ID: 929664082

View in Genome Browser
Species Human (GRCh38)
Location 2:43820331-43820353
Sequence ACGGCTCCTTCAGCTCTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929664078_929664082 -7 Left 929664078 2:43820315-43820337 CCACCTTTTCCCTTTCACGGCTC 0: 1
1: 0
2: 3
3: 22
4: 262
Right 929664082 2:43820331-43820353 ACGGCTCCTTCAGCTCTCATAGG 0: 1
1: 0
2: 1
3: 5
4: 110
929664079_929664082 -10 Left 929664079 2:43820318-43820340 CCTTTTCCCTTTCACGGCTCCTT 0: 1
1: 1
2: 3
3: 26
4: 372
Right 929664082 2:43820331-43820353 ACGGCTCCTTCAGCTCTCATAGG 0: 1
1: 0
2: 1
3: 5
4: 110
929664076_929664082 17 Left 929664076 2:43820291-43820313 CCATTGGCTGCAACTCATTGGGA 0: 1
1: 0
2: 1
3: 9
4: 96
Right 929664082 2:43820331-43820353 ACGGCTCCTTCAGCTCTCATAGG 0: 1
1: 0
2: 1
3: 5
4: 110
929664074_929664082 18 Left 929664074 2:43820290-43820312 CCCATTGGCTGCAACTCATTGGG 0: 1
1: 0
2: 1
3: 4
4: 87
Right 929664082 2:43820331-43820353 ACGGCTCCTTCAGCTCTCATAGG 0: 1
1: 0
2: 1
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929664082 Original CRISPR ACGGCTCCTTCAGCTCTCAT AGG Intronic
902366753 1:15980335-15980357 ACGACTCATTCAGCTCACAGAGG - Intergenic
904054558 1:27661653-27661675 ATGGCTCCTTCTGCACTCTTTGG - Intergenic
905254392 1:36670820-36670842 AAGGCTCCCTCAGCTTCCATGGG - Intergenic
905488330 1:38323637-38323659 ATGGCCCCTTCAGCTCTGTTAGG + Intergenic
906292867 1:44631524-44631546 ACGGCCCCTGGAGCTCCCATAGG - Intronic
907449661 1:54536872-54536894 ATGGCTCCTCAGGCTCTCATTGG - Intergenic
908272663 1:62436424-62436446 GCCCCTCCTTCCGCTCTCATTGG - Intronic
911629571 1:100167117-100167139 ACCTCTCCTTCACTTCTCATTGG - Intronic
912566902 1:110593998-110594020 GCTCCGCCTTCAGCTCTCATTGG + Intronic
913709622 1:121469629-121469651 AGGGCACATTCAGCTCACATTGG - Intergenic
916792166 1:168134997-168135019 AGTGCTCCTTCACCTCTCAGAGG + Exonic
918066290 1:181104469-181104491 GCGGCTCCTTCAGTTGTCCTGGG - Intergenic
923009509 1:230077005-230077027 CCGGCTCCTCAAGCTCTCACAGG - Intronic
924937704 1:248786067-248786089 ACGCATCCATCAGCTCTGATTGG + Intergenic
1063365284 10:5486824-5486846 AGGGCTCCTCCGGCTCTCAGTGG + Intergenic
1064660934 10:17607357-17607379 ACTGATCCTACAGCACTCATCGG + Intronic
1064963525 10:20992533-20992555 ACAGCTCCTGTTGCTCTCATGGG - Intronic
1067413267 10:46083893-46083915 ATATCTCCTTCAGCTCTTATAGG + Intergenic
1070670307 10:78372999-78373021 ACGGCAGCTGGAGCTCTCATGGG - Intergenic
1071345742 10:84690502-84690524 ACGGCTCTTGCTGCTATCATTGG + Intergenic
1071436238 10:85650382-85650404 ACGTCTCCTTCATCTCTCTGTGG - Intronic
1077446380 11:2592960-2592982 GCGGCTCCTTCAGGACTCCTGGG - Intronic
1080521994 11:33075702-33075724 ACGGCTCCCACAGCACTAATAGG + Intronic
1081607895 11:44538564-44538586 ACGGCGTCCTCAGGTCTCATCGG + Intergenic
1081652142 11:44831548-44831570 ACGGCCCCTTCACCACTCCTAGG + Intronic
1085028895 11:73257912-73257934 AGGGCTCCTTGACCTCTCCTGGG + Intergenic
1085161787 11:74354519-74354541 ATGGCTCCTCAGGCTCTCATCGG - Intronic
1086862386 11:91940005-91940027 ACTGCACCATCAGCTCTCCTGGG + Intergenic
