ID: 929671123

View in Genome Browser
Species Human (GRCh38)
Location 2:43877012-43877034
Sequence ATGAAGAAACTGTGTGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 3, 3: 37, 4: 355}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929671119_929671123 6 Left 929671119 2:43876983-43877005 CCATGAGAATATAGGGAGACCAT 0: 1
1: 0
2: 4
3: 61
4: 743
Right 929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG 0: 1
1: 1
2: 3
3: 37
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929671123 Original CRISPR ATGAAGAAACTGTGTGAATA TGG Intronic
902083740 1:13840237-13840259 ATGAGGAAACAGTTTCAATATGG + Intergenic
902173294 1:14630231-14630253 ATGAAGAACTAGGGTGAATACGG - Intronic
903976432 1:27153425-27153447 ATGAAGGAAAGGTGGGAATATGG + Intronic
904313150 1:29642231-29642253 ATGAAGGAACTGTGAGCAGATGG + Intergenic
904587014 1:31586322-31586344 AGGAAGACACTCTGAGAATATGG - Intronic
906611013 1:47202637-47202659 AAGAAGAAATTGTATCAATAAGG + Intergenic
906913174 1:49978592-49978614 ATGATGACAATGTGAGAATATGG + Intronic
907259701 1:53208391-53208413 ATGAATAAACTCTATAAATAAGG - Intronic
908318465 1:62958094-62958116 ATGAAGAAACTGGGAAAATGAGG + Intergenic
908707620 1:66976539-66976561 ATGAAGTAACTTTGTTAAAAAGG + Intronic
908731564 1:67231482-67231504 ATGAAGAAACTGAGTCACTGAGG + Intronic
908829049 1:68162014-68162036 CTTAAGAAACTGTGTGAACAAGG - Intronic
908896025 1:68900327-68900349 ATGAAGAGACTGTGTTAAAAAGG - Intergenic
908985523 1:70014879-70014901 ATGAAGAAACTGCTAGAAAAGGG - Intronic
909338855 1:74509068-74509090 AAGAAGAAAGTGTCTGAATAAGG - Intronic
909426633 1:75532978-75533000 AAGTAGAAACTGTTTCAATAAGG - Intronic
909795193 1:79726509-79726531 AGGAAGAAACAGTGTGACTTTGG + Intergenic
909889153 1:80981219-80981241 ATGAAGAAACTGTATCAAAAAGG + Intergenic
910264817 1:85327362-85327384 AAGAAGTAATTGTGAGAATATGG - Intronic
911599241 1:99830449-99830471 CTGGAGAAACTGTGGGAATTGGG - Intergenic
912011303 1:104966840-104966862 ATGAAAGAAATTTGTGAATATGG - Intergenic
912022295 1:105120345-105120367 ATTCAGAAACTATGTGACTAAGG + Intergenic
912546486 1:110455092-110455114 ATGAAAAAGCTGTGGGAATTGGG - Intronic
914921872 1:151852799-151852821 ATGGGGAAACTGAGGGAATACGG + Intronic
915704222 1:157828311-157828333 ATGAAGAAAGTGTTTCAAGAAGG - Intergenic
917083211 1:171278211-171278233 AACATGAAACTTTGTGAATAGGG + Intronic
917129537 1:171726610-171726632 AGGATGAAACTGGGGGAATATGG - Intronic
918957392 1:191226503-191226525 ATGAAGAGACTGTTTCAATAAGG + Intergenic
918991157 1:191698627-191698649 ATCAAAAAATTGTGTGACTATGG - Intergenic
919181821 1:194094847-194094869 ATAAAGAATCTTTGTAAATAAGG - Intergenic
920227469 1:204449031-204449053 CTGAAGCAACTGAGGGAATATGG - Intronic
921261219 1:213386625-213386647 ATGAAGAGGCTGTGTGAAAGAGG - Intergenic
923296584 1:232600495-232600517 ATGAGGAAACTGGGTTACTAGGG + Intergenic
923937701 1:238781724-238781746 GTGAAGAAACTGTGAGCACATGG - Intergenic
924561315 1:245157838-245157860 ATGAAGAAACGGTGTTAAATCGG - Intronic
1063068429 10:2634365-2634387 AAGAAGAATCTGTGTGACTTCGG - Intergenic
1064339588 10:14474224-14474246 ACGTAGCAAGTGTGTGAATATGG - Intergenic
1064390962 10:14941827-14941849 ATGCAGAAAATGTGTGAATGTGG - Intronic
1064401326 10:15023836-15023858 ATGCAGAAAATGTGTGAATGTGG - Intergenic
1065549151 10:26852935-26852957 ATGAAGAAAATCTGTTAATGAGG - Intronic
1066093074 10:32045157-32045179 ATTAAGAGACTGTGTAACTAAGG + Intronic
1066241179 10:33536687-33536709 ATGAATTCACTGTGTGAATGGGG - Intergenic
1067470443 10:46533719-46533741 AAGAAGAAAATGTGTGACCAGGG - Intergenic
