ID: 929671084

View in Genome Browser
Species Human (GRCh38)
Location 2:43876799-43876821
Sequence ATGAAGAGACTGTGTGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 2, 2: 4, 3: 19, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929671084 Original CRISPR ATGAAGAGACTGTGTGAATA TGG Intronic
903633684 1:24797775-24797797 ATGAAGAGCCTCTGGGAAAAGGG - Exonic
904587014 1:31586322-31586344 AGGAAGACACTCTGAGAATATGG - Intronic
906364995 1:45200953-45200975 ATGATGTGACTTTGGGAATAGGG + Intronic
906913174 1:49978592-49978614 ATGATGACAATGTGAGAATATGG + Intronic
908829049 1:68162014-68162036 CTTAAGAAACTGTGTGAACAAGG - Intronic
908896025 1:68900327-68900349 ATGAAGAGACTGTGTTAAAAAGG - Intergenic
909198401 1:72656680-72656702 TTAAAGGGACTGTGTCAATATGG + Intergenic
909338855 1:74509068-74509090 AAGAAGAAAGTGTCTGAATAAGG - Intronic
909889153 1:80981219-80981241 ATGAAGAAACTGTATCAAAAAGG + Intergenic
910069074 1:83189232-83189254 ATTAAGAGACTGTCTTAATGTGG + Intergenic
912417823 1:109522076-109522098 ATGAAGGGCCTGAGTGATTAAGG - Intergenic
913001923 1:114589227-114589249 AGCAAGAGACAGTGTGAAGAGGG - Intronic
913251122 1:116912490-116912512 ATTGAGAGACTACGTGAATATGG - Intronic
916375211 1:164146348-164146370 GTGCAGAGACTGTGTGAAAGAGG - Intergenic
916619928 1:166486156-166486178 AGGAAGAGACAGTGTAAAGAAGG - Intergenic
916879252 1:169003551-169003573 ATGAAAAGACTGTGTGTTCAGGG + Intergenic
918957392 1:191226503-191226525 ATGAAGAGACTGTTTCAATAAGG + Intergenic
921190603 1:212704674-212704696 ATGAAGAGACTGGGGGAAGCTGG - Intergenic
921261219 1:213386625-213386647 ATGAAGAGGCTGTGTGAAAGAGG - Intergenic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
1063747621 10:8903149-8903171 TTAAAGAGAAAGTGTGAATAAGG - Intergenic
1063749598 10:8927875-8927897 TTAAAGAGAAAGTGTGAATAAGG - Intergenic
1064390962 10:14941827-14941849 ATGCAGAAAATGTGTGAATGTGG - Intronic
1064401326 10:15023836-15023858 ATGCAGAAAATGTGTGAATGTGG - Intergenic
1065371975 10:24996516-24996538 CTGAAGAGGCTGTGTAAAAACGG - Intronic
1065638871 10:27760114-27760136 ATAATGAGACTGTGTGCTTAGGG - Intergenic
1066093074 10:32045157-32045179 ATTAAGAGACTGTGTAACTAAGG + Intronic
1066241179 10:33536687-33536709 ATGAATTCACTGTGTGAATGGGG - Intergenic
1066271583 10:33829360-33829382 ATGGAGAGACTGTGTATGTATGG + Intergenic
1067109565 10:43390561-43390583 AGAAAGAGGCTGTGTGGATAAGG - Intronic
1067177038 10:43957538-43957560 ATGAAGAGTCTGTGTTATTGGGG + Intergenic
1068826429 10:61445229-61445251 ATTAAGAGACTGTCTGAGAATGG + Intronic
1071090165 10:81909181-81909203 ATGAGAAGACTATGTGAAGAAGG - Intronic
1071095547 10:81969865-81969887 ATGAAGAGATTGAGTTAAAACGG - Intronic
1072811386 10:98465035-98465057 ATGAAGGGACTTTGTGGATAAGG - Intronic
1073632381 10:105161783-105161805 ATGAAGAGACTGTGGGCAGGTGG + Intronic
1074151319 10:110762236-110762258 ATCAAGAGAATGTGTGAAGCAGG + Intronic
1075566313 10:123507022-123507044 CTGAAGAGACGGTGTGGAGAAGG - Intergenic
