ID: 929675302

View in Genome Browser
Species Human (GRCh38)
Location 2:43920842-43920864
Sequence CTAAACAATAAAAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 0, 2: 2, 3: 71, 4: 760}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929675294_929675302 29 Left 929675294 2:43920790-43920812 CCAACAGCTAGACACAATACTGC 0: 1
1: 0
2: 0
3: 10
4: 138
Right 929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG 0: 1
1: 0
2: 2
3: 71
4: 760
929675298_929675302 0 Left 929675298 2:43920819-43920841 CCTTTAAAAAGGGATTAGTTATT 0: 1
1: 0
2: 3
3: 31
4: 380
Right 929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG 0: 1
1: 0
2: 2
3: 71
4: 760

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929675302 Original CRISPR CTAAACAATAAAAAGGTGGG TGG Intronic
900378149 1:2369056-2369078 CAAAAAAAAAAAAAGGCGGGGGG + Intronic
900546778 1:3233891-3233913 TAAAAAAAAAAAAAGGTGGGGGG + Intronic
901043000 1:6376880-6376902 ATAAATAATAATAAGGTGGGAGG + Intronic
901376246 1:8841616-8841638 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
901609287 1:10484332-10484354 CTAAACAAAAAAAAATTGGCTGG - Intronic
901867714 1:12118109-12118131 CTCAAAAAGAAAAGGGTGGGGGG - Intronic
902189270 1:14750006-14750028 ATGACCAAAAAAAAGGTGGGGGG + Intronic
902314601 1:15608676-15608698 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
902371096 1:16007251-16007273 AAAAAAAAAAAAAAGGTGGGGGG + Exonic
902671813 1:17979921-17979943 TTAGACAATAATAAGGGGGGAGG + Intergenic
903428813 1:23275590-23275612 ACAAAAAACAAAAAGGTGGGGGG + Intergenic
903432181 1:23314244-23314266 TTAAATAATAAAAGGGTGGAGGG + Intronic
903572085 1:24313425-24313447 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
903943632 1:26948444-26948466 CGGAACAATAAAAAGGGCGGTGG + Intergenic
903999246 1:27329198-27329220 AAAAAAAAAAAAAAGGTGGGCGG - Intronic
904228211 1:29042765-29042787 CCAAAAAAAAAAAAGTTGGGGGG - Intronic
904244356 1:29175954-29175976 CTTAAAAACAAAAAGGTGGCCGG + Intronic
904642433 1:31940538-31940560 CAAAAAAAAAAAAAGGGGGGGGG - Intronic
904736300 1:32636694-32636716 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
904891647 1:33783940-33783962 CTATACTATAAAAAGGTGGGTGG + Intronic
904891720 1:33784356-33784378 CTCTACTATAAAAAGGTGGGTGG - Intronic
905142262 1:35856817-35856839 CTCAAAAAAAAAAAGGGGGGGGG + Exonic
905436258 1:37957381-37957403 CAAAAAAAAAAAAAGGGGGGGGG - Exonic
906361237 1:45161590-45161612 CTAGCCAAAAAAAATGTGGGGGG - Intronic
907091700 1:51731048-51731070 CACAAAAAAAAAAAGGTGGGGGG - Intronic
907183656 1:52592141-52592163 AAAAAAAAAAAAAAGGTGGGAGG - Intergenic
907288612 1:53397950-53397972 TCAAACAAAAAAAAGGTGGGGGG + Intergenic
907352323 1:53842711-53842733 CTAAAAAATATAAAGGGTGGTGG + Intergenic
907698941 1:56764514-56764536 CTAAAAAATAAAAAGGTCAGTGG - Intronic
907962863 1:59298807-59298829 CTCCATTATAAAAAGGTGGGCGG - Intronic
908632602 1:66126100-66126122 CTTAACAATACAATGTTGGGTGG - Intronic
908696092 1:66843199-66843221 CAAAAAAAAAAAAAGGTGGGGGG + Intronic
909187160 1:72502523-72502545 TTAAACAATACAAAGGTTAGGGG - Intergenic
909484126 1:76155009-76155031 ATAAAAAATAAAAAGATTGGTGG - Intronic
909907057 1:81209869-81209891 CTTAAAAAAAAAAAGGTGGCTGG - Intergenic
910402062 1:86847356-86847378 CTCAAAAAAAAAAAGGTGTGTGG - Intergenic
910808205 1:91209828-91209850 TTAGAAAAAAAAAAGGTGGGGGG - Intergenic
910957810 1:92725763-92725785 ATAACCAATAATGAGGTGGGGGG + Intronic
910988191 1:93027002-93027024 TTAAAAAAAAAAAAAGTGGGAGG + Intergenic
911187596 1:94919044-94919066 CTAAAGAAGAAAAAGAAGGGGGG + Intronic
912203706 1:107486718-107486740 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
912922581 1:113883481-113883503 CAAAAAAAAAAAAAGGCGGGCGG + Intronic
913440204 1:118888913-118888935 GAAAAAAAAAAAAAGGTGGGGGG + Intronic
914049825 1:144122399-144122421 CTAAACCATAAGAGGGAGGGAGG + Intergenic
914229799 1:145755235-145755257 CTCAAAAAAAAAAAGGTGGGGGG + Intronic
914516316 1:148377828-148377850 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
915388508 1:155519136-155519158 ATAAAAAATAAAATGGTGGCTGG + Intronic