1068444075 10:57097245-57097267 TTGGAGAAATTGTGTGAATGTGG + Intergenic
1068615221 10:59106979-59107001 GGGAAGAAACTGTGTCAAAATGG - Intergenic
1071596130 10:86927560-86927582 ATAAGGAAAGTATGTGAATATGG + Exonic
1071949098 10:90682699-90682721 GTGAAGAAGGTGTGTGTATATGG - Intergenic
1072184241 10:93019693-93019715 ATAAGGGAACTGTGTGGATAGGG - Intronic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1072811386 10:98465035-98465057 ATGAAGGGACTTTGTGGATAAGG - Intronic
1074617497 10:115084098-115084120 ATAAAGAAACAGGGTGAATGAGG + Intergenic
1075776557 10:124992774-124992796 CTTAAGAAATTGTGTGAACAAGG - Exonic
1077953907 11:6992121-6992143 ATGTAGAAACTATGTGAAGAGGG + Intergenic
1078366072 11:10707580-10707602 ATGGAGAAAATGAGTCAATAGGG + Intergenic
1078741984 11:14075397-14075419 ACCAAGAAACTTTGTGAACAAGG + Exonic
1081343316 11:41953850-41953872 ATTCACAAACTGTGTGAATTTGG - Intergenic
1081485360 11:43522989-43523011 CTTAAGAAACTGTGTGAACAAGG + Intergenic
1081519255 11:43865714-43865736 AAGAACAAAATGTGTGAAAAGGG - Intergenic
1081588548 11:44404702-44404724 ATCACAAAACTGTGTGAACAGGG - Intergenic
1084702350 11:70795704-70795726 TTTAAGAACCTGTGTGATTATGG - Intronic
1085363302 11:75912673-75912695 ATGAACAATCTGTCTGAGTAGGG - Intronic
1085565640 11:77511120-77511142 CTAAAGAAACTGAGTGAATTAGG - Intergenic
1086253423 11:84845638-84845660 ATGAAGGAAGTGTTTCAATAGGG - Intronic
1086535483 11:87839686-87839708 CTGAAGAAACTCTCTTAATATGG + Intergenic
1086928073 11:92662413-92662435 ATGGAGTAACTGTGTTAAAATGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1088220032 11:107560238-107560260 ATGAAAAGACTTTGTTAATAAGG + Intronic
1089242004 11:117089424-117089446 ACTAAGAAACTGTGTGACTCAGG + Intronic
1089413747 11:118269242-118269264 CTGAAGAAACTTGGTGAATGTGG - Intergenic
1090300792 11:125637074-125637096 ATTATAAAACTGTGTGAATAAGG + Intronic
1091487197 12:900793-900815 CTGAAGAATCTGGGTGAAAAGGG + Intronic
1092781627 12:11993033-11993055 AGGAAGAGACTCTGAGAATAAGG + Intergenic
1093365623 12:18293253-18293275 ATGAAGAAACTAGGTCAAAAAGG + Intronic
1093407466 12:18822418-18822440 ATGAAAAAATTTTGTTAATAAGG - Intergenic
1093796033 12:23312375-23312397 AAGAAGACAATGAGTGAATAAGG + Intergenic
1093829834 12:23742312-23742334 GAAAAGAAAATGTGTGAATAAGG + Intronic
1094147663 12:27247237-27247259 ATGAAGTAACTGTGGTACTAAGG + Intronic
1095604565 12:44051679-44051701 GTAACGAGACTGTGTGAATAGGG + Intronic
1095863740 12:46948767-46948789 AGGAAGAAAATGTGTGGAGATGG - Intergenic
1096266705 12:50128931-50128953 GAGAAGGAACTGTGTGCATATGG - Intergenic
1096278386 12:50230334-50230356 ATAAAGAAATTGTGTCAGTATGG - Intronic
1097432174 12:59523879-59523901 ATGAAGAAAAGGTGAGAACATGG + Exonic
1097625852 12:61999456-61999478 ATGGAGAAAATATGTGGATACGG + Intronic
1098099493 12:66999067-66999089 ATGAAGAAAATGTCTGAATGTGG - Intergenic
1098500128 12:71182561-71182583 ATTAAGAAACTATGGGAATAGGG + Intronic
1099701591 12:86090260-86090282 ATGCATAAACTTTATGAATATGG - Intronic
1100207433 12:92365994-92366016 GTGAAGAAGCTGTATGAATGGGG - Intergenic
1100536367 12:95513761-95513783 CTGAAGAATCTGTGTGACTTGGG + Exonic
1100705368 12:97194911-97194933 AGGAACCAACTGTGTGATTAGGG + Intergenic
1101301829 12:103490936-103490958 ATGAATTAAATGTGTGCATAGGG + Intronic
1101653840 12:106702506-106702528 CTTAAGCAACTGTGTGCATAGGG - Intronic
1101803038 12:108039198-108039220 AGGAAGAAAGTGTGTAAATAGGG + Intergenic
1102406120 12:112675875-112675897 ATGCAGGAACTGTTTAAATAGGG + Intronic