1077953907 11:6992121-6992143 ATGTAGAAACTATGTGAAGAGGG + Intergenic
1080381850 11:31779874-31779896 AGGAAGAGACTGTGTGATGCAGG - Intronic
1080967944 11:37235577-37235599 AGGAAGAGAAAGTGGGAATATGG - Intergenic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1081245368 11:40759688-40759710 ATAAATAGAATATGTGAATATGG - Intronic
1081485360 11:43522989-43523011 CTTAAGAAACTGTGTGAACAAGG + Intergenic
1084625312 11:70301927-70301949 ATGCAGTGACCGTGTGAACATGG + Intronic
1085632635 11:78131842-78131864 ATGAAGGGCCTGAGTGAAGATGG - Intronic
1085660405 11:78360050-78360072 AGGAAGAGACAGTGTGACCATGG + Intronic
1086873403 11:92066529-92066551 ATGAAGAGAATTGGTGTATATGG - Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1088220032 11:107560238-107560260 ATGAAAAGACTTTGTTAATAAGG + Intronic
1088408297 11:109505108-109505130 ATGCAGAGACAGTATGAGTAGGG + Intergenic
1089853341 11:121518836-121518858 CTGAAGAGATTGTGTGGAGATGG + Intronic
1090300792 11:125637074-125637096 ATTATAAAACTGTGTGAATAAGG + Intronic
1091995184 12:4987732-4987754 ATCGAGAGACTGTTTGAACAGGG + Intergenic
1092781627 12:11993033-11993055 AGGAAGAGACTCTGAGAATAAGG + Intergenic
1093796033 12:23312375-23312397 AAGAAGACAATGAGTGAATAAGG + Intergenic
1095604565 12:44051679-44051701 GTAACGAGACTGTGTGAATAGGG + Intronic
1098099493 12:66999067-66999089 ATGAAGAAAATGTCTGAATGTGG - Intergenic
1098500128 12:71182561-71182583 ATTAAGAAACTATGGGAATAGGG + Intronic
1101284049 12:103291240-103291262 TTGAACAGACTGTGTGACTTTGG + Intronic
1101803038 12:108039198-108039220 AGGAAGAAAGTGTGTAAATAGGG + Intergenic
1102664901 12:114563512-114563534 ATGAAGAGACTGTGAGAAGATGG - Intergenic
1103054305 12:117806537-117806559 TTGAAGTGTCTGTGTGAAAATGG - Intronic
1106290422 13:28356140-28356162 ATGACTAGACTGTGTGAGTTGGG + Intronic
1109032961 13:57217258-57217280 GTGAAGAGACAGTGAGAAGATGG + Intergenic
1110875284 13:80502127-80502149 CTGAAGATACTGTGGAAATAGGG - Intergenic
1111823463 13:93241986-93242008 ATGTAGCGGGTGTGTGAATAGGG + Intronic
1112486491 13:99825074-99825096 ATGAAGTGACTGTCTGCTTATGG - Intronic
1112781415 13:102905023-102905045 ATTAAGAGCCTGTCTGAATTTGG - Intergenic
1113424810 13:110199292-110199314 ATGAGGAGAGTGTGAGAAAAAGG + Intronic
1113614971 13:111673787-111673809 CTGAGGAGACTGTGTGAGTCAGG + Intergenic
1113620441 13:111758701-111758723 CTGAGGAGACTGTGTGAGTCAGG + Intergenic
1114210555 14:20610272-20610294 GTGAAGAGACTGTGTTAACGTGG - Intergenic
1114331215 14:21638817-21638839 AAGAAGAGACTTTGGGAATGGGG + Intergenic
1114949500 14:27731026-27731048 ATAAACAGACTGTGTGAATGTGG + Intergenic
1115292802 14:31791714-31791736 AGGAAGAGAATGTGAGATTAAGG + Intronic
1115795445 14:36930418-36930440 ATGAGGGGACTGAGTGAAAAAGG - Intronic
1115877510 14:37877017-37877039 ATGCAGAGACTGTGAGAAAGAGG + Intronic
1117456443 14:55901948-55901970 ATGAAGAAACTGGGAGAAGAGGG + Intergenic
1117895128 14:60476264-60476286 ATGAATATACAGTATGAATAGGG - Intronic
