + Intronic
1180229890 21:46420958-46420980 GGTGGCCTGAGGCATTTTGAGGG + Intronic
1181099816 22:20531653-20531675 GGTACTGTCATGCATTTTGATGG - Intronic
1182714294 22:32343084-32343106 CATGCTTTGCTGCATTCTGAAGG + Intergenic
1185126872 22:49016162-49016184 TGTGCTTTGCTACATTTTCAGGG + Intergenic
1203296149 22_KI270736v1_random:44751-44773 GGTTCTTTGTTGCATTCTGAGGG + Intergenic
950948676 3:16976933-16976955 GGTGTTTTCATGTATTTAGATGG - Intronic
953306057 3:41830729-41830751 AGATCTTTGATGCATTTTAAGGG - Intronic
954467534 3:50665199-50665221 GCTGCTATGAGGCATTTAGAAGG - Intergenic
956258657 3:67312152-67312174 GGTGTTTTGATACATTCTGATGG + Intergenic
956456804 3:69429688-69429710 GGTGCTTGGGTGAAATTTGAGGG + Intronic
956981420 3:74643306-74643328 GGTTCTGGGATGAATTTTGAAGG + Intergenic
957204663 3:77180862-77180884 GGTGCTTTTGTGGATTTTTATGG - Intronic
958786569 3:98603182-98603204 TCTGCTTTAATGCCTTTTGATGG - Intergenic
959526021 3:107378259-107378281 AGCTCCTTGATGCATTTTGATGG - Exonic
960739446 3:120816923-120816945 ACTGTTTTGATGCATTTTGCAGG - Intergenic
961908272 3:130285471-130285493 TGTTTATTGATGCATTTTGAAGG + Intergenic
962133343 3:132706465-132706487 TGGATTTTGATGCATTTTGAAGG - Intronic
962563307 3:136631252-136631274 GGTTCTTTCATGCCTTTTCAAGG - Intronic
963086929 3:141445627-141445649 GATTCTTTCATGGATTTTGAGGG - Exonic
965760597 3:172071757-172071779 GGGGCTTTGAAGCATATTGTAGG + Intronic
968412911 4:404745-404767 TGTGATCTGATGCCTTTTGATGG + Intergenic
971680699 4:29696105-29696127 TGTGCTTGTATGCATTTTGTTGG - Intergenic
975156454 4:71078172-71078194 GATGGTTTGATGCATTTTGAGGG - Intergenic
978931991 4:114325195-114325217 GGTGTTTTGATACCATTTGATGG - Intergenic
981600691 4:146485301-146485323 GCTGCAGTGATTCATTTTGAGGG + Intronic
981751811 4:148099452-148099474 GGTGATTAAATGCATTTTCACGG - Intronic
983299303 4:165904629-165904651 GGTGCTTTTATGAATTAAGAAGG - Intronic
983455416 4:167956809-167956831 GGCATTTTGATGCATTTTGTTGG - Intergenic
986832821 5:11599952-11599974 GGTACCTTGATGCATTTTGGAGG - Intronic
987164874 5:15187228-15187250 AGTGCTTTTATCCATTTTAATGG + Intergenic
987166409 5:15202762-15202784 AGTGCTTTTATCCATTTTAATGG + Intergenic
988810712 5:34782425-34782447 AGTGTTTTTATGCATTTTAATGG + Intronic
989285010 5:39688862-39688884 GTTGTTTTGATGCATTTGTATGG + Intergenic
990306522 5:54498865-54498887 GGTGTTTTTATCCATTTTAATGG + Intergenic
990605231 5:57403044-57403066 AGTGCTTTGATTCTTTCTGAGGG + Intergenic
993606551 5:89997499-89997521 TGAGCTTTGATGGATCTTGAAGG + Intergenic
995438903 5:112167913-112167935 TGTGCTTAGATGCATTTTTATGG + Intronic
998484900 5:142493427-142493449 GGTGATAACATGCATTTTGAGGG + Intergenic
999830749 5:155316784-155316806 GGTGCTTGGATTTATTTTGAGGG + Intergenic
1000251253 5:159497671-159497693 GGTGTTTTGACGCATTGTGATGG - Intergenic
1000707715 5:164532371-164532393 GGTGATTCAATGAATTTTGAAGG + Intergenic
1002706297 5:181162649-181162671 AGTGCTAAGATGGATTTTGAGGG - Intergenic
1004676662 6:17849309-17849331 GGGGATTTGTTGCATTATGAGGG - Intronic
1012279654 6:97313854-97313876 GGTACATTGTTGCATTTTTAAGG + Intergenic
1012424892 6:99103036-99103058 GGAGCCTTGATGTAATTTGATGG - Intergenic
1013050848 6:106533607-106533629 AGATCTTGGATGCATTTTGAAGG + Intronic
1013420941 6:109966205-109966227 GCTGATTTGATGCAATTTAAGGG + Intergenic
1014026345 6:116650783-116650805 GGGGCTTTGATTCATTGTGTTGG - Intronic
1015487446 6:133788795-133788817 GGAGCTGTGATTCATTTCGATGG - Intergenic
1016098740 6:140070890-140070912 TGTGCATTGGTGCATTGTGATGG - Intergenic
1016354242 6:143200868-143200890 GGTGCTTTGTTGACTTTTGTGGG - Intronic
1017181923 6:151562791-151562813 GGTGCCTTGATGCGTTTTGGGGG + Intronic
1024630818 7:51245270-51245292 GGTGTTTTGTTGGACTTTGATGG - Intronic
1027666746 7:81049480-81049502 AGTTCTTTGATACTTTTTGAGGG - Intergenic