1102664901 12:114563512-114563534 ATGAAGAGACTGTGAGAAGATGG - Intergenic
1104298292 12:127539254-127539276 ATGAAGAAAATGTTGGAAAATGG - Intergenic
1104717387 12:131025167-131025189 AAAAAGAAAGTGTTTGAATAAGG + Intronic
1106923176 13:34586673-34586695 TTGATGAAAATGTGTGACTAGGG - Intergenic
1108815773 13:54288026-54288048 ATTAAGAATCTTTGTGAATTAGG + Intergenic
1109228679 13:59728508-59728530 AGAAAGAAATTGTGTGTATAAGG + Intronic
1110875284 13:80502127-80502149 CTGAAGATACTGTGGAAATAGGG - Intergenic
1111346402 13:86960628-86960650 ATGAAAAAAATGTGTGATTTGGG - Intergenic
1111457346 13:88502354-88502376 ATGAAGAAAATGTGTATATGTGG - Intergenic
1113266169 13:108620610-108620632 ATGAGGAAACTGTGGAAAGAAGG + Intronic
1114949500 14:27731026-27731048 ATAAACAGACTGTGTGAATGTGG + Intergenic
1115468579 14:33744172-33744194 ATGATGAAGCTTAGTGAATAAGG - Intronic
1115795983 14:36936203-36936225 ATGAAGAAATTATTTGAAGAGGG - Intronic
1115913717 14:38285995-38286017 ATGCTGAAACTGTGAGATTAGGG + Intergenic
1116362425 14:44017558-44017580 GTCAAGAAACATTGTGAATAGGG - Intergenic
1116498691 14:45593892-45593914 CTGAAGAAAGTGTGAGAATTAGG + Intergenic
1116724034 14:48538269-48538291 ATGAAAAATCTGGGTGGATATGG + Intergenic
1117456443 14:55901948-55901970 ATGAAGAAACTGGGAGAAGAGGG + Intergenic
1117651211 14:57907712-57907734 TTGCAGAACCTGTATGAATAAGG + Intronic
1117749060 14:58901792-58901814 ATAGAGAAAGTGTGTGAAAAAGG - Intergenic
1117895128 14:60476264-60476286 ATGAATATACAGTATGAATAGGG - Intronic
1118460730 14:65984573-65984595 ATGAGGAAACTGAGTGCAAAAGG - Intronic
1120018245 14:79498591-79498613 ATGAACAAACTGTGGGCATGAGG - Intronic
1120763676 14:88308740-88308762 TTGAAGAATCTGTGTTAATTAGG - Intronic
1121303553 14:92890531-92890553 GTGAGGACACTGTGAGAATATGG + Intergenic
1121705154 14:95987397-95987419 ATGATGAAACTGAGATAATATGG - Intergenic
1121973253 14:98378744-98378766 AGGAAGAAACTGGATGAATTAGG + Intergenic
1202869551 14_GL000225v1_random:147974-147996 AAAAAGAAACTGTGTGAACAAGG + Intergenic
1125347591 15:38733704-38733726 ATGAAGACACAGTGAGAAGATGG - Intergenic
1125952148 15:43761275-43761297 AGGAGGAAACTGGGTGACTAGGG + Intronic
1126014990 15:44342186-44342208 ATGTAGAAAATGTCTGCATATGG - Intronic
1126281095 15:46950095-46950117 ATGAAGAAATTGTTTCAAGAAGG - Intergenic
1126817973 15:52472377-52472399 ATGAAAAAAATGTCTGGATAGGG - Intronic
1127123093 15:55787926-55787948 ATAAAGAAACTGGGTGTATGTGG + Intergenic
1131964954 15:97832190-97832212 ATGAAGAAACTGGGAGAGTGGGG + Intergenic
1132262479 15:100438588-100438610 ATGAAATTACTGTGTGAATTTGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134189139 16:12107847-12107869 ATGAAGAAACTGTGTGCCACAGG + Intronic
1134780915 16:16894898-16894920 ATGAAGAAACTGAGTACAGAAGG - Intergenic
1137306095 16:47201577-47201599 ATCAAGAAACTGTGAGAATAAGG - Intronic
1138817289 16:60217212-60217234 ATGAGGGAACTGTGTATATAAGG + Intergenic
1139344373 16:66293099-66293121 AGGAAAAAAATGTGTGCATAGGG - Intergenic
1139698356 16:68691636-68691658 ATGAAGAAAGTTTGAGAATACGG - Intronic
1140053404 16:71503139-71503161 AAGAAGAAATTGTGAGACTATGG - Intronic
1141118838 16:81335126-81335148 AGGATTAAACTGTGTGACTATGG + Intronic
1142912261 17:3104373-3104395 ATGAAGAAACGGGATGAACAGGG + Intergenic
1143070626 17:4289485-4289507 ATAAAGGTACTGTGTGAATCAGG - Intronic
1144595066 17:16562583-16562605 ATGTAGGAACTGGGTGAATGTGG + Intronic
1146236886 17:31174687-31174709 ATGAACAAACTGTGTGTCTAAGG - Intronic
1146537967 17:33669627-33669649 ATAGAGAACGTGTGTGAATATGG + Intronic
1148396543 17:47312607-47312629 ATGAAGAAACTGTATCAAAGGGG + Intronic