1117962500 14:61177350-61177372 ATGCAGAGCCTCAGTGAATATGG + Intergenic
1118355671 14:65011610-65011632 CAGAAGAGCCTGTGTGACTAGGG - Intronic
1118362554 14:65068812-65068834 ATGGAAAGACTGTGTGATCAAGG - Intronic
1121166082 14:91802253-91802275 GTGAAGAGACTGTATGGATCGGG - Exonic
1121303553 14:92890531-92890553 GTGAGGACACTGTGAGAATATGG + Intergenic
1122163953 14:99807294-99807316 ATGAAATGACTGTGTGAACTTGG + Intronic
1202869551 14_GL000225v1_random:147974-147996 AAAAAGAAACTGTGTGAACAAGG + Intergenic
1125347591 15:38733704-38733726 ATGAAGACACAGTGAGAAGATGG - Intergenic
1125797956 15:42417967-42417989 ATGAGGAGACTCGGTGAAAAAGG + Intronic
1126731002 15:51682129-51682151 ATGAATAGACTGTCTGAGAAAGG - Intronic
1127552035 15:60049582-60049604 ATCATGAGACGGTGTGAATGTGG - Intronic
1128267491 15:66279494-66279516 ATGAAGGGAATGAGAGAATAAGG - Intergenic
1128359752 15:66953752-66953774 AGGCAGAGACTGTGTGACTCAGG + Intergenic
1129124575 15:73427660-73427682 CTGAAGAGACTGATTGAATGTGG - Intergenic
1129124717 15:73429044-73429066 TTGAAGAGAATGTGGGAAAATGG - Intergenic
1129578095 15:76775598-76775620 ATGAAGAGACAGTTTTTATATGG - Intronic
1131725308 15:95216048-95216070 CTGATGAGACTGTGTTAATTAGG + Intergenic
1132262479 15:100438588-100438610 ATGAAATTACTGTGTGAATTTGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133979652 16:10623627-10623649 ATAAGGAGACTGTGTGGCTATGG + Intergenic
1135270335 16:21063976-21063998 ATGGAGGGATTGTGTGATTATGG + Intronic
1137306095 16:47201577-47201599 ATCAAGAAACTGTGAGAATAAGG - Intronic
1139698356 16:68691636-68691658 ATGAAGAAAGTTTGAGAATACGG - Intronic
1140758545 16:78090680-78090702 ATGAGTGGACTGGGTGAATAGGG + Intergenic
1140798975 16:78467300-78467322 ATATATAGACTGTGTGTATATGG - Intronic
1141295514 16:82764772-82764794 ATGAAGGGACTCTGTGAGTGTGG - Intronic
1143070626 17:4289485-4289507 ATAAAGGTACTGTGTGAATCAGG - Intronic
1144182579 17:12766470-12766492 ATGAAGAGAGAGGGTGAATGCGG - Exonic
1145838087 17:27969962-27969984 CTTAAGAGACTGATTGAATACGG - Intergenic
1146236886 17:31174687-31174709 ATGAACAAACTGTGTGTCTAAGG - Intronic
1149466433 17:56883557-56883579 ATGAAGAGACTGAGGGAGTTGGG + Intergenic
1150264569 17:63824026-63824048 ACGCAGGGACTGTGTGAAGATGG - Intronic
1151625777 17:75274638-75274660 ATGAAGGGACAGTTTGAATTTGG - Intronic
1151776359 17:76205808-76205830 AAGAAGAAACTGTGTCAATGCGG + Intronic
1203161470 17_GL000205v2_random:56366-56388 CTTAAGAAACTGTGTGAACAAGG - Intergenic
1152968199 18:136426-136448 ATGAGGAGACTGTGAGAAGGAGG - Intergenic
1154099492 18:11456959-11456981 ATGTAGAAACAGTGTGAATTGGG - Intergenic
1156611772 18:38733464-38733486 AGGAAGAGACAGTGTGAGAATGG - Intergenic
1156714525 18:39991167-39991189 ATCCAGAGACTGTTTGATTAGGG - Intergenic
1158109948 18:53929767-53929789 ATGAACAAGCTGTGTGAGTATGG + Intergenic
1158161972 18:54494838-54494860 AAGAAGGGACTGGTTGAATAGGG - Intergenic
1158387944 18:57015912-57015934 ATGAAGTGTCTGTGTGTGTATGG - Intronic
1158782157 18:60664091-60664113 CTTAAGAAACTGTGTGAACAAGG + Intergenic
1159050244 18:63414952-63414974 ATGATGAGAATGTCTGTATATGG + Intronic
1160342764 18:78103777-78103799 ATTAACAGAGTGTGTGATTATGG + Intergenic
1161107391 19:2451274-2451296 ATGAAGAGACTTTGTGACACAGG + Intronic
1163283631 19:16332414-16332436 GGGAAGAGGCTGGGTGAATAGGG + Intergenic
1165541665 19:36497173-36497195 CTTAAGAAACTGTGTGAACAAGG - Intergenic
1166896491 19:46025615-46025637 ATGAACAGACAGTTTGAAGATGG - Intergenic
1167124026 19:47537075-47537097 AAGAAGGGACTGTGGGGATATGG + Intronic
1168200921 19:54815365-54815387 ATAAAGGGACTGTGTGTACACGG + Intronic
925674061 2:6341462-6341484 ATGAACAGTATGTGTGTATAAGG - Intergenic
926037142 2:9644762-9644784 GTGAAGAGCATGTGTGAACAGGG - Intergenic
926440751 2:12886044-12886066 AAGAAGGCAATGTGTGAATAAGG + Intergenic
926689660 2:15724625-15724647 AGGAAGAGACTGGGTGGAGAAGG + Intronic
929671027 2:43876493-43876515 AGGAGGAGACCGTGGGAATATGG + Intronic
929671032 2:43876512-43876534 ATGGGGAGACGGTGAGAATATGG + Intronic
929671044 2:43876569-43876591 ATGGGGAGACTATGGGAATATGG + Intronic
929671051 2:43876627-43876649 ATGGGGAGACCGTGAGAATATGG + Intronic
929671072 2:43876721-43876743 ATGGGGAGACTGTGGGAATATGG + Intronic
929671084 2:43876799-43876821 ATGAAGAGACTGTGTGAATATGG + Intronic
929671094 2:43876858-43876880 ATGGGGAGATTGTGCGAATATGG + Intronic
929671105 2:43876896-43876918 ATGGGGAGACTGTGGGAATATGG + Intronic
929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG + Intronic
929671151 2:43877141-43877163 ATGAGGAGACTGTGTGAATATGG + Intronic
929671181 2:43877293-43877315 ATGAGCAGACTGTGTGAATATGG + Intronic
929671217 2:43877463-43877485 ATGGGGAGACTCTGTGAATATGG + Intronic
930446080 2:51474108-51474130 ATGAGGCTACTGCGTGAATAAGG + Intergenic
930663481 2:54079089-54079111 ATGAAGAGACTGTCTCAGTGAGG + Intronic
931500921 2:62865441-62865463 ATGAATAGACTGTGTAATTAGGG + Intronic
932463379 2:71897590-71897612 AAGAAAAGTCTGTGGGAATAAGG + Intergenic
933465986 2:82652580-82652602 ATGAAGAGACTGGTTGTAAAAGG - Intergenic
935141091 2:100353757-100353779 ATGAAAAAACTGTGTGACTCTGG + Intergenic
938551097 2:132383131-132383153 ATGAAGAGATTGTAGGAACAGGG - Intergenic
940681130 2:156786621-156786643 ATGATAAGAATGTGTGAGTATGG + Intergenic
944097546 2:195985881-195985903 ATGAAGGTACTGTGTGAAAGAGG - Intronic
945680470 2:212907538-212907560 ATGAAGAAAATGTGAAAATAAGG - Intergenic
946133512 2:217626579-217626601 ATTTTGAGACTGTGTGATTAAGG - Intronic
946943934 2:224800151-224800173 CTGATGAGTCTGTGTGAAGAGGG + Exonic
947504674 2:230698786-230698808 GTGAAGAGATTCTGTAAATATGG + Intergenic
1171817415 20:29800475-29800497 GCGAAGACACTCTGTGAATATGG - Intergenic
1172545269 20:35755973-35755995 ATCAAAAGACTATATGAATAGGG + Intergenic
1172887664 20:38241904-38241926 AAGAAGAGGCAGTGTGAGTAGGG + Exonic
1175419973 20:58825364-58825386 ATGAAGAGACTGGGTGGATGGGG + Intergenic
1178132929 21:29593565-29593587 ATGAAGAGTGTGTGTAAATTGGG + Intronic
1178138535 21:29655742-29655764 ATGAAGAAACAGTGTGAAATTGG - Intronic
1181429868 22:22872739-22872761 ATGAAGTGTGTGTGTGCATATGG + Intronic
1183085468 22:35484067-35484089 AGGAAGGGAGTGAGTGAATATGG + Intergenic
1183994003 22:41620052-41620074 TGGATGAGGCTGTGTGAATAAGG - Intronic
949667347 3:6355376-6355398 GTGAAGAGAGTTTGTGAATTTGG - Intergenic
949891981 3:8740057-8740079 ATGGAGAGGCCATGTGAATAAGG - Intronic
955790377 3:62582911-62582933 ATGAAGAGAATGTGGGAAATGGG + Intronic
963290409 3:143481398-143481420 AAGGAGAGCCTGAGTGAATAGGG + Intronic
963510818 3:146246162-146246184 ATGAAGATACTGTGTATCTATGG - Intronic
964800063 3:160546525-160546547 AAGAAGAATCTGTGAGAATATGG + Intronic
965584099 3:170300147-170300169 ATGAAGAGACTGTTTGGAGCAGG - Intronic
966538010 3:181055581-181055603 GGGAAGAGACTGTGTCATTAGGG + Intergenic
967020012 3:185514604-185514626 AAGAAGAGACTCAGTGATTAGGG - Intronic
967706327 3:192655206-192655228 ATACAGAGATTGTGTTAATAAGG - Intronic
968612699 4:1564336-1564358 AGGAAGAGGCTGTGAGAAGACGG + Intergenic
970168466 4:13264564-13264586 ATGAAGAGACAGTGAGCATCTGG - Intergenic
970374993 4:15448041-15448063 ATGAAGACACAGTGAGAAGATGG + Intergenic
970935234 4:21561941-21561963 ATGAAAACACTGTGGCAATAAGG + Intronic
971430912 4:26566285-26566307 ATCATGAGACTGTGTAAATATGG + Intergenic
972032782 4:34482994-34483016 ATGAAGAAACTGAGTGAATTTGG + Intergenic
974327025 4:60426599-60426621 ATGAAGAGACTGGCTAAACAAGG + Intergenic
976806503 4:89052969-89052991 ATGAAAAGTCAGTGTGGATATGG - Intronic
976806643 4:89054734-89054756 ATGAAAAGTCAGTGTGGATATGG - Intronic
977886350 4:102256724-102256746 AGGAGGTGACTGTGTGAATTTGG - Intronic
979557695 4:122068677-122068699 ATGATGATACTTTGTGAATCTGG - Intergenic
979976596 4:127204300-127204322 ATGAAAAGATTGTGGGAAGAGGG + Intergenic
983618892 4:169738585-169738607 AGCAAGAGACTGGGAGAATAGGG - Intronic
984559555 4:181252509-181252531 CTGAAGAGACTGAGACAATATGG - Intergenic
985408787 4:189662378-189662400 ATGAACAGACTGTCTGCACAAGG - Intergenic
985618951 5:943241-943263 ATGCGGAGGCTGCGTGAATATGG + Intergenic
986695548 5:10352039-10352061 ATGAAGGGAATGTGTGTGTATGG - Intergenic
989340524 5:40369044-40369066 ATGAAGAGAATGTAGAAATATGG - Intergenic
989663095 5:43821125-43821147 ATGAAGATACTCTGAGAAGATGG + Intergenic
990195559 5:53311194-53311216 ATGAACAGACAGTTTGAAAAAGG + Intergenic
990887181 5:60607874-60607896 ATCAAGAGACAGTGTGTGTAAGG + Intronic
992263329 5:74992407-74992429 AAGAGGAGACTCTGTGAAGATGG - Intergenic
992468872 5:77034169-77034191 ATAATGAGACTTTGTGAACAAGG - Intronic
993212277 5:84967035-84967057 TTGAAGAGACGGTGAGTATATGG + Intergenic
993362518 5:86995675-86995697 ATGAAGTGACTTCATGAATAAGG - Intergenic
993391063 5:87319906-87319928 ATGAAGAGACGGTGTGAAATTGG - Intronic
993593298 5:89822951-89822973 GTGAAGACACAGTGAGAATATGG + Intergenic
994091677 5:95815129-95815151 ATAAGGAGACTTTCTGAATATGG + Intronic
995182641 5:109243476-109243498 TTGAAGATTCTGTGTGCATAAGG + Intergenic
995419287 5:111945102-111945124 ATGAAGTGAGTGCGTGAAGAGGG - Intronic
995540898 5:113185128-113185150 ATGAAGAGAGAGTGGGCATAAGG + Intronic
996485383 5:124027497-124027519 GTGAGGACACTGTGTGAAGATGG + Intergenic
996911160 5:128658856-128658878 ATGCAGAGCCTTTTTGAATATGG + Intronic
1000171923 5:158710945-158710967 ATCAAGAGATTGTGAGAACACGG + Intronic
1000175501 5:158748533-158748555 AAGAAGACACTATGTGAAAATGG - Intronic
1000358496 5:160424431-160424453 ATGATGAGACTGTCTGAATCTGG + Intronic
1001437953 5:171715133-171715155 AATAAGAGAGTGTGTGAAGATGG + Intergenic
1001910906 5:175516930-175516952 ATGAAGAGATGATGTGAATTTGG + Intronic
1003253051 6:4449240-4449262 ATGAAAAGTTTGTCTGAATATGG + Intergenic
1007177259 6:39905491-39905513 ATGAAGACACTGTGTGGGTAGGG - Exonic
1008384076 6:50867743-50867765 ATGGTGAATCTGTGTGAATATGG + Intergenic
1008784132 6:55144943-55144965 AAGAAAAGACAGTTTGAATAGGG - Intronic
1009557947 6:65198933-65198955 CTTGAGAGAATGTGTGAATAGGG + Intronic
1009609148 6:65916411-65916433 GTGTAGAGACAGTGTGTATATGG - Intergenic
1009890002 6:69669051-69669073 CTGAAGGGGCTGTGTGACTAGGG - Intergenic
1010694586 6:78954600-78954622 ATGAAGACACTGTAAGAATTGGG - Intronic
1012729340 6:102861357-102861379 AGGAAGAGAATGGGTGAAAAGGG + Intergenic
1014104300 6:117545778-117545800 GTGAAAAGACTGGCTGAATAGGG - Intronic
1015777858 6:136832611-136832633 ATGAAGAGATTATTTGAATTTGG - Intronic
1016420653 6:143879082-143879104 AGGAAGAGACTGTCAAAATATGG - Intronic
1017957753 6:159192985-159193007 ATTCAGAGACTCTGTGAATCTGG - Intronic
1018598833 6:165516241-165516263 ATTAAGAGACTGTATGCTTATGG - Intronic
1018621593 6:165734209-165734231 ATGAAGATACTGTATGAGTTTGG - Intronic
1020458372 7:8400141-8400163 ATGAAGATACTGTCTGGATTTGG + Intergenic
1021975096 7:26004216-26004238 AAGAAAAGACTGTGAGTATAAGG - Intergenic
1023534330 7:41192723-41192745 CTAAAGAGACTGTGTGAAATAGG + Intergenic
1023685697 7:42733020-42733042 ATAAAGACACTGTGTCAATTAGG + Intergenic
1024428414 7:49257581-49257603 ATGAATGCACTTTGTGAATAAGG + Intergenic
1026513046 7:71043412-71043434 ATGGAGACACTGAGTGATTAAGG + Intergenic
1028402883 7:90443353-90443375 AGGAAGAGACTGAGGGAAGAGGG + Intronic
1030876624 7:114820886-114820908 ATATAGAGACTGTGTTTATAAGG + Intergenic
1031405820 7:121385594-121385616 ATCAAGCTACTATGTGAATAAGG + Intronic
1031446317 7:121859213-121859235 TTGAAGAGAGTGGATGAATAAGG - Intergenic
1032082608 7:128867327-128867349 ATGGATAGAATGTGAGAATAAGG + Intronic
1035488574 7:159252236-159252258 CTGAAGTGACAGTGTGGATAGGG - Intergenic
1037850842 8:22326498-22326520 ATTAGGAGAAGGTGTGAATAAGG - Intronic
1038337679 8:26658765-26658787 ATGAAGAGAGTGTGTGCCTTGGG + Intergenic
1038701830 8:29856147-29856169 AAGAAAAGGCTGTGTGAAGAAGG + Intergenic
1038913695 8:31995821-31995843 ATGAAAAGACAGGGTGAATTTGG - Intronic
1040457931 8:47618839-47618861 GTGAACAGTCTGTGTTAATATGG + Intronic
1041784578 8:61617186-61617208 ATTAAGAGAGTGCGTGTATATGG + Intronic
1042014902 8:64298152-64298174 ATAAAGGGAGTGTGCGAATATGG + Intergenic
1042095695 8:65213675-65213697 ATGAAGAGAGTGTGTTATCAAGG - Intergenic
1042852194 8:73227169-73227191 ATGAAGAGACTTTATGGACAGGG - Intergenic
1043548954 8:81346984-81347006 ATAAACAGATTGTGTGATTAGGG + Intergenic
1045756613 8:105550702-105550724 AAGGAGAGGCTGTGTGAATCAGG + Intronic
1046186096 8:110721545-110721567 ATGAAGATACAGTGAGAAAACGG - Intergenic
1046679393 8:117151760-117151782 ATGATAAAACTGTGTTAATAAGG - Intronic
1046740340 8:117820829-117820851 AAGAAGAGATTCTGGGAATATGG - Intronic
1046958266 8:120083666-120083688 CTGAAGGGACTGTGGGAAGAAGG - Intronic
1048735448 8:137494956-137494978 CTGATAAGGCTGTGTGAATACGG - Intergenic
1049186874 8:141259874-141259896 ATGAAGCGAATGAATGAATAAGG + Intronic
1049907176 9:228932-228954 AACAAGAGACCGTGTGAAGAGGG - Intronic
1050030867 9:1383871-1383893 ATGGAGAGACTATGTTATTAAGG - Intergenic
1050658701 9:7858802-7858824 ATAAAGAAACAGTGTGATTAGGG + Intronic
1051236911 9:15010814-15010836 AGCAAGAGACTGGGAGAATAGGG + Intergenic
1051516088 9:17931968-17931990 ATGTAGAGGCTGTGTGGAAATGG + Intergenic
1051923082 9:22290724-22290746 ATCAATAGACTGAGTGAAGAAGG - Intergenic
1052247659 9:26356592-26356614 ATGCAGAGACTGTGAAAATCAGG + Intergenic
1053302801 9:36963767-36963789 ACGGAGTGTCTGTGTGAATAAGG + Intronic
1056872521 9:90296204-90296226 ATGAGGACATTATGTGAATAAGG - Intergenic
1059599720 9:115763609-115763631 ATGAAGAGAGTGGGTATATAAGG - Intergenic
1059827389 9:118046266-118046288 ATGAAGAGACTGTGTGACCCAGG - Intergenic
1059928420 9:119236662-119236684 CTGTAGAGACTGTGTGAAGTGGG - Intronic
1060578335 9:124719479-124719501 ATGATGAGAGTGTGGGAAAATGG - Intronic
1061713489 9:132503691-132503713 ATGAAGAGGTTGTGTGAACTTGG - Intronic
1203735324 Un_GL000216v2:133167-133189 AAAAAGAAACTGTGTGAACAAGG - Intergenic
1186994503 X:15105684-15105706 GGGAAGGGACTGTATGAATAGGG + Intergenic
1187068958 X:15868946-15868968 ATGAAGACACAGTGAGAAGATGG - Intergenic
1187798464 X:23031508-23031530 ATGAAGAGACTCTGTGTTCATGG - Intergenic
1189368772 X:40411318-40411340 ATGAACAGACTGTGTAGATGTGG - Intergenic
1190289923 X:48985547-48985569 ATGAAGAGAATGGGTAAATGTGG + Intronic
1191897661 X:66010704-66010726 ATGGTGAGCTTGTGTGAATAGGG - Intergenic
1193496524 X:82219843-82219865 CTGGAGAGTCTGTGAGAATAAGG - Intergenic
1194654675 X:96558232-96558254 ATGAGGAGATTGAGTGGATATGG + Intergenic
1196247246 X:113414738-113414760 CTGAATAGACTGGGTCAATAGGG - Intergenic
1197303616 X:124812656-124812678 ATGAATAGACTGTGGTAACAAGG + Intronic
1197364088 X:125543183-125543205 ATGAAGAGGGTGAGAGAATAAGG + Intergenic
1197788430 X:130224239-130224261 GTGAAGACACAGTGAGAATATGG + Intronic
1199297781 X:146178559-146178581 ATTATGAGACTGTGTGATTGTGG - Intergenic
1202333957 Y:23786070-23786092 TTAAAGAGACTGTGTAAAGATGG - Intergenic
1202536811 Y:25883989-25884011 TTAAAGAGACTGTGTAAAGATGG + Intergenic
1202625692 Y:56855240-56855262 AAAAAGAAACTGTGTGAACAAGG + Intergenic