ID: 929670285

View in Genome Browser
Species Human (GRCh38)
Location 2:43871877-43871899
Sequence GGGTGATCAGCATTGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929670281_929670285 -8 Left 929670281 2:43871862-43871884 CCAGAGCCCCACGAGGGGTGATC 0: 1
1: 0
2: 1
3: 14
4: 89
Right 929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 94
929670272_929670285 26 Left 929670272 2:43871828-43871850 CCCTTGCTTCATGGCTGAGGGTG 0: 1
1: 0
2: 0
3: 18
4: 212
Right 929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 94
929670273_929670285 25 Left 929670273 2:43871829-43871851 CCTTGCTTCATGGCTGAGGGTGG 0: 1
1: 0
2: 3
3: 17
4: 253
Right 929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 94
929670280_929670285 -7 Left 929670280 2:43871861-43871883 CCCAGAGCCCCACGAGGGGTGAT 0: 1
1: 0
2: 1
3: 10
4: 80
Right 929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 94
929670271_929670285 27 Left 929670271 2:43871827-43871849 CCCCTTGCTTCATGGCTGAGGGT 0: 1
1: 0
2: 1
3: 23
4: 167
Right 929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929670285 Original CRISPR GGGTGATCAGCATTGTGAGC TGG Intronic
900267310 1:1764515-1764537 GGGGGTTCTGCACTGTGAGCAGG - Intronic
901061157 1:6472518-6472540 GGGTGATCATCAACGTGAGTAGG - Exonic
902644965 1:17791621-17791643 GGGCCATCAGCATGGTGAGGAGG + Intronic
903469538 1:23576254-23576276 GGGTGTACAGCCCTGTGAGCAGG - Intergenic
903708078 1:25301673-25301695 GGAAGATCAGCAAGGTGAGCAGG + Exonic
903719033 1:25390740-25390762 GGAAGATCAGCATGGTGAGCAGG - Exonic
904820761 1:33242344-33242366 GGGAGGTGAGCATTTTGAGCAGG + Intergenic
908594698 1:65674704-65674726 GGGTGATTCACATTCTGAGCTGG - Intergenic
922679870 1:227584819-227584841 GGGTGATCAGACTTGTGCGATGG + Intronic
923868351 1:237963985-237964007 GGCAGATCAGCAGTGTGAGAAGG + Intergenic
924530995 1:244893827-244893849 GGAAGAAAAGCATTGTGAGCTGG - Intergenic
1064771574 10:18728982-18729004 GGGTGATCAGCAGTGTACTCTGG + Intergenic
1067404655 10:46010648-46010670 GTGTGATGAGAATTGTGAGAAGG - Exonic
1070392540 10:75983989-75984011 TGGGGAGCAGCATTGTGAGGAGG - Intronic
1072474891 10:95750692-95750714 GGGGAAACAGCATTCTGAGCAGG + Intronic
1074611927 10:115030129-115030151 GTGTGATAACCATTGTGTGCTGG - Intergenic
1075673448 10:124280029-124280051 GGGTGCTCTGCACTCTGAGCTGG + Intergenic
1076367662 10:129932565-129932587 CAGTGATCAGGATGGTGAGCAGG + Intronic
1077550716 11:3199051-3199073 GGGCGATCAGGAGTCTGAGCTGG - Intergenic
1079158127 11:17967832-17967854 GGCTGACCAGCATTGTGAGCTGG - Intronic
1079179223 11:18173910-18173932 GGAAGACCAGCACTGTGAGCAGG - Exonic
1079181420 11:18197033-18197055 GGAAGAGCAGCACTGTGAGCAGG - Intronic
1083159175 11:60844099-60844121 GGGTGATGAGCAAGTTGAGCGGG + Intronic
1083187348 11:61025437-61025459 GGGTGGTCAGCACTGGGAGATGG + Intergenic