1095347481 12:41168610-41168632 ACAGCTCCTGCAGCTCCCACTGG - Intergenic
1096411784 12:51382340-51382362 CCGGCTCCTTCAGCACTCAAGGG - Intronic
1100255987 12:92883850-92883872 ATGGCTCCTCAGGCTCTCATCGG - Intronic
1100617325 12:96240976-96240998 ATGGCTCATTAAGCTCTCACGGG + Intronic
1101855435 12:108438821-108438843 ACTGCACCATCAGCTCTCCTGGG - Intergenic
1103885583 12:124197812-124197834 AGGGCTCCCTCTGCTCTCCTTGG + Intronic
1105498260 13:20949501-20949523 ATGGCTCCTCAGGCTCTCATCGG + Intergenic
1107048629 13:36023349-36023371 ACTGCACCATCAGCTCTCCTGGG - Intronic
1107183412 13:37488374-37488396 ACTGCTCCTGAAGGTCTCATTGG + Intergenic
1109392625 13:61711914-61711936 TTGGCTCCATCAGCTCTCCTGGG + Intergenic
1116857224 14:49963435-49963457 ACCCCTCCTTGAGCTTTCATAGG - Intergenic
1121114061 14:91331353-91331375 ACATCTCCTGCAGCTCTCAGAGG - Intronic
1121162558 14:91758367-91758389 ACTGCACCATCAGCTCTCTTGGG + Intronic
1128434018 15:67627927-67627949 ATGGCTCCTCAGGCTCTCATCGG - Intronic
1129837508 15:78720337-78720359 ACGCCTCCTTGAGCTCTGGTGGG - Intronic
1132560937 16:593535-593557 ACAGCTCCTTCAGCTCACACCGG + Intronic
1133117006 16:3583096-3583118 ACAGCTCCTTGAGCTCACAGAGG - Exonic
1135978805 16:27130261-27130283 ATTGCTCCTTCAGCTCTCATGGG - Intergenic
1137704553 16:50525588-50525610 ACTACACCTTCAGCTCTCCTGGG - Intergenic
1141824806 16:86471579-86471601 CTGGCTCCTTAAGCTCTCCTTGG - Intergenic
1142795931 17:2306836-2306858 ATGGCTCCTCAGGCTCTCATTGG - Intronic
1150418674 17:65008612-65008634 ATGTCTCCTTCAGCTCTTCTTGG - Intergenic
1150512770 17:65774360-65774382 CCAGCTCCTTCTGCTCTCAGAGG - Intronic
1153738980 18:8102961-8102983 ACGTCTCCATCAGAGCTCATGGG + Intronic
1154502044 18:15001923-15001945 ACAGCCCCTTCAGCTGCCATCGG - Intergenic
1164870009 19:31635088-31635110 TCGGCTCCCTCAGCCCTCCTGGG + Intergenic
1165371923 19:35413843-35413865 AAGGCTCCTTCAGCCCTCTCCGG + Intergenic
1167575472 19:50315622-50315644 ACTGCTCCTGGAGTTCTCATCGG - Exonic
928506913 2:31963165-31963187 ACCGCACCGTCAGCTCTCCTGGG + Intronic
929664082 2:43820331-43820353 ACGGCTCCTTCAGCTCTCATAGG + Intronic
929912538 2:46102620-46102642 ATGTCTCCTTCAGCTCTTCTTGG + Intronic
929951182 2:46410679-46410701 AGGCCTGCTTCTGCTCTCATGGG + Intergenic
932487358 2:72092291-72092313 ACTGCTCCTTCTGTTCTCCTGGG - Intergenic
938501222 2:131832095-131832117 ACAGCCCCTTCAGCTGCCATCGG - Intergenic
938594730 2:132776506-132776528 CTGGCTCTTTCAGCTCTCCTGGG + Intronic
940202390 2:151166007-151166029 ACGGCAGATTCAGTTCTCATAGG - Intergenic
944572977 2:201063165-201063187 ATGGCTCCTCAGGCTCTCATCGG - Intronic
945117265 2:206420140-206420162 ATGGCTCCTCAGGCTCTCATCGG + Intergenic
945614964 2:212055319-212055341 AGGCCTCATTCAGCTGTCATGGG - Intronic
947642382 2:231714282-231714304 CCTGCCCCTGCAGCTCTCATTGG - Intergenic
948392619 2:237624001-237624023 ACGGGTCCTTCAGCATTCCTGGG + Intergenic
948573301 2:238931148-238931170 ACCTCTCCTTCAACTCTCCTGGG - Intergenic
1172502535 20:35437445-35437467 ACGGCTCCTTGGGCTCTCGTGGG + Exonic
1179795199 21:43778455-43778477 ACGGTTCCTGCAGCTCTGTTGGG + Intergenic