1149357875 17:55862452-55862474 ATGAAGAAACTGAGTCAGTTTGG + Intergenic
1149403874 17:56327157-56327179 ATGAAGAAACCAAGTGAGTATGG - Intronic
1150187298 17:63197127-63197149 ATGCAGGAACTGTGTGATTTGGG + Intronic
1150361283 17:64536605-64536627 TTTAAGAAACTGTTTGAAGAAGG + Exonic
1151776359 17:76205808-76205830 AAGAAGAAACTGTGTCAATGCGG + Intronic
1152556247 17:81054585-81054607 ATGTAGAAACTGTGGGATCAGGG + Intronic
1203161470 17_GL000205v2_random:56366-56388 CTTAAGAAACTGTGTGAACAAGG - Intergenic
1154099492 18:11456959-11456981 ATGTAGAAACAGTGTGAATTGGG - Intergenic
1155108430 18:22689752-22689774 ATGAAGAAACTGTTTTGAGAAGG - Intergenic
1155618812 18:27752083-27752105 AAGAAGAATCAGTGTGTATATGG + Intergenic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1156892807 18:42209347-42209369 ATGAGGAAACAGTTTCAATATGG + Intergenic
1157374235 18:47148964-47148986 ATGAAGAAACTGAGGCAAAAAGG - Intronic
1157431538 18:47631636-47631658 ATGGAGAAACCATGTGAAAAGGG - Intergenic
1158109948 18:53929767-53929789 ATGAACAAGCTGTGTGAGTATGG + Intergenic
1158782157 18:60664091-60664113 CTTAAGAAACTGTGTGAACAAGG + Intergenic
1159505121 18:69326682-69326704 ATGAAGAATGTGTTTTAATAAGG - Intergenic
1160068373 18:75600311-75600333 TTAAAGAAACTGTGCAAATATGG + Intergenic
1163868603 19:19797609-19797631 AAGAAAAAATTGTGTAAATAGGG + Intronic
1165541665 19:36497173-36497195 CTTAAGAAACTGTGTGAACAAGG - Intergenic
1167981036 19:53276036-53276058 AGGAAGAAGCTCTGGGAATAAGG - Intergenic
1168121192 19:54253458-54253480 ATGCAGAACCTGTCTGGATAGGG + Intronic
926293223 2:11547359-11547381 ATGAAGAAACTAAGAAAATAAGG - Intronic
926440751 2:12886044-12886066 AAGAAGGCAATGTGTGAATAAGG + Intergenic
926520645 2:13909132-13909154 ATTAAGAAAATGTGTGGGTAAGG + Intergenic
927382168 2:22491544-22491566 AAGAAGAAACTTTGTAAATGAGG + Intergenic
927835519 2:26395236-26395258 ATGAAGAAACTATCTGATAAAGG - Exonic
929044083 2:37773700-37773722 ATGAACAATCTGTCTGAACAAGG - Intergenic
929671072 2:43876721-43876743 ATGGGGAGACTGTGGGAATATGG + Intronic
929671084 2:43876799-43876821 ATGAAGAGACTGTGTGAATATGG + Intronic
929671105 2:43876896-43876918 ATGGGGAGACTGTGGGAATATGG + Intronic
929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG + Intronic
929671151 2:43877141-43877163 ATGAGGAGACTGTGTGAATATGG + Intronic
929671181 2:43877293-43877315 ATGAGCAGACTGTGTGAATATGG + Intronic
929671217 2:43877463-43877485 ATGGGGAGACTCTGTGAATATGG + Intronic
930340116 2:50102001-50102023 AGGAAAAAAATGTGTGTATATGG + Intronic
930446080 2:51474108-51474130 ATGAGGCTACTGCGTGAATAAGG + Intergenic
930469155 2:51791819-51791841 AGAAAGAATCTGTGTGCATAGGG + Intergenic
930707448 2:54518794-54518816 ATTAAGGAAGTGTGTGTATATGG + Intronic
930983384 2:57555189-57555211 AGGAAGAAACTATGGGAAGAAGG - Intergenic
931310471 2:61074702-61074724 GTTAAAAACCTGTGTGAATATGG - Intronic
931500921 2:62865441-62865463 ATGAATAGACTGTGTAATTAGGG + Intronic
931800605 2:65754420-65754442 ACAAAGAAAATGTGTGAATTTGG - Intergenic
935042351 2:99444964-99444986 ATGAAAAAACTCAGTGTATAAGG - Intronic
935141091 2:100353757-100353779 ATGAAAAAACTGTGTGACTCTGG + Intergenic
936668068 2:114621457-114621479 ATTTAGAATCTGTGTGAATTTGG - Intronic
936810538 2:116394908-116394930 ATTTAGAAACTATGTGCATATGG + Intergenic
936987754 2:118327750-118327772 ATTAAGAAACCATGGGAATAGGG + Intergenic
937576781 2:123433123-123433145 ATGAAGAAAATGTAAGAAAATGG + Intergenic
937624906 2:124033450-124033472 AAGAAGAAAGTGTGAGAAGAAGG - Intronic
938527935 2:132153017-132153039 CTGAAGAACCTGTGTTAGTAAGG + Intronic
940735055 2:157441446-157441468 AAGAAAAAGCTGTTTGAATATGG + Intronic
941128000 2:161610189-161610211 ATGAAGAAACTACTTGAATGGGG - Intronic
941370852 2:164662355-164662377 ACCAAGAAACTGTGTGGAAATGG + Intronic
941913252 2:170787574-170787596 GTGAAGAAACTATCTGAATCTGG - Intronic
942923153 2:181401237-181401259 ATAAAGAAACTGGGTGAAGGAGG - Intergenic
943147814 2:184067252-184067274 CTGAAGAAACTATTTGAGTATGG + Intergenic
943148332 2:184075103-184075125 GTGATGAAAATGTCTGAATATGG + Intergenic
943372791 2:187036554-187036576 AAGAAAAAACTGTGAGATTAGGG + Intergenic
944097546 2:195985881-195985903 ATGAAGGTACTGTGTGAAAGAGG - Intronic
945367320 2:208971361-208971383 TTGCAGGAACTGTGTGATTACGG + Intergenic
945680470 2:212907538-212907560 ATGAAGAAAATGTGAAAATAAGG - Intergenic
945995650 2:216433737-216433759 ATGAACAAACTCAGTGAAGAAGG + Intronic
946609221 2:221439965-221439987 ATGCAGAAAATTTGTGAAGATGG - Intronic
947010938 2:225566003-225566025 TGGCAGAAACTGTGTGAACATGG - Intronic
948241575 2:236441607-236441629 ATGTAGAAATTATGTGATTATGG - Intronic
1171817415 20:29800475-29800497 GCGAAGACACTCTGTGAATATGG - Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174667172 20:52270497-52270519 ATGAAGGAAATGTGGGATTAAGG + Intergenic
1175419973 20:58825364-58825386 ATGAAGAGACTGGGTGGATGGGG + Intergenic
1176341270 21:5697987-5698009 CTTAAGAAACTGTGTGAACGAGG + Intergenic
1176473524 21:7130140-7130162 CTTAAGAAACTGTGTGAACGAGG + Intergenic
1176503557 21:7626469-7626491 CTTAAGAAACTGTGTGAACGAGG - Intergenic
1176964828 21:15200543-15200565 ATAAAGAAACTGTGCGATAAGGG + Intergenic
1177027410 21:15936504-15936526 CTGAAGAAACCCTGTGAATGGGG + Intergenic
1178102063 21:29280685-29280707 ATTAAGAAACTTTGGGACTATGG + Intronic
1178138535 21:29655742-29655764 ATGAAGAAACAGTGTGAAATTGG - Intronic
1179333230 21:40425891-40425913 ATGAATAAACTATGTATATATGG + Intronic
1179634291 21:42697388-42697410 AAGAAGAAACACAGTGAATATGG - Intronic
1181007027 22:20018484-20018506 ATGAGGTAACTGTGAGAAGAGGG - Intronic
1182032618 22:27171407-27171429 ATGAAGAAACTGAGTCCTTAGGG - Intergenic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1203240535 22_KI270733v1_random:12451-12473 CTTAAGAAACTGTGTGAACGAGG + Intergenic
956475595 3:69616936-69616958 ATGAAGAAACTGAGATATTATGG + Intergenic
959593991 3:108108791-108108813 AGGAAGAAACTTTATAAATAAGG + Intergenic
959637393 3:108590302-108590324 ATGTAGAAATTGTAAGAATAGGG + Intronic
959797631 3:110450859-110450881 ATAAGGAAAGTATGTGAATATGG - Intergenic
960789586 3:121413686-121413708 TTGAAGAAACCTTGTGATTAAGG + Intronic
963510818 3:146246162-146246184 ATGAAGATACTGTGTATCTATGG - Intronic
964800063 3:160546525-160546547 AAGAAGAATCTGTGAGAATATGG + Intronic
965177591 3:165355715-165355737 ATGAAAAACCTCTGTGAATCAGG - Intergenic
966328849 3:178789025-178789047 ATGGTGAAACTGGGGGAATAGGG + Intronic
966430365 3:179825738-179825760 ATGAAGAAACTGAGTTAAAGAGG - Intronic
966963341 3:184964254-184964276 ATGAAAAAAATGAGTGAATTTGG + Intronic
967174246 3:186848417-186848439 ATGAGGAAACTGAGAGATTAAGG + Intronic
967282928 3:187839883-187839905 GGCAAGAAACTGTGTGAACAGGG - Intergenic
967945965 3:194804469-194804491 ATGAAGAAACTCAGTCCATAGGG - Intergenic
968463601 4:738316-738338 ATGAATGAACTCTGTGAGTAGGG - Intronic
968695439 4:2023498-2023520 ATCAAGAAAATGTGGCAATAAGG - Intronic
969986185 4:11213385-11213407 AGGAAGAAACAGTATAAATAGGG + Intergenic
970322889 4:14892879-14892901 ATGATGTAACTTTGTGTATAGGG - Intergenic
970374993 4:15448041-15448063 ATGAAGACACAGTGAGAAGATGG + Intergenic
970935234 4:21561941-21561963 ATGAAAACACTGTGGCAATAAGG + Intronic
971430912 4:26566285-26566307 ATCATGAGACTGTGTAAATATGG + Intergenic
971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG + Intergenic
972032782 4:34482994-34483016 ATGAAGAAACTGAGTGAATTTGG + Intergenic
975025084 4:69538241-69538263 ATGAGAAAACTGTGAGACTATGG - Intergenic
975159887 4:71113119-71113141 ATGAAGAAACTGAGTGGAGGAGG + Intergenic
975995536 4:80309413-80309435 ATCAAGAAAATATGTGAATCAGG - Intronic
976873535 4:89825996-89826018 ATGAATTAACTTTTTGAATAGGG - Intronic
979130682 4:117040808-117040830 ATGAAGAAAGCGTGTAAAGAGGG + Intergenic
979557695 4:122068677-122068699 ATGATGATACTTTGTGAATCTGG - Intergenic
979793661 4:124817150-124817172 AAGAAGAATGTGTTTGAATAAGG - Intergenic
979916245 4:126437654-126437676 AAGAAGAAACAGAGTGAAAAGGG - Intergenic
980372664 4:131898049-131898071 ATGAACAAAATATGTAAATAAGG - Intergenic
981559948 4:146036915-146036937 ATGAATAAATTGTGAGATTATGG + Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
983754332 4:171315356-171315378 ATGAAAAAACTTTGTGGAAATGG + Intergenic
985362213 4:189187608-189187630 AGGAAGAAACTGTAGGAAAAGGG - Intergenic
986417349 5:7542543-7542565 ATGTAAAAACTGTGTAAAAAAGG + Intronic
986819697 5:11452058-11452080 AGGAAGAAACTTTCTGAAAATGG + Intronic
987257410 5:16170304-16170326 ATGAAAAAAGTCTGTGAATGTGG - Intronic
987423102 5:17744101-17744123 AAGAAGAAACTCTGGAAATAAGG - Intergenic
987854527 5:23402535-23402557 ATGATAAAACTGTTTGAAAAGGG + Intergenic
987879584 5:23726114-23726136 TTGAAGAAACTATGTGCCTATGG + Intergenic
989663095 5:43821125-43821147 ATGAAGATACTCTGAGAAGATGG + Intergenic
990471495 5:56120325-56120347 ATGAAGAAATGGTGTTAAGAGGG - Intronic
992465661 5:77001249-77001271 AGGAAGAAGCTGTGGGAAGAGGG - Intergenic
992657538 5:78925183-78925205 ATGCAGAAACTGTGTTCCTATGG - Intronic
992709687 5:79438962-79438984 ATTAAGTAAATGTGTAAATATGG - Intronic
993391063 5:87319906-87319928 ATGAAGAGACGGTGTGAAATTGG - Intronic
993593298 5:89822951-89822973 GTGAAGACACAGTGAGAATATGG + Intergenic
993826580 5:92695094-92695116 ATGTAAAAATTGTGTGAACAAGG + Intergenic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
994336861 5:98576978-98577000 CTTAAGAAATTGTGTGAACAAGG + Intergenic
994799449 5:104353047-104353069 ATGAATAAAATCTGAGAATATGG + Intergenic
995082584 5:108071005-108071027 ATCAAGAAACTGTGTTTATTTGG - Intronic
995182641 5:109243476-109243498 TTGAAGATTCTGTGTGCATAAGG + Intergenic
995207397 5:109497009-109497031 ATGAAGAAACTGAGCTAAAAAGG - Intergenic
996058610 5:119008144-119008166 ATGAAGAAACAATGAGAAGATGG - Intergenic
996485383 5:124027497-124027519 GTGAGGACACTGTGTGAAGATGG + Intergenic
996970135 5:129357167-129357189 ATGGAGAATCAGTGTGTATAAGG - Intergenic
999248484 5:150167733-150167755 ATTAACTAACTGTGTGAACAGGG + Intronic
999590141 5:153135995-153136017 ATGAAGAAACTGAGTCCAGAAGG - Intergenic
999805257 5:155075042-155075064 ATAAATAAAATGTGTGAATTGGG - Intergenic
1000025356 5:157354429-157354451 ATTGAGAAAATGTGGGAATAGGG - Intronic
1000175501 5:158748533-158748555 AAGAAGACACTATGTGAAAATGG - Intronic
1000176263 5:158757699-158757721 ATGAAGAAACTGAGTCAAAGAGG - Intronic
1000358496 5:160424431-160424453 ATGATGAGACTGTCTGAATCTGG + Intronic
1000360854 5:160446012-160446034 ATGAAAAAAATGTATGCATAGGG + Intergenic
1002374456 5:178778349-178778371 ATGAATAACGAGTGTGAATAAGG - Intergenic
1002962741 6:1931832-1931854 ATCAATAAATTGTATGAATAGGG - Intronic
1003105609 6:3212899-3212921 GATAAGAAACTGTGAGAATAGGG + Intergenic
1004457386 6:15803658-15803680 ATGAACAAACTGTGTGCCTTTGG - Intergenic
1004706588 6:18129849-18129871 ATGGAGAAACCATGTGAAAAGGG + Exonic
1007177259 6:39905491-39905513 ATGAAGACACTGTGTGGGTAGGG - Exonic
1007688486 6:43681983-43682005 CTAAAGAAACTGTGTCAACACGG - Intronic
1007884117 6:45206167-45206189 ATGAAGAACATGTGTTAGTAAGG + Intronic
1008023458 6:46606589-46606611 ATAAAGAAACTGAGTGATTTGGG + Intronic
1008024705 6:46621874-46621896 TTGAAGAATCTATGTTAATAAGG - Intronic
1008384076 6:50867743-50867765 ATGGTGAATCTGTGTGAATATGG + Intergenic
1009314618 6:62202841-62202863 ATGAGACAACTGTGTGAAAAGGG + Intronic
1010066866 6:71692452-71692474 TTGAAGAAACTGTTTGAAGGTGG + Intergenic
1010694586 6:78954600-78954622 ATGAAGACACTGTAAGAATTGGG - Intronic
1010846418 6:80714272-80714294 ATGAACAAATTGTTTCAATATGG + Intergenic
1013117162 6:107112379-107112401 GTAAAGAAAATGTGTCAATATGG + Intronic
1013503389 6:110774367-110774389 ATTAAAAAACAGTGTGTATAGGG - Intronic
1013716236 6:112966699-112966721 CTGAAGAAGCTGTTTGACTAAGG - Intergenic
1014050078 6:116942041-116942063 ATGGAGAAACTGATTGAATTGGG - Intergenic
1015634432 6:135261907-135261929 ATGAAGAAACTAGGTGATTGTGG - Intergenic
1016531897 6:145067715-145067737 AATAATAAACTCTGTGAATAAGG + Intergenic
1016805580 6:148208819-148208841 ATATAGAAACTGACTGAATACGG + Intergenic
1016843908 6:148552323-148552345 ATGAAGAATCTGAGTCCATATGG + Intergenic
1017664289 6:156704264-156704286 AGGAAGAAATGCTGTGAATAGGG - Intergenic
1018621593 6:165734209-165734231 ATGAAGATACTGTATGAGTTTGG - Intronic
1018681715 6:166270689-166270711 ATGGAGAAACTGTGTGGGTGAGG - Intergenic
1020458372 7:8400141-8400163 ATGAAGATACTGTCTGGATTTGG + Intergenic
1020757056 7:12215779-12215801 TTAAAGAAACTCTGTGAAGAGGG + Intronic
1020894233 7:13919207-13919229 ATGAAGAAACTGGAGGCATAAGG + Intronic
1021403695 7:20238987-20239009 ATAATGAAACTGAGTGAATTAGG + Intergenic
1022829518 7:34051468-34051490 ATCTAGAAACTGTGGGAATTGGG - Intronic
1023597014 7:41840629-41840651 ATGAAGAAACTAAGGAAATACGG - Intergenic
1023685697 7:42733020-42733042 ATAAAGACACTGTGTCAATTAGG + Intergenic
1024428414 7:49257581-49257603 ATGAATGCACTTTGTGAATAAGG + Intergenic
1024642874 7:51345381-51345403 ATGAATAAACTATGTGTGTAGGG + Intergenic
1025634742 7:63312694-63312716 CTCAATAAAGTGTGTGAATAGGG + Intergenic
1026513046 7:71043412-71043434 ATGGAGACACTGAGTGATTAAGG + Intergenic
1027640988 7:80733689-80733711 ATGCAGAAACTGTCAGAACAAGG - Intergenic
1028340174 7:89708814-89708836 ATGAAAAAACTGTGGGATTTGGG - Intergenic
1028838829 7:95404085-95404107 ATGAAGAAACTGTATACATCAGG + Intergenic
1030858540 7:114592991-114593013 GCCAAGGAACTGTGTGAATACGG - Intronic
1031405820 7:121385594-121385616 ATCAAGCTACTATGTGAATAAGG + Intronic
1031617752 7:123901281-123901303 ATAAAGAAACTGTGTACACAAGG - Intergenic
1032332999 7:130997826-130997848 TTAAATAAACTCTGTGAATATGG - Intergenic
1032419556 7:131766916-131766938 ATGAAGAAACTGAGACAACAGGG + Intergenic
1032469812 7:132170136-132170158 GTGAAGAAACTGAGTCACTAAGG - Intronic
1032726591 7:134595234-134595256 AGAAAGAAACTGTGGGAAAAGGG + Intergenic
1036058325 8:5286117-5286139 ATGAAGAATGTGTGTGCAGATGG - Intergenic
1037640658 8:20739390-20739412 ATGAGGAAACTGAGTGTCTAAGG - Intergenic
1039914399 8:41849076-41849098 ATGACTAAACTGTGTGAACTTGG + Intronic
1041615907 8:59906845-59906867 ATGGAGAATCTGTGTGCTTAGGG + Intergenic
1041940492 8:63382015-63382037 ATCAGGAAGCTGTGTGAAGAGGG + Intergenic
1043632390 8:82352516-82352538 ATGTACTAACTGTGTGAATGTGG - Intergenic
1044216066 8:89612140-89612162 AAGAAGAAACCGAGAGAATAAGG + Intergenic
1046186096 8:110721545-110721567 ATGAAGATACAGTGAGAAAACGG - Intergenic
1046288038 8:112120865-112120887 ATGAAGAAGGGGTGTCAATAAGG - Intergenic
1046679393 8:117151760-117151782 ATGATAAAACTGTGTTAATAAGG - Intronic
1047486818 8:125338801-125338823 ATGATGAAACTGAATGATTATGG + Intronic
1050658701 9:7858802-7858824 ATAAAGAAACAGTGTGATTAGGG + Intronic
1051005862 9:12343219-12343241 ACTGTGAAACTGTGTGAATAAGG + Intergenic
1051019612 9:12526422-12526444 ATTAAAAAATTGTGTTAATAGGG + Intergenic
1051185323 9:14454259-14454281 ATGAGGAAAATGTATTAATAAGG + Intergenic
1051368216 9:16336167-16336189 ATGAAGAAGCTATCTGAAAAGGG + Intergenic
1051417442 9:16857096-16857118 ATGAATAAAATGTGTCAATTGGG + Intronic
1052206690 9:25849752-25849774 AGGAAACAACTGTGTTAATATGG + Intergenic
1052280566 9:26728771-26728793 CTGAAGAAACTGAGTTAATGTGG + Intergenic
1053637454 9:40026095-40026117 ATGAACAAAATATGTAAATAAGG - Intergenic
1053768626 9:41439146-41439168 ATGAACAAAATATGTAAATAAGG + Intergenic
1054318236 9:63622661-63622683 ATGAACAAAATATGTAAATAAGG - Intergenic
1054547295 9:66350626-66350648 ATGAACAAAATATGTAAATAAGG + Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1056872521 9:90296204-90296226 ATGAGGACATTATGTGAATAAGG - Intergenic
1058162859 9:101588689-101588711 CTGAAGAATATGTGTGCATATGG - Intronic
1058941471 9:109816604-109816626 TTCAGGAAACTGTGGGAATAGGG + Intronic
1059326356 9:113506263-113506285 ATGAAGAAACTTAGAGAAAAAGG + Intronic
1059384902 9:113956993-113957015 ATGAAGAAACTGAGTCACAAAGG + Intronic
1059754760 9:117282160-117282182 AAGAAGAAACTGAGAGAATGGGG - Intronic
1059827389 9:118046266-118046288 ATGAAGAGACTGTGTGACCCAGG - Intergenic
1059962448 9:119578523-119578545 ATGAAGAAACTGAGATTATAAGG + Intergenic
1062699972 9:137894031-137894053 ATGAAGCAAATGGGTGAAAAAGG - Intronic
1203421797 Un_GL000195v1:6-28 CTTAAGAAACTGTGTGAACGAGG - Intergenic
1203735324 Un_GL000216v2:133167-133189 AAAAAGAAACTGTGTGAACAAGG - Intergenic
1186797804 X:13063537-13063559 AAGGAGAAAATGTGGGAATAAGG + Intergenic
1187068958 X:15868946-15868968 ATGAAGACACAGTGAGAAGATGG - Intergenic
1188618581 X:32191446-32191468 ATGAAGGAACAGCGAGAATAAGG + Intronic
1189342920 X:40218311-40218333 ATGTAGAAAATGTCTGAATCTGG - Intergenic
1189378081 X:40481220-40481242 ATGAAGAATTTGTGGGAAGATGG - Intergenic
1189445519 X:41077104-41077126 ATGAAGAACCTCTGGGAAAAGGG - Intergenic
1190589011 X:51978408-51978430 ATGGAGAATATGTGTGAAAAGGG + Intergenic
1192511869 X:71725448-71725470 ATGAAGCAAATGTGAGAAAATGG - Intergenic
1192514828 X:71756057-71756079 ATGAAGCAAATGTGAGAAAATGG + Intergenic
1193772466 X:85604338-85604360 ATGAAGAAAGTATGTCAAAAAGG - Intergenic
1194138906 X:90182878-90182900 CTGAAGAAAATGTTTAAATAAGG + Intergenic
1195981972 X:110588683-110588705 ATGAAGAAACTATCTAAATTTGG + Intergenic
1196713038 X:118783256-118783278 ATGAAGAAAATCAGTGATTAGGG - Intronic
1196846304 X:119899189-119899211 AGAAAGAAAATGTGAGAATAGGG + Intronic
1197424649 X:126280860-126280882 ATGAAGAAACTGAGACAAAAAGG - Intergenic
1197788430 X:130224239-130224261 GTGAAGACACAGTGAGAATATGG + Intronic
1198847937 X:140932731-140932753 AGGTAGAAACTGTTTGAATTTGG + Intergenic
1200343186 X:155421675-155421697 ATCAAGAAAATGTGTGAGAATGG - Intergenic
1200484708 Y:3753111-3753133 CTGAAGAAAATGTTTAAATAAGG + Intergenic
1201491776 Y:14549603-14549625 ATGAATAAATTGTGTGGAGATGG - Intronic
1202625692 Y:56855240-56855262 AAAAAGAAACTGTGTGAACAAGG + Intergenic