ID: 929674498

View in Genome Browser
Species Human (GRCh38)
Location 2:43911975-43911997
Sequence ATCATACGGAAGAAGAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929674498 Original CRISPR ATCATACGGAAGAAGAACTA AGG Intronic
904931558 1:34091403-34091425 ATTTTACAGACGAAGAACTAAGG + Intronic
906040293 1:42783961-42783983 ATCCTACAGAAGAGGAAGTAGGG - Intronic
909803245 1:79841353-79841375 ATTATACAAAAGAAAAACTAAGG + Intergenic
911077131 1:93887387-93887409 AACCTAGGGAAAAAGAACTATGG - Exonic
913168180 1:116208735-116208757 CTCATATGGAAGAAGAAGGAAGG + Intergenic
916258322 1:162813494-162813516 AACATATGGAGGAAGAAATAAGG - Intergenic
916635610 1:166664767-166664789 ATCAAGCTGAAGAAGAAATATGG + Intergenic
917345330 1:174022756-174022778 ATAATATGGAAGAAGAAAAATGG - Intergenic
917428674 1:174942578-174942600 ATTTTACAGAAGAAGAACAAAGG - Intronic
918434638 1:184498943-184498965 ATCATAAAGAAAAGGAACTAAGG - Intronic
920456227 1:206103592-206103614 ATCTTGGGGAAGAAGAACTCAGG - Intergenic
921012990 1:211161444-211161466 AGCATACTGAAGAAGCCCTAAGG - Intergenic
921462256 1:215443464-215443486 TTCATAAGGAAGGAGAAATAAGG - Intergenic
921495898 1:215841241-215841263 ATCATAAGCAAAAAGAACAAAGG + Intronic
1063828127 10:9921602-9921624 AAAATAGGGAAAAAGAACTAAGG - Intergenic
1066724768 10:38379178-38379200 AACATATGGAGGAAGAAATAAGG - Intergenic
1069763037 10:70828619-70828641 TTCATACTCAAAAAGAACTAAGG - Intronic
1070286516 10:75087613-75087635 ATCATACGGATCAAGAAGCACGG + Intergenic
1075000842 10:118796093-118796115 ATCCTAAGGAAAAAGAACAAAGG + Intergenic
1075681326 10:124334908-124334930 ATCAAAAGGAAGAAGAAATTTGG + Intergenic
1075977580 10:126708943-126708965 ATCATACGCAAGATGAACATTGG - Intergenic
1078156242 11:8802469-8802491 ATTTTACGGAAGAGGAACCAGGG + Intronic
1078243149 11:9548815-9548837 ATCATACAGCAGGAAAACTATGG + Intergenic
1078460703 11:11513221-11513243 ATATTACAGAAGAAGAACTGAGG - Intronic
1078956758 11:16206443-16206465 ATCAGACTGAGGAAGAAGTATGG + Intronic
1080282219 11:30570253-30570275 CTCATATGAAAGAAGAACAAGGG + Intronic
1082017339 11:47500517-47500539 ATAATAATGAAAAAGAACTAGGG + Intronic
1083103852 11:60337874-60337896 ATCATAAGAAAGAAGAAGTCTGG - Exonic
1085128973 11:74021488-74021510 AGCATATAGAAGAAGAAGTAGGG + Intronic
1086073287 11:82822429-82822451 ATCATGGGGAACTAGAACTAGGG - Intergenic
1086148675 11:83583670-83583692 ATCGTCCAGAAGAAGAACTGAGG - Intronic
1093228049 12:16509315-16509337 ATGAAAAGGAAGAAGAAATATGG - Intronic
1094274099 12:28649542-28649564 ATAAGACGGAAGAAGCACTCTGG - Intergenic
1094294428 12:28888522-28888544 TTCATATGGAAAATGAACTAGGG + Intergenic
1095643480 12:44512769-44512791 ATCTTATAGAAGAAGAATTATGG + Intronic
1098380593 12:69865501-69865523 ATCTTGGGGAAGAAGAATTATGG + Intronic
1098601922 12:72341435-72341457 ATCAGACTTAAGAAGAAATATGG - Intronic
1099161586 12:79248510-79248532 ATCAAAAGGAAGGAGAAGTATGG + Intronic
1103202780 12:119102216-119102238 GTCCTACAGAAGAAGAAATAAGG - Exonic
1113161592 13:107387819-107387841 ATCATACTGAAGAATGACTTAGG - Intronic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1115759995 14:36570500-36570522 AACTTCCAGAAGAAGAACTATGG - Intergenic
1116068739 14:40015784-40015806 ATAAAACTGAGGAAGAACTAGGG - Intergenic
1116075406 14:40104403-40104425 ATCGTAAGGAAAAAGAACAAAGG + Intergenic
1117937984 14:60928629-60928651 ATCATACCAAAGAAGATATATGG - Intronic
1118924508 14:70179842-70179864 ATCATACAGAAGAAGAAATTGGG + Intronic
1120019293 14:79510203-79510225 TTCTTAAGGAAGAAGATCTAGGG + Intronic
1120155908 14:81093052-81093074 ATTCTACAGAAGAAGAACTGGGG + Intronic
1120259021 14:82159190-82159212 ATATTACGGAAGAACAAATAAGG + Intergenic
1120666682 14:87314670-87314692 GCCATAGGGAAGAAGTACTATGG + Intergenic
1121506355 14:94480427-94480449 ATCATACAGATGCAAAACTAAGG + Intergenic
1125061017 15:35424005-35424027 ATCTTTAGGAAGAAGAACAAAGG - Intronic
1128434528 15:67632841-67632863 GTGATATGGAAGAAGAACTCTGG - Intronic
1130772925 15:86943247-86943269 ATGATAAGGAAGAAGAAAAATGG + Intronic
1133707421 16:8368215-8368237 ATCAGACAGATGAAGAACTGGGG + Intergenic
1133850164 16:9495957-9495979 AGGATCAGGAAGAAGAACTAAGG - Intergenic
1141728374 16:85805843-85805865 ATCATGTGGCAGAAGCACTATGG + Exonic
1147636664 17:41968104-41968126 ATCTTGCGGAAGAAGATCTTGGG - Exonic
1155396862 18:25395101-25395123 ATCATACAGAGGAACAAATATGG + Intergenic
1157998656 18:52590253-52590275 ATCATACAGAATGAGATCTAAGG + Intronic
1164036209 19:21457935-21457957 ATCCTACAGAAGCAGAACGAAGG + Intronic
1166584123 19:43930178-43930200 TTCATATGGCAGAAGAACAAGGG + Intronic
1168133102 19:54333372-54333394 ATCATAGGGAAGAAAAACGAAGG + Exonic
925593653 2:5534392-5534414 ATTATAAGGAAGAAGAAACAAGG + Intergenic
927609737 2:24525874-24525896 AACATAAGGAAGCAGACCTAAGG - Intronic
928037943 2:27843781-27843803 ATCAAACAGAAACAGAACTAAGG + Intronic
928105047 2:28464872-28464894 ATCTTATGGAAGAGGCACTAAGG + Intronic
928721322 2:34124998-34125020 ATCAGTCCCAAGAAGAACTATGG + Intergenic
929674498 2:43911975-43911997 ATCATACGGAAGAAGAACTAAGG + Intronic
933719595 2:85389573-85389595 ATCTTACAGATGAGGAACTAAGG - Intronic
936583556 2:113729292-113729314 ATCATACGGAAGAAAAAAAAAGG + Intronic
940409941 2:153349886-153349908 ATCATTCAAAAGAAGAATTAGGG - Intergenic
941552339 2:166932985-166933007 ACAATCCTGAAGAAGAACTAGGG - Intronic
941552414 2:166933717-166933739 ACAATCCTGAAGAAGAACTAGGG + Intronic
941724729 2:168849165-168849187 ACCATAGGGAAGAAGAAAGATGG - Intronic
942782017 2:179654916-179654938 ATCATACTGCAAAAGGACTATGG - Intronic
943351131 2:186797665-186797687 ATCCTACGAAAAAAGAACAATGG + Intergenic
943429449 2:187779901-187779923 ATCATAAGGAATAAAAACTGTGG - Intergenic
944921770 2:204421512-204421534 ATCAAGCTGAAGAAAAACTAAGG - Intergenic
946464053 2:219895884-219895906 CTCAAGCGGAGGAAGAACTAAGG + Intergenic
949066199 2:241991865-241991887 ATCAAATGTAAAAAGAACTAAGG - Intergenic
1169094735 20:2887026-2887048 ATCCAAAGGAAGAAGCACTATGG - Intronic
1170438997 20:16358771-16358793 ATTTTACTGAGGAAGAACTATGG + Intronic
1171446269 20:25206880-25206902 ATCCTACAGAAGAGGAACTGAGG - Intronic
1173885592 20:46455894-46455916 ATCATAGGGCAGAAACACTAAGG - Intergenic
1176687655 21:9865544-9865566 AGGATACAGAAGAAGAACAAAGG - Intergenic
953600434 3:44358243-44358265 ATCATAAGGAAAAATCACTAGGG - Intronic
957241751 3:77669268-77669290 ATGAGACTGAAGTAGAACTACGG + Intergenic
957470868 3:80655898-80655920 CTCATACGGAAGCTGGACTAGGG + Intergenic
957860146 3:85937425-85937447 ATTTTACGGAAGAGAAACTAAGG + Intronic
958182763 3:90082013-90082035 ATCATACAGGAAAAGAACAAGGG + Intergenic
960258374 3:115535380-115535402 ATCATACGGAAGACGAAGAGGGG + Intergenic
962994252 3:140609921-140609943 ATCCTAAGCAAAAAGAACTAAGG + Intergenic
966699254 3:182827331-182827353 AACATACTGAAGAAGCACTTAGG - Intronic
969358297 4:6644651-6644673 ATCATAAAAAAGAGGAACTAAGG - Intergenic
971155559 4:24077998-24078020 ATCATAAAGAACAGGAACTATGG - Intergenic
971851407 4:31990275-31990297 ATCAAACGGATGAAAAACTAAGG + Intergenic
974178286 4:58353174-58353196 ATTATACTGAAAGAGAACTAGGG + Intergenic
976817998 4:89173098-89173120 ATTTTACTGACGAAGAACTATGG - Intergenic
978188943 4:105891385-105891407 ATCATAAGAAAGATGAACTCAGG + Intronic
980351008 4:131683360-131683382 AGGATACAGAAGAAGAACAAAGG - Intergenic
981252314 4:142617969-142617991 ATCATACTTAAGAAGCATTATGG + Intronic
981497895 4:145413991-145414013 AACAAACTGAAGAAGAGCTATGG + Intergenic
983662225 4:170140494-170140516 ATCACACAGAGGAAGAATTATGG + Intergenic
985434184 4:189913151-189913173 ATCCTACGGAAGCAGATCTTGGG + Intergenic
986246210 5:6009248-6009270 AGAATAAGGAAGATGAACTAAGG - Intergenic
986754055 5:10817955-10817977 ATCATCAGGAAGAATAGCTAAGG + Intergenic
989382489 5:40822963-40822985 TTCATATGGCAGAAGAACGAAGG - Intergenic
996249820 5:121316153-121316175 TTCATAAGGAAGGAGAAATAAGG - Intergenic
996579062 5:125009862-125009884 ATCATACATAATAAGAATTAAGG - Intergenic
1000302210 5:159966392-159966414 ATCTTACTGATGAGGAACTAAGG + Intronic
1006335580 6:33418859-33418881 ATCAGAGGGAAGGAGAACGAGGG + Intergenic
1007050034 6:38817761-38817783 ATCAGAGGCAAGAAGAGCTAGGG + Intronic
1016916049 6:149245468-149245490 ATCAAAAGGAAGAAGAAACAAGG - Intronic
1019792138 7:3022268-3022290 ATGATACAGAGGAAGAACAATGG + Intronic
1020058090 7:5132453-5132475 AGAATAGAGAAGAAGAACTATGG - Intergenic
1021025079 7:15656781-15656803 ATCAAAAGGAAAAAGAACAATGG - Intronic
1023288213 7:38641819-38641841 ATGATACGGAAAAAAAACTGAGG + Intergenic
1023601505 7:41885757-41885779 ATCATAAGGAAGAAGCAATTTGG + Intergenic
1026384408 7:69831789-69831811 ATCCTAAGGGAGAAGAATTAGGG - Intronic
1026518811 7:71097177-71097199 ATCTTATGGAAGCAGATCTATGG + Intergenic
1029176076 7:98665350-98665372 ATCATAATGATGATGAACTATGG - Intergenic
1032498705 7:132383002-132383024 ATGATACAGAAGAAGTACAAAGG - Intronic
1035340949 7:158161265-158161287 ACAATACTGAAGAAGAACAAAGG + Intronic
1036010552 8:4717130-4717152 ATCATTAGGAAAAAAAACTAGGG + Intronic
1037771791 8:21805501-21805523 GTCATGCAGAATAAGAACTAAGG + Intronic
1043636058 8:82383567-82383589 GGCATACTGAAGAAGAACTGTGG + Intergenic
1044765494 8:95568577-95568599 ATCTTAAGCAAGAAGAACAAAGG - Intergenic
1048777022 8:137958291-137958313 CTCATACTGAAGAAGATTTAAGG + Intergenic
1048855114 8:138680332-138680354 TTCATACGGAAAAGGAACTGAGG + Intronic
1050267999 9:3911290-3911312 AACATATGGAAAAAGATCTAAGG - Intronic
1051366138 9:16322842-16322864 ATAATACATAAGAAGAACTTAGG + Intergenic
1051581267 9:18677917-18677939 TTCATTCGTAAGAAGAATTAAGG + Intronic
1053781701 9:41616355-41616377 AGGATACAGAAGAAGAACAAAGG + Intergenic
1054169649 9:61826509-61826531 AGGATACAGAAGAAGAACAAAGG + Intergenic
1054667889 9:67754306-67754328 AGGATACAGAAGAAGAACAAAGG - Intergenic
1055590757 9:77811388-77811410 AACATACTGAAGATGCACTAGGG + Intronic
1059777728 9:117492657-117492679 CTCATAGGGATGAAGAACAATGG - Intergenic
1060123300 9:121017286-121017308 AGGATATGGAGGAAGAACTAAGG - Intronic
1188125486 X:26363114-26363136 AACATAAGGAAGGAGAACCAAGG - Intergenic
1197948398 X:131865952-131865974 ATAATACTGAAGAAGAACAAAGG - Intergenic
1198142716 X:133821281-133821303 ATCAGAAGGAAAAAGAACTTTGG + Intronic
1198721035 X:139620911-139620933 ATCATAAGCAAAAAGAACAAGGG + Intronic
1199667862 X:150115601-150115623 AACATACTGAAGTAGAAGTATGG + Intergenic