1180748125 22:18105973-18105995 ACCACGTCTTCAGCTCTCATGGG - Intronic
1182662354 22:31933930-31933952 ACGGCCCCTCCAGCTCTTAGAGG + Exonic
1185269330 22:49921714-49921736 ACGGCTACTTCAGCTCGCTCCGG + Exonic
949380073 3:3434426-3434448 ATGGCTCCTTTACCTCTCCTAGG - Intergenic
952003637 3:28815372-28815394 GCGGCTTCTTCACCTCTCTTAGG + Intergenic
956698881 3:71941513-71941535 ACGGCTCCTGCTGCTCTCCAGGG + Intergenic
959599376 3:108162539-108162561 ACTTCTCCTTCAGCTTTGATTGG + Exonic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
963664633 3:148167198-148167220 ATGGCTCCTCAGGCTCTCATCGG + Intergenic
964623332 3:158736267-158736289 AAGGCTCCTGCAGCTCTTCTGGG - Intronic
969105103 4:4801566-4801588 ACGTGTACTACAGCTCTCATAGG - Intergenic
969792074 4:9499056-9499078 ACGGCACCTTCAGGTCTTGTAGG - Intergenic
975478252 4:74847436-74847458 AAGGCCAGTTCAGCTCTCATAGG - Intergenic
978813975 4:112882051-112882073 AGGGCTCCTCAGGCTCTCATCGG + Intronic
979946578 4:126840043-126840065 ACGAGTCCTTCAGCACTCATAGG - Intergenic
982921465 4:161278548-161278570 AGGGCCCCTTCAGCTCTCCAGGG + Intergenic
983557380 4:169070518-169070540 ACGGCAGCCTCAGCTCTCTTTGG + Intergenic
984104653 4:175529943-175529965 ACGTCTCCTTCAGCATTCAGAGG - Intergenic
985536930 5:470448-470470 ACGTCTCCTTAAATTCTCATAGG + Intronic
987466092 5:18273600-18273622 AAGGCTCCATCTGCTTTCATTGG - Intergenic
997948489 5:138223093-138223115 ACTGTTCTTTCAGTTCTCATCGG - Intergenic
1003379466 6:5610100-5610122 ATGGCTCCTCAGGCTCTCATTGG + Intronic
1004821386 6:19371834-19371856 ACTGCTCCTGAAGCTCTCTTGGG - Intergenic
1018247101 6:161833822-161833844 AAGGCTCCTTCAGGACCCATGGG - Intronic
1021655435 7:22869542-22869564 ACGGCCCTTTCAGCTCTCTCTGG - Intergenic
1023931288 7:44708119-44708141 ACCCCTCCCTCTGCTCTCATAGG + Exonic
1028164401 7:87521540-87521562 ATGGCTCCTCAGGCTCTCATTGG - Intronic
1038831676 8:31068894-31068916 GTGGCTCCTTCTGCTCTCACTGG - Intronic
1045024616 8:98074932-98074954 ATGCCTCCTTCAGCTCCCCTTGG + Intronic
1045706411 8:104928255-104928277 TCAGCTTCTTCTGCTCTCATGGG + Intronic
1049662748 8:143827527-143827549 CATGCTGCTTCAGCTCTCATGGG - Intronic
1050373396 9:4945806-4945828 ATGGCTCCTCAGGCTCTCATTGG + Intergenic
1056645871 9:88411364-88411386 ATGGCTCCTCAGGCTCTCATCGG + Intronic
1057955359 9:99403108-99403130 ACAGCTCCTTCAGCTGTGATGGG + Intergenic
1057994541 9:99808956-99808978 ACTTTTCCTTCATCTCTCATTGG + Intergenic
1059412062 9:114138698-114138720 ACCGCTCCTCCAGCTATGATGGG - Intergenic
1060684425 9:125595743-125595765 ATGGCTCCTCTTGCTCTCATTGG - Intronic
1060919775 9:127412126-127412148 ACTGCACCATCAGCTCTCCTGGG - Intergenic
1062228203 9:135465750-135465772 CCGGCTCCCTCAGCCCTCAGAGG + Intergenic
1186197453 X:7123714-7123736 ATAGCTACTTCAGCTCTCTTTGG - Intronic
1187663688 X:21579022-21579044 ACAACTCCTTCAGCTCCAATCGG - Intronic
1187838389 X:23459065-23459087 AGGCCTCCTTGAGCTATCATGGG + Intergenic
1189775245 X:44464742-44464764 AGGGCTCCTTCCCCTCTCACTGG + Intergenic
1196763350 X:119220858-119220880 ATGGCTCCTCAGGCTCTCATCGG - Intergenic
1197996693 X:132383938-132383960 ACAGCTCCTACAGTCCTCATGGG - Intronic