1083588891 11:63880773-63880795 GAGTGATCACCAAGGTGAGCTGG - Intronic
1085191657 11:74630911-74630933 GGGTGATTAGAAATGTGAGTGGG + Intronic
1085658595 11:78340891-78340913 GGCTGATCACCATTGTGATGAGG - Intronic
1093287136 12:17277962-17277984 TGGTGATCAGCTGTGGGAGCTGG + Intergenic
1096177423 12:49531981-49532003 TGGCTACCAGCATTGTGAGCCGG - Intergenic
1096498585 12:52052433-52052455 GGATGATCAGCATCTGGAGCTGG - Intronic
1098569083 12:71968710-71968732 AGATGCTCAGCATTGTGAGGAGG - Intronic
1104837335 12:131800058-131800080 CGGTGCTCAGCATGGTGAGGCGG - Intergenic
1105603423 13:21907825-21907847 GGGTGATCAGCCATGGGAGAGGG - Intergenic
1106514001 13:30437227-30437249 GGGTCATAAGCAGTTTGAGCTGG + Intergenic
1107417122 13:40211265-40211287 GTGAGATCAGCACCGTGAGCCGG - Intergenic
1111396191 13:87672296-87672318 GAGTGATCATGAGTGTGAGCGGG + Intergenic
1111456991 13:88497194-88497216 GGGAAATAAGCATTGTGAACTGG - Intergenic
1113385103 13:109841505-109841527 TGGTCATCAGCATTTTGGGCGGG - Intergenic
1114774156 14:25461850-25461872 GGGTCAGCAGCATTGAGGGCAGG - Intergenic
1116827563 14:49687540-49687562 CGGTTATCAACATTGTGACCTGG - Intronic
1118448983 14:65880143-65880165 GTGTGATGAGAATTGTGAGAAGG - Intergenic
1118514086 14:66508021-66508043 GGGTGCTGAGTATTGGGAGCGGG - Exonic
1119514948 14:75240679-75240701 GGCTGATCACCATGGTGAGATGG - Intronic
1119975951 14:79023896-79023918 GGGTGCCCAGCATTGTAAGAAGG + Intronic
1124701245 15:31914399-31914421 GGGTGAACAGCATGCTCAGCTGG - Intergenic
1127799940 15:62469406-62469428 GGGTAAGCAGCATTGTGAAAGGG - Intronic
1127950655 15:63802493-63802515 GGTTGATCAGGATTGTGAACTGG - Intronic
1139596503 16:67961450-67961472 GGGTGCCAAGCATAGTGAGCAGG - Intronic
1142737768 17:1912383-1912405 GGGTGAACAGCATTGCAAGCAGG + Intergenic
1142964786 17:3573692-3573714 GGGCGATGAGCATGTTGAGCAGG + Exonic
1147399569 17:40172121-40172143 TTGTGATCAGCATTGTGACTTGG + Exonic
1147748088 17:42708257-42708279 GGGTGATCTGCTTTGTGGGGAGG + Intronic
929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG + Intronic
933083357 2:78023302-78023324 GGGTCCTCAGCAGTGTGTGCTGG + Intergenic
933693715 2:85199228-85199250 CTGAGATCACCATTGTGAGCTGG - Intronic
935755066 2:106270462-106270484 GGGTGATCAGGATTGGGAAGGGG - Intergenic
943314783 2:186373772-186373794 GGATGATCAGAGTTGTGAACAGG - Intergenic
944683194 2:202095747-202095769 GGGTGGGCGGCATTGTGAGTAGG - Intronic
1169271650 20:4204187-4204209 GGGATATAAGAATTGTGAGCTGG + Intergenic
1175098285 20:56559385-56559407 GGATTATCAGCATTCTGACCTGG - Intergenic
1175674317 20:60933834-60933856 GGGTGATGACCAGTGTGAGATGG - Intergenic
1182748599 22:32624358-32624380 GGATGAGCAGCATTCTGAGGAGG + Intronic
953703683 3:45215477-45215499 TGGTGGTCAGCATTGTTGGCCGG + Intergenic
956767387 3:72495236-72495258 GTGAGATCAGCATTTTAAGCAGG + Intergenic
969642932 4:8409986-8410008 GGGCTATCTGCATTGTGGGCAGG + Intronic
969703723 4:8781167-8781189 GGGAGACCAGCATCCTGAGCTGG + Intergenic
970387176 4:15567450-15567472 GGGTAGTCAGCATTGTGGGTTGG - Exonic
972165731 4:36281848-36281870 GGGTGATGACCTTTGTGAGGGGG + Intronic
972172076 4:36358378-36358400 GGGCGTGCAGGATTGTGAGCTGG + Intergenic
975721185 4:77250135-77250157 GGGTCTTCAGCAATGTGACCTGG - Intronic
985140156 4:186831637-186831659 GGGTGATGTCCATGGTGAGCTGG + Intergenic
986319219 5:6614364-6614386 TGGTGATCAGGATTGTGAGGAGG - Intronic
986703462 5:10434391-10434413 GTGTGATCAGCATTGGGAGTTGG + Exonic
987063805 5:14268403-14268425 GGGATATCAGCATTGGGATCAGG + Intronic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
996329727 5:122315137-122315159 TGGTGGTCAGCAATTTGAGCTGG + Intronic
996779491 5:127170659-127170681 GGGTGATCAGCCTGGTGAGGGGG - Intergenic
1001014056 5:168124923-168124945 GGGTGGTCTGAACTGTGAGCTGG + Exonic
1002801093 6:522187-522209 GTGTGGTGAGCACTGTGAGCTGG + Intronic
1006317749 6:33300143-33300165 GTGTGATGAGCATTGAGAGGAGG + Intronic
1006600777 6:35224254-35224276 GAGGGATAAGCATTGTGAGCAGG + Intronic
1015712173 6:136154107-136154129 GCGTGAACAGCATTGTGATACGG - Exonic
1016088103 6:139940871-139940893 TGGTGATCAGCCTCGTGATCAGG - Intergenic
1016897101 6:149064177-149064199 TGGTGACAAGCCTTGTGAGCAGG + Intronic
1017575580 6:155798720-155798742 GGGTGATAACCATGCTGAGCTGG + Intergenic
1018737216 6:166696287-166696309 GGGTGATCAGAAATGAGAGATGG + Intronic
1027565071 7:79781230-79781252 GGGTGAGTAGCATTGTGAACAGG - Intergenic
1030227084 7:107165356-107165378 GGGTGATAAGCATGCTGTGCAGG - Intergenic
1031724085 7:125215464-125215486 AAGTGAGCAGCATTCTGAGCAGG - Intergenic
1031859535 7:126962120-126962142 GGTTGAAAAGCATTCTGAGCAGG - Intronic
1032631656 7:133659663-133659685 GGAGAATCAGCATTTTGAGCAGG + Intronic
1036478866 8:9120158-9120180 TGCTGATCAGAATTGTAAGCTGG - Intergenic
1038746918 8:30262691-30262713 GGGTGATGAGGGATGTGAGCTGG + Intergenic
1041740302 8:61150580-61150602 TGCTGATCTGCATTGTGGGCAGG - Intronic
1046854662 8:119017344-119017366 TGGTGATCAGCAATTTAAGCAGG + Intronic
1049432677 8:142572483-142572505 TGGGGGTCAGCCTTGTGAGCTGG - Intergenic
1056144103 9:83712146-83712168 GAGTGATCACTATTGTGAACTGG + Intergenic
1056700850 9:88906142-88906164 GGCTGGTGAGCATTGTGTGCGGG - Intergenic
1060312784 9:122477779-122477801 GGATGAGCAGCATGATGAGCAGG + Exonic
1060315983 9:122510927-122510949 GGATGAGCAGCATGATGAGCAGG - Exonic
1190176924 X:48158062-48158084 GGGTGATCAGATTTCTGAGGAGG + Intergenic
1190181331 X:48195220-48195242 GGGTGATCAGTTTTCTGAGGAGG - Intronic
1195977134 X:110539471-110539493 GGCCTATCAGCATTGTGAGTGGG - Intergenic
1197990471 X:132311823-132311845 CGAGGATCAGCATTGTGAGGAGG + Intergenic