1028506534 7:91577209-91577231 AGTGGTTTCATGCATTTTGAAGG - Intergenic
1031045034 7:116878105-116878127 GTATCTTTGAGGCATTTTGATGG + Intronic
1033104519 7:138508830-138508852 GGTGCCTTGATTCCTTTTCATGG + Intronic
1033411233 7:141119596-141119618 CATGCTTTGATGTATTTTGCAGG + Intronic
1033443895 7:141403841-141403863 AGTGAAGTGATGCATTTTGAGGG - Intronic
1033605372 7:142923887-142923909 GGAGATTTTCTGCATTTTGAAGG - Intronic
1034998547 7:155593724-155593746 TGTGATTTGATGCTTTTTGTGGG - Intergenic
1036911964 8:12765210-12765232 GGTGCGTTTATGCAGTTTGTGGG + Intergenic
1037630879 8:20654471-20654493 GGTGCTTTGATGAATATAGGAGG - Intergenic
1037755747 8:21709137-21709159 GGTGCTTGGATGCCCTTTGGTGG - Intronic
1040768758 8:50948490-50948512 GGGGCTTATATGTATTTTGAGGG - Intergenic
1040891038 8:52316327-52316349 GGTGCTGGGTGGCATTTTGATGG - Intronic
1041403489 8:57469896-57469918 GGTTCTTTTATGTATTTTCATGG + Intergenic
1041866238 8:62577031-62577053 GGTGCTTTGTTTATTTTTGAAGG + Intronic
1042256875 8:66814219-66814241 GGTACTTAAATGCTTTTTGAAGG - Intronic
1042300000 8:67268392-67268414 GGTACTTTGATGCAGTTTTTGGG - Intronic
1042927846 8:73984688-73984710 GGTCCTTTCAAGCATTTTGTGGG + Intergenic
1044173285 8:89083553-89083575 GGGGCTGAGATGCATCTTGAAGG - Intergenic
1044557005 8:93573942-93573964 GGTGCTTAAAACCATTTTGATGG - Intergenic
1045953625 8:107881252-107881274 GTTGCTTTGATGCTGCTTGAGGG + Intergenic
1046343486 8:112890188-112890210 TGTCACTTGATGCATTTTGATGG - Intronic
1046788857 8:118298873-118298895 GGTATTTTGAAGCATTTTGTTGG + Intronic
1048159169 8:131996259-131996281 GCTGCTTTTATGTATTTAGAAGG + Intronic
1048959751 8:139566526-139566548 GATGCTATGCTGCAGTTTGAGGG + Intergenic
1050266318 9:3893854-3893876 GGTGATTTGATGCATACTGAAGG + Intronic
1055150414 9:72991595-72991617 GGTGCTTTTATGAATCTAGAGGG + Intronic
1055605800 9:77969150-77969172 GCTGCTTGGCTGCATTATGAAGG - Intronic
1056370350 9:85947906-85947928 GGACCTTTGATGTACTTTGAGGG + Intronic
1056711464 9:88995135-88995157 GGTGTTTTGATTCAGTTTGGAGG + Exonic
1057256833 9:93556496-93556518 TGTCCTTGGATGTATTTTGATGG + Exonic
1058637562 9:107051051-107051073 GCTGCTTTGAAGCCTTTTTAGGG - Intergenic
1059905440 9:118979369-118979391 GTTGCTATCATGCATTTTGGAGG - Intergenic
1060683711 9:125588808-125588830 GGTGCTTTGTTGGATGTTGCAGG - Intronic
1061359133 9:130129966-130129988 GGAGCCTGGATGCATTATGAAGG + Intronic
1062232864 9:135491901-135491923 GGTCCTTTCATTCGTTTTGAGGG - Intergenic
1187477213 X:19622415-19622437 ACTGTATTGATGCATTTTGAGGG - Intronic
1188422631 X:30008479-30008501 GATACAGTGATGCATTTTGATGG + Intergenic
1188629584 X:32337149-32337171 AGTGATTTGATGCATTTTGCAGG + Intronic
1189180106 X:38995927-38995949 ATTGCTTTGAAGCATTTTAATGG - Intergenic
1190133911 X:47776783-47776805 GCTGCTCTGATGCATTCTTAGGG + Intergenic
1192775495 X:74240357-74240379 GCTGGTTTCATGTATTTTGAGGG - Intergenic
1193005143 X:76608573-76608595 GGTGCTTTGATTCAATTTATTGG - Intergenic
1193349707 X:80447464-80447486 GGTCATTTTATGCATTTAGAGGG - Intergenic
1194850506 X:98863481-98863503 TGTGCTTTGATTCCTTTTTAAGG + Intergenic
1196653249 X:118190121-118190143 GGGGATTTGATGTATTTTAAAGG + Intergenic
1197583889 X:128319928-128319950 GGTGGTCTGATACATTTTGAGGG - Intergenic
1197734379 X:129839951-129839973 GGTTATTTCTTGCATTTTGAAGG - Intronic
1198463309 X:136883327-136883349 GGTGGTTTCATTCATTCTGATGG - Intergenic
1200970333 Y:9145929-9145951 AGTGTTTTGATCCATTTTAATGG + Intergenic
1201370562 Y:13258675-13258697 AGTGTTTTGATCCATTTTAATGG - Intronic
1201520759 Y:14870968-14870990 TATGCTTTGATGCATTGTGCTGG + Intergenic
1201926918 Y:19297593-19297615 AGTGTTTTGATCCATTTTAATGG - Intergenic
1202140679 Y:21718392-21718414 AGTGTTTTGATCCATTTTAATGG - Intergenic
1202146186 Y:21785405-21785427 AGTGTTTTGATCCATTTTAATGG + Intergenic