915818506 1:158996035-158996057 CTAAACCATAAAAGGGAGGTAGG + Intergenic
916751162 1:167723954-167723976 CTTAACACTTAAAAGGTGGGAGG + Intronic
917258163 1:173138891-173138913 ATCAACAATAACAAGGTGGAGGG + Intergenic
917341276 1:173980262-173980284 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
917427209 1:174927072-174927094 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
917952638 1:180056468-180056490 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
918448847 1:184640146-184640168 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
919028773 1:192211750-192211772 CTCAACAATAAAAAATTGGATGG + Intergenic
919652664 1:200165534-200165556 GGAGACAATAAAAAGATGGGTGG - Intronic
920450153 1:206054126-206054148 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
920903907 1:210140936-210140958 AAAAACAATAACAAGGTTGGAGG - Intronic
922450731 1:225735199-225735221 CTAAAAAAAAAAAAAGTAGGGGG + Intergenic
923066078 1:230518536-230518558 CTAAACCATCAAAAGGAGGAAGG - Intergenic
923184776 1:231560410-231560432 CAAAAAAAAAAAAAGGGGGGGGG - Intronic
923551400 1:234967103-234967125 CTCAAAAAAAAAAAGATGGGGGG + Intergenic
923878962 1:238083043-238083065 ATAAAAAATTAAAAGGTGGGAGG - Intergenic
923885183 1:238146592-238146614 TTAAGCAATAAAAAGGGAGGAGG - Intergenic
1063260059 10:4377899-4377921 CTAAACAAAAAAAAAGGCGGGGG - Intergenic
1063857253 10:10269046-10269068 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1064212887 10:13375456-13375478 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1064672980 10:17734533-17734555 CAAAACAAAAAAATGTTGGGAGG + Intergenic
1065352339 10:24806824-24806846 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
1065397368 10:25253333-25253355 CTAAAGAATAAATTGGGGGGAGG - Intronic
1065491788 10:26289785-26289807 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1065684525 10:28270519-28270541 TTAAAAAAAAAAAAGGGGGGGGG + Intronic
1065722705 10:28642050-28642072 ATAAAAAAGAAAAAGATGGGAGG + Intergenic
1065860058 10:29864890-29864912 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1066339891 10:34521370-34521392 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1066500412 10:35988134-35988156 CAAAAAAAAAAAAATGTGGGAGG - Intergenic
1067186647 10:44034739-44034761 CTCTACAACAAAAAGGTGCGAGG - Intergenic
1067491938 10:46716445-46716467 CTTAAAAGTAAAAAGGTGGCCGG - Intergenic
1067602720 10:47623938-47623960 CTTAAAAGTAAAAAGGTGGCCGG + Intergenic
1068048628 10:51919668-51919690 CTTTAAAAAAAAAAGGTGGGGGG - Intronic
1068246741 10:54381560-54381582 GTTAAAAATAAAAAGATGGGAGG + Intronic
1068837828 10:61573624-61573646 AAAAATAATGAAAAGGTGGGGGG + Intergenic
1069452902 10:68531471-68531493 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1069510202 10:69036426-69036448 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
1069615672 10:69804642-69804664 CAAAAAAAAAAAAAGGTGGCAGG - Intronic
1069666032 10:70159526-70159548 CTCTACAAAAAACAGGTGGGAGG + Intronic
1070081805 10:73196315-73196337 CAAAAAAAAAAAAGGGTGGGGGG - Intronic
1070422859 10:76254561-76254583 TTAAAAAATAAAAAGATTGGTGG - Intronic
1071226226 10:83531464-83531486 CTAAAAAATAAAAGGGGGGGTGG + Intergenic
1071502355 10:86212889-86212911 CAAAACCATAAAATGGTGGGGGG + Intronic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071654079 10:87429353-87429375 CTTAAAAGTAAAAAGGTGGCCGG + Intergenic
1071753560 10:88509709-88509731 GCACATAATAAAAAGGTGGGTGG + Intronic
1072237003 10:93462087-93462109 CAAAAAAAAAAAAAGGTGGGGGG - Intronic
1072380239 10:94860461-94860483 CCAAAAAATAAATAAGTGGGGGG + Intergenic
1072522703 10:96242523-96242545 GTGACCAATAAATAGGTGGGTGG + Intronic
1073357876 10:102871251-102871273 CAAAACAAAAAAAAGGCCGGGGG + Intronic
1074383374 10:112997993-112998015 AAAAACAAAAAAAAGGTGTGGGG + Intronic
1074850870 10:117438729-117438751 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1074852489 10:117449847-117449869 CTAAACAGGAAAAAGGAGGAAGG + Intergenic
1075049698 10:119174034-119174056 CCTAAAAATAAAAAGGTGAGGGG - Intronic
1075769372 10:124919913-124919935 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
1075785561 10:125047801-125047823 CTAAATAATTAAAAGTTAGGAGG - Intronic
1076225979 10:128775727-128775749 CTGAACTGTAATAAGGTGGGAGG - Intergenic
1077580195 11:3412570-3412592 AAAAAAAAAAAAAAGGTGGGTGG + Intergenic
1077801251 11:5539977-5539999 ATAAACCATAAAAATGTGGGAGG + Intronic
1078158160 11:8816553-8816575 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1078280557 11:9896788-9896810 CAAAAAAAAAAAAAGGGGGGTGG + Intronic
1078753665 11:14188370-14188392 CTATACAATGAAGAGGTGGCAGG + Intronic
1079922237 11:26447215-26447237 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1080024144 11:27596152-27596174 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1080717159 11:34814277-34814299 ATAAAAAATCAAAATGTGGGGGG + Intergenic
1081899017 11:46611711-46611733 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1082038441 11:47664868-47664890 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
1082643851 11:55697678-55697700 CCAAACAGTAAAAATGGGGGGGG + Intergenic
1083361694 11:62113118-62113140 CTAAAGAAAAAAAAGGGGGACGG - Intergenic
1083607772 11:63989018-63989040 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1084099456 11:66936251-66936273 ACACACAAAAAAAAGGTGGGGGG + Intronic
1084237118 11:67795393-67795415 AAAAAAAAAAAAAAGGTGGGTGG + Intergenic
1084598178 11:70129620-70129642 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
1085079354 11:73621246-73621268 CAAAAAAAAAAAAAAGTGGGGGG + Intergenic
1085225156 11:74913283-74913305 CTAAAGATTAAAAAGATGGAAGG + Intronic
1085363076 11:75910490-75910512 CTTAAAAAAAAAAAAGTGGGGGG - Intronic
1085560011 11:77462969-77462991 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1086127168 11:83360797-83360819 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1086300915 11:85425634-85425656 CTAAACAAGAAAAAAATCGGGGG + Intronic
1086576533 11:88344619-88344641 TTAAACCATAAAAAGGAGGCTGG + Intergenic
1087326674 11:96732335-96732357 ACAAAGAATAGAAAGGTGGGAGG - Intergenic
1087484418 11:98744015-98744037 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1087831433 11:102823414-102823436 TACAACAATCAAAAGGTGGGAGG - Intergenic
1088249717 11:107852108-107852130 CTAGACAATAACAAGGAGTGTGG + Intronic
1088250985 11:107860689-107860711 ATTAAAAAAAAAAAGGTGGGAGG - Intronic
1088637699 11:111839588-111839610 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1089099921 11:115954014-115954036 TTAAAAAAAAAAAAGGAGGGGGG + Intergenic
1090177043 11:124659635-124659657 TTAAAAAAAAAAAAGGGGGGGGG + Intronic
1090712107 11:129396384-129396406 CAAAAAAAAAAAAAGGTGAGTGG - Intronic
1091044040 11:132310061-132310083 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1092782200 12:11997506-11997528 CTGAACAAAAAAACGTTGGGAGG + Intergenic
1092944955 12:13444399-13444421 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1092994606 12:13937083-13937105 ATAAAAAAAAAAAAGGGGGGGGG + Intronic
1093207433 12:16267725-16267747 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1093269738 12:17045389-17045411 CAAAAGAATAAAAAGGAGGTAGG + Intergenic
1093445080 12:19247754-19247776 TTAAAAAAAAAAAAGGTAGGGGG + Intronic
1096207595 12:49735992-49736014 CTAAGGAATAAAAGGGGGGGGGG + Intronic
1096257053 12:50069588-50069610 CTAAAGAATAAAGAGGAGGCTGG - Intronic
1096316996 12:50576474-50576496 AAAAAGAAAAAAAAGGTGGGGGG - Intronic
1096432340 12:51557044-51557066 CTAAAAAATACAAAAGTGGCTGG + Intergenic
1096884418 12:54702073-54702095 CAAGATAATAAAAGGGTGGGTGG - Intergenic
1097541204 12:60945870-60945892 ATAAACAAAAAAAAGGAGAGTGG + Intergenic
1097730048 12:63118383-63118405 CTCAACAATTAAAGGGAGGGGGG - Intergenic
1097793132 12:63835615-63835637 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1097997681 12:65907418-65907440 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1098085138 12:66834185-66834207 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1098346905 12:69514831-69514853 CAAAAAAAAAAAAAGATGGGTGG + Intronic
1098513838 12:71350820-71350842 CGAAAAAAAAAAAAGGTAGGGGG + Intronic
1099270919 12:80509940-80509962 CTAGACAATAAAAAAGAGGTGGG - Intronic
1099671739 12:85702676-85702698 CTTAACAATAAAAGGATAGGTGG + Intergenic
1100710122 12:97246947-97246969 TTAAAAAATAAAAAATTGGGAGG + Intergenic
1101161943 12:101986474-101986496 CCAAACAATAAAACAGTTGGGGG + Intronic
1102839067 12:116098277-116098299 CAAAAACATAAAAATGTGGGGGG + Intronic
1103290302 12:119840154-119840176 CAAAAAATTAAAAAGGTGGCAGG + Intronic
1103326481 12:120124746-120124768 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1103438658 12:120946831-120946853 CAAAAAAAAAAAAAGGGGGGGGG + Intergenic
1103552238 12:121746183-121746205 CAAAAAAAAAAAAAAGTGGGGGG - Intronic
1103746521 12:123128451-123128473 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1104318016 12:127722070-127722092 CTAAAAAACAAAAAAGAGGGTGG + Intergenic
1105683448 13:22752815-22752837 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
1105757370 13:23480428-23480450 CTAAACAAACAAAAGCTGAGAGG - Intergenic
1106250943 13:27981067-27981089 CCTAACAAGAAAAAGGTGTGAGG + Intronic
1106745292 13:32697986-32698008 CCAAACTATAAAAAGGTGATAGG - Intronic
1106841718 13:33691372-33691394 CTGGACAATAAAAAGTTGAGGGG - Intergenic
1107420510 13:40241857-40241879 CTAAAAAAAAAAAAAGGGGGTGG - Intergenic
1107512237 13:41096370-41096392 CTCAAAAAAAAAAAGGAGGGGGG - Intergenic
1108006620 13:45953719-45953741 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1108071710 13:46635459-46635481 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
1108094304 13:46884419-46884441 CTAAACAAATCCAAGGTGGGCGG + Intronic
1108518976 13:51227893-51227915 CTAGACTTTAAATAGGTGGGTGG + Intronic
1108639799 13:52372457-52372479 CTAAAAAATAAGAAGTTTGGAGG - Intergenic
1108819880 13:54335743-54335765 ATAAAAAAAAAAAAAGTGGGGGG - Intergenic
1109612879 13:64789641-64789663 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1109648023 13:65285706-65285728 CTAAAAAAAAAAGAGTTGGGTGG + Intergenic
1109674362 13:65654486-65654508 CTAAAGAAAAAAAATGTGGTTGG + Intergenic
1109996073 13:70128850-70128872 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1110987282 13:81986349-81986371 GGAAAGAAAAAAAAGGTGGGAGG + Intergenic
1111379655 13:87431392-87431414 CTAAAGAAAAACAAGGTGGAAGG + Intergenic
1111457204 13:88500030-88500052 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1111659176 13:91188211-91188233 AAAAAGAATAAAACGGTGGGGGG + Intergenic
1112037455 13:95509919-95509941 GTAAACATTTAAAAGGTGGTGGG + Intronic
1112302805 13:98245936-98245958 CTAAAATATAAAAAGTTGGCTGG - Intronic
1112809915 13:103206075-103206097 TTAAAAAAAAAAAATGTGGGGGG - Intergenic
1112901289 13:104360983-104361005 CAAAACATTAAAAAGCAGGGGGG - Intergenic
1113549219 13:111178960-111178982 CAAAACAAAAAAAAAGGGGGGGG - Intronic
1114175205 14:20312378-20312400 CTACAAAAAAAAAAGGTGGGGGG - Intronic
1114189962 14:20433272-20433294 CTTCATAATAAAAAGGTGGGGGG + Intronic
1114477931 14:23010763-23010785 ATAAATAACAAATAGGTGGGTGG - Intergenic
1115425085 14:33249342-33249364 GAAAAAAAAAAAAAGGTGGGGGG - Intronic
1115650413 14:35398974-35398996 ACACACAAAAAAAAGGTGGGGGG + Intergenic
1116030203 14:39562087-39562109 CTAAAAAATAAAAAAGTGTGGGG - Intergenic
1116055847 14:39862832-39862854 AAAAAAAAAAAAAAGGTGGGAGG - Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116176592 14:41478802-41478824 CTAAAGAAGAATAAGGTGGAAGG - Intergenic
1116343590 14:43758356-43758378 TTGGACAATAAAAAGGCGGGAGG + Intergenic
1116358626 14:43963658-43963680 ATAAAAAATAAAAAGGGAGGGGG + Intergenic
1116896258 14:50317770-50317792 CCAAAAAAAAAAAAGGGGGGTGG + Intronic
1116993459 14:51299205-51299227 TTAAAAAAAAAAAAGGTAGGGGG - Intergenic
1117218989 14:53582337-53582359 CAAAAAAAAAAAAAGGCGGGGGG - Intergenic
1117239865 14:53819380-53819402 CTGAAGAATAAAGAGCTGGGTGG - Intergenic
1117990947 14:61432908-61432930 CTTAATAAAAAAAAAGTGGGGGG + Intronic
1118407001 14:65434779-65434801 TAAAAGAAAAAAAAGGTGGGGGG - Intronic
1118712339 14:68531430-68531452 CTAACCAAAAGAAAGGTGGGTGG + Intronic
1118778957 14:68993377-68993399 TCAAAAAAGAAAAAGGTGGGAGG + Intergenic
1119018816 14:71087825-71087847 TTAAAAAATAAAAAGGTTGAGGG + Intronic
1119064257 14:71510169-71510191 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1119119440 14:72060363-72060385 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
1119228311 14:72960874-72960896 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1119807543 14:77491992-77492014 TAAAAAAAAAAAAAGGTGGGGGG - Intronic
1120114431 14:80596829-80596851 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1120604736 14:86560372-86560394 CTAAAAAAGAAAAATGTGAGTGG - Intergenic
1120714426 14:87824883-87824905 CTCAAAAATAAAAAGGTTGGGGG + Intergenic
1120909677 14:89654709-89654731 CCAAAAAAAAAAAAGGGGGGGGG + Intergenic
1121082273 14:91118079-91118101 CTAAAAAAAAAAAGGGGGGGGGG - Intronic
1121461198 14:94080054-94080076 CTCATCTATAAAAAGGGGGGAGG + Intronic
1121563425 14:94891563-94891585 GCACACAATAAATAGGTGGGTGG - Intergenic
1122103801 14:99435736-99435758 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1122752127 14:103944564-103944586 CTCAAAAAAAAAAGGGTGGGGGG - Intronic
1123410872 15:20057890-20057912 CTAAACAGAAAAAAGATGAGAGG + Intergenic
1123419693 15:20121648-20121670 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1123446171 15:20331888-20331910 CTAAACCATAAGAGGGAGGGAGG - Intergenic
1123520203 15:21064595-21064617 CTAAACAGAAAAAAGATGAGAGG + Intergenic
1123528916 15:21128184-21128206 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1123677398 15:22724428-22724450 CTTAAAAAAAAAAAGGTGGTTGG - Intergenic
1123963152 15:25427803-25427825 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1124251569 15:28109555-28109577 GGAAAGAATAAAAAGGAGGGAGG + Intergenic
1124896468 15:33781846-33781868 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1125323803 15:38515780-38515802 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1125570877 15:40716967-40716989 CTAAACAATATAAAAGTAGAGGG - Intronic
1125697598 15:41651951-41651973 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1125833697 15:42733270-42733292 CCAAAAAAAAAAAAGGTGGTGGG - Intronic
1125844023 15:42834183-42834205 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1125948903 15:43734486-43734508 CAAAAAAAAAGAAAGGTGGGGGG - Intergenic
1126035853 15:44544711-44544733 AAAAAAAAAAAAAAGGTGGGAGG + Intronic
1126186381 15:45834463-45834485 CTAAACAAAAAATAAGTGGAAGG - Intergenic
1126391076 15:48153098-48153120 CCAAACATTAAAAAGATGTGTGG + Intronic
1126591376 15:50343537-50343559 CTAAAAAAAAAAGAGGTGAGGGG - Intronic
1127016220 15:54691431-54691453 GTTAAAAAAAAAAAGGTGGGGGG + Intergenic
1127328156 15:57915418-57915440 TTAAAAAAAAAAAAGGGGGGGGG - Intergenic
1127482062 15:59386836-59386858 CAAAAAAATAGAAAGGTGGAGGG + Intronic
1127682944 15:61315292-61315314 CTGAGCTATAAAAATGTGGGCGG - Intergenic
1128102257 15:65012146-65012168 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1128165293 15:65459039-65459061 TTAAAAAAAAAAAAGGCGGGGGG + Intronic
1129125154 15:73433596-73433618 CTAAAGAGTAAAAAGATGGAGGG - Intergenic
1129318091 15:74758234-74758256 CAAAAAAAAAAAAAGGTCGGGGG + Intergenic
1129745797 15:78019888-78019910 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1130521000 15:84660497-84660519 CTATAGAAAAAAAAGGGGGGGGG + Intergenic
1130783307 15:87068621-87068643 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1131045843 15:89314841-89314863 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1131919255 15:97304847-97304869 TTAAAAAAAAAAAAGGTGTGGGG - Intergenic
1132418025 15:101638290-101638312 CCAAAAAAAAAAAAGGTGGGGGG - Intronic
1132848514 16:2012524-2012546 CTAAAAAAAAAAAAGCTGGGCGG - Intronic
1133083446 16:3342581-3342603 CTGAACAATAAAAACGAGGCCGG + Intergenic
1133348726 16:5087808-5087830 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1133527928 16:6624510-6624532 CTAACCAAAACAAAGGTGGGTGG - Intronic
1133633658 16:7645945-7645967 AGAAAAAAAAAAAAGGTGGGTGG - Intronic
1134268271 16:12710454-12710476 CAAAAAAAAAAAAAGGAGGGGGG + Intronic
1134645357 16:15860706-15860728 CTCAACAATAAAATGGGGGTAGG - Intergenic
1134649469 16:15897262-15897284 ATAAAAAAAAAAAAAGTGGGGGG - Intergenic
1134685232 16:16153961-16153983 CTCAACAACAAAAAGCTGTGTGG - Intronic
1134840614 16:17398822-17398844 CAAAACAAAAAAACAGTGGGGGG - Intronic
1134903042 16:17955922-17955944 AAAAAAAAAAAAAAGGTGGGAGG - Intergenic
1135105366 16:19645137-19645159 CTTAAGAGGAAAAAGGTGGGGGG + Intronic
1135856569 16:26016944-26016966 CTGAATAATAAATAGTTGGGAGG - Intronic
1136233486 16:28901337-28901359 AAAAAAAAAAAAAAGGTGGGCGG + Intronic
1136420408 16:30128859-30128881 CTCAAAAAAAAAAAGGTGGGGGG - Intergenic
1136530678 16:30866576-30866598 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1137349820 16:47703642-47703664 CAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1137634197 16:49971427-49971449 TTAAAAAAAAAAAGGGTGGGGGG + Intergenic
1137855039 16:51786097-51786119 CTAAATAACAAAAAGCTGGGGGG - Intergenic
1138068290 16:53965070-53965092 CAAAACAAAAAAAGGGCGGGGGG - Intronic
1138116986 16:54368708-54368730 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1138391927 16:56676404-56676426 AAAAACAAAAAAAAAGTGGGGGG - Intronic
1139201937 16:64986804-64986826 CAAAACAAAGAAAAGGTAGGGGG - Intronic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1139913478 16:70413417-70413439 ATAAAAAATAAAAAGCTGGCCGG + Intronic
1140523632 16:75603657-75603679 CTAAACAACAAAATTCTGGGTGG + Intronic
1140781423 16:78300426-78300448 TTAGAGAATAAAAAGGTGGCAGG - Intronic
1142860535 17:2758173-2758195 TTAAAAAAAAAAAAGGGGGGGGG - Intergenic
1143539091 17:7558889-7558911 CTTGAAAATAAAAAGGAGGGAGG - Exonic
1143804983 17:9418826-9418848 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1144183594 17:12775039-12775061 CTCAAAAAAAAAAGGGTGGGGGG + Intergenic
1144200426 17:12936379-12936401 GTAAACAATAAAAAGATCAGTGG - Intronic
1144223851 17:13125495-13125517 CTAAAAAAAAAAAAAGTTGGGGG - Intergenic
1144333628 17:14248764-14248786 GTAACCAAGAAGAAGGTGGGAGG - Intergenic
1144653995 17:17024108-17024130 GAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1144766268 17:17734443-17734465 CAAAAAAATAAAAAGTTGGGGGG + Intronic
1144820258 17:18067907-18067929 CTAAACTTGAAAAGGGTGGGTGG - Exonic
1145178550 17:20723620-20723642 TTAAAAAAAAAAAAGGTGGGTGG - Intergenic
1145363255 17:22229566-22229588 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1145965768 17:28915874-28915896 AGAAACACTTAAAAGGTGGGAGG + Intronic
1146019025 17:29259573-29259595 CTCAAAAAAAAAAAGGTGGGGGG + Exonic
1146021348 17:29281763-29281785 CTAAAAAAAAAAAGGGTGGGGGG - Intronic
1146329301 17:31914665-31914687 CTCAAAAAAAAAAAGGTTGGAGG + Intergenic
1146353442 17:32114987-32115009 TTAAAAAATAAAAAGTAGGGAGG + Intergenic
1146547766 17:33754055-33754077 ACAAAAAATAAAAAGATGGGTGG + Intronic
1147234738 17:39048956-39048978 CAAAAAAAAATAAAGGTGGGGGG + Intergenic
1147271064 17:39271611-39271633 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1147714319 17:42494231-42494253 CTCAAAAAAAAAAAGGGGGGTGG + Intronic
1147895513 17:43748734-43748756 CTAAAGAATAAAGATGTGGCGGG + Intergenic
1147923919 17:43935228-43935250 CTCAAAAAAAAAAAGGTTGGGGG + Intergenic
1148024700 17:44578678-44578700 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148295566 17:46499322-46499344 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1148719885 17:49743926-49743948 CTTAAAAAAAAAAAGGTTGGGGG + Intronic
1148880620 17:50723653-50723675 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1149192043 17:54074359-54074381 CAAGACAATAAAAAGATTGGTGG - Intergenic
1149456372 17:56791856-56791878 CTCAAAAAAAAAAAAGTGGGGGG + Intergenic
1149768211 17:59298150-59298172 CTCAAAAAAAAAAAGGTCGGGGG - Intergenic
1149804223 17:59599820-59599842 CAAAAAAAAAAAAAGGTGGGGGG - Intronic
1149838190 17:59933194-59933216 AAAAAAAAAAAAAAGGTGGGTGG - Intronic
1149842271 17:59975665-59975687 CAAAAAAAAAAAAGGGTGGGGGG + Intergenic
1150081105 17:62240024-62240046 TTAAAAAAAAAAAAGGTAGGTGG + Intergenic
1150411552 17:64947683-64947705 AAAAAAAATAAAAAGGTGGCCGG + Intergenic
1150681053 17:67284925-67284947 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1150726736 17:67657148-67657170 CAAAACAAAAAAAACGGGGGTGG - Intronic
1150756838 17:67922286-67922308 TTAAAAAATAAAAAGCAGGGAGG - Intronic
1150789755 17:68194208-68194230 GGAAAAAATAAAAAGGTGGCCGG - Intergenic
1151022495 17:70633759-70633781 CTAAACAATGAAAAGGAATGAGG - Intergenic
1151279278 17:73060261-73060283 GTAAAAAAAAAAAAGTTGGGGGG + Intronic
1151610372 17:75169850-75169872 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1152596590 17:81240668-81240690 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1153019170 18:611226-611248 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1153222093 18:2870935-2870957 CTAAAGAAAAAAAGGGTGGTGGG - Intronic
1153882754 18:9434979-9435001 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1154095426 18:11410222-11410244 CAAAAAAAAAAAAAGGGGGGGGG + Intergenic
1154254714 18:12772522-12772544 TTAAAAAATAAAAAGTTGGCCGG + Intergenic
1155015272 18:21831642-21831664 CTCAAAAAAAAAAAAGTGGGGGG - Intronic
1155047205 18:22113480-22113502 CTAAACAATAAAAAGATAGTGGG + Intergenic
1155311182 18:24525434-24525456 CAAAAAAAAAAAAAAGTGGGGGG - Intergenic
1155516611 18:26629716-26629738 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
1155750015 18:29411136-29411158 CTACAGAAAAAAAAGGAGGGGGG + Intergenic
1155892318 18:31285123-31285145 CTTAAAAAAAAAAAGGTTGGGGG - Intergenic
1155922723 18:31619306-31619328 CTCAAAAAAAAAAAGGTGGGGGG + Intergenic
1156125875 18:33904473-33904495 CTAAACCATAAAAGGGAGGAGGG - Intronic
1156714957 18:39997032-39997054 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1157336034 18:46738252-46738274 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1157488387 18:48105683-48105705 CAAAACAAAAAAAAGGTAGATGG + Intronic
1157722253 18:49934351-49934373 CAATACAAAGAAAAGGTGGGAGG - Intronic
1158081579 18:53598804-53598826 CCAAAAAAAAAAAAGGGGGGGGG - Intergenic
1158236669 18:55323104-55323126 CCAATCAACAAAAAGGCGGGGGG + Intronic
1158593568 18:58797403-58797425 CTCAAAAACAAAAAGGTGGCCGG + Intergenic
1158641527 18:59207801-59207823 GAAAAGAAAAAAAAGGTGGGGGG - Intergenic
1158726366 18:59976724-59976746 AAAAAAAAAAAAAAGGTGGGTGG - Intergenic
1158731284 18:60025802-60025824 ATCAACAAAAAAATGGTGGGAGG - Intergenic
1160728842 19:631325-631347 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1161020829 19:2010635-2010657 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1161050340 19:2160533-2160555 CTCAAAAAAAAAAAAGTGGGCGG + Intronic
1161197299 19:2993929-2993951 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1161477569 19:4494919-4494941 CAAAACAAAACAAAGGAGGGAGG + Intronic
1161718555 19:5891155-5891177 CAAGACAAAAAAAAGGGGGGTGG - Intronic
1161945286 19:7432092-7432114 AAAAAGAATAAAAAGGTAGGAGG - Intronic
1162510447 19:11114806-11114828 ATAAAAAATAAAAAGGGGGCCGG - Intronic
1162555865 19:11385143-11385165 CAAGAGAATAAAAATGTGGGTGG - Intronic
1162576620 19:11503032-11503054 TCAAAAAAAAAAAAGGTGGGGGG + Intronic
1162845622 19:13390108-13390130 ATAAAAAATAAAAATGTAGGTGG - Intronic
1162928026 19:13940046-13940068 ATAAAGAAAAAAAAAGTGGGGGG + Intronic
1162980202 19:14234111-14234133 TTAAAAAATAAAAATGAGGGAGG + Intergenic
1163194356 19:15704144-15704166 GTAAAAAAAAAAAAGGTTGGGGG + Intergenic
1163262986 19:16202365-16202387 TTAAAGAATAAAAAGGAGGTCGG - Intronic
1163327478 19:16614538-16614560 AAATAAAATAAAAAGGTGGGGGG + Intronic
1163401740 19:17098052-17098074 GTGAAGAAAAAAAAGGTGGGGGG - Intronic
1163463646 19:17454276-17454298 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1163934527 19:20430860-20430882 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
1164144992 19:22506738-22506760 TCAAAAAAAAAAAAGGTGGGGGG - Intronic
1165308526 19:35016909-35016931 AAAAAAAAAAAAAAGGTGGGAGG + Intronic
1165944189 19:39431716-39431738 CCAAAAAAAAAAAAGGCGGGGGG + Intergenic
1166131209 19:40746805-40746827 CTCAACAAAAAAAAGGAGGCCGG - Intronic
1166307588 19:41943589-41943611 CAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1166673119 19:44723346-44723368 CAAAAAAAAAAAAAGCTGGGGGG + Intergenic
1166680865 19:44765798-44765820 CAAAAAAGGAAAAAGGTGGGGGG + Intergenic
1166681771 19:44772368-44772390 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1166866504 19:45841289-45841311 TCAAAAAAAAAAAAGGTGGGGGG - Intronic
1167157644 19:47749160-47749182 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
1167490532 19:49790424-49790446 CCAAACAAAAAAAAGGGTGGGGG - Intronic
1167884324 19:52487952-52487974 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1168162883 19:54523855-54523877 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1168550105 19:57285705-57285727 CTGAAAAATAAAAAACTGGGAGG - Intronic
1168566907 19:57432571-57432593 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1202689214 1_KI270712v1_random:74962-74984 CTAAACCATAAGAGGGAGGGAGG + Intergenic
925180519 2:1814258-1814280 CAAAACAGTAAAGAGTTGGGAGG - Intronic
925857588 2:8145271-8145293 CTAAACTATAAAGATTTGGGTGG + Intergenic
926113925 2:10199275-10199297 CTAGAAAAAAAAAAGGGGGGGGG + Intronic
926503244 2:13680251-13680273 CTTAAAAAAAAAAGGGTGGGGGG + Intergenic
927544371 2:23940116-23940138 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
927789756 2:26001113-26001135 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
928581664 2:32714155-32714177 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
928763917 2:34618601-34618623 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
928961158 2:36927511-36927533 AAAAACAAAAAAAAGGGGGGGGG + Intronic
929224768 2:39501520-39501542 CTTAAAAAAAAAAAGGGGGGGGG - Intergenic
929598063 2:43188461-43188483 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG + Intronic
930610361 2:53536080-53536102 ATAAATAATAAAAAGTTGGCTGG - Intronic
931365190 2:61613169-61613191 CTCAAAAAAAAAAAGGTCGGCGG - Intergenic
931407399 2:61992902-61992924 GTAAACAATTAAAATGAGGGAGG + Intronic
931408012 2:61999923-61999945 CTCAAAAAAAAAAAAGTGGGTGG - Intronic
931505071 2:62917201-62917223 CTAAACATGAAATAGGAGGGAGG + Intronic
931760684 2:65414110-65414132 AAAAAAATTAAAAAGGTGGGAGG + Intronic
931917281 2:66969853-66969875 TTAAAAAAAAAAAAGGGGGGGGG + Intergenic
932147523 2:69336034-69336056 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
932473287 2:71978640-71978662 TTAGACAATAAAGAGGCGGGAGG - Intergenic
932517163 2:72363721-72363743 CTGAACAATATAAAGATGAGAGG - Intronic
933708984 2:85311847-85311869 CTAAACATAGAAAAGGTGGCTGG + Intergenic
933957222 2:87381129-87381151 CTAAACCATAAGAGGGAGGGAGG - Intergenic
934076320 2:88431639-88431661 CAAAAAAAAAAAAAGGTGGTGGG - Intergenic
934108875 2:88723450-88723472 CCAAAAAACAAAAAGGTGGGGGG + Intronic
934241340 2:90273021-90273043 CTAAACCATAAGAGGGAGGGAGG - Intergenic
934271834 2:91543665-91543687 CTAAACCATAAGAGGGAGGGAGG + Intergenic
934509838 2:94928761-94928783 CAAAAAAAAAAAAAGGAGGGGGG + Intergenic
935108289 2:100067184-100067206 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
935914659 2:107936051-107936073 CCAAAAAAAAAAAAGTTGGGGGG + Intergenic
937162893 2:119782706-119782728 CTCAAAAAAAAAAAGGGGGGTGG - Intronic
938544319 2:132314171-132314193 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
938706484 2:133933125-133933147 CTAAACCACAAAAATGGGGGGGG + Intergenic
938822949 2:134977178-134977200 CAAAAAAAAAAAAAAGTGGGTGG - Intronic
938863297 2:135392342-135392364 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
939412441 2:141846485-141846507 CTAAAAAATAAAAAAATGTGGGG + Intronic
940209465 2:151241779-151241801 TTAAACACTAAAAGGGTGGGAGG + Intergenic
940275204 2:151932831-151932853 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
940502898 2:154516626-154516648 CTAAATATGAAGAAGGTGGGTGG - Intergenic
940749052 2:157603276-157603298 CTCAACAATTAAAAGGTAAGAGG - Intronic
941686717 2:168455824-168455846 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
941957492 2:171219596-171219618 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
942004478 2:171684385-171684407 TAAAACAACAAAAAAGTGGGGGG + Intergenic
942782891 2:179667405-179667427 CTTAACTACAAAATGGTGGGGGG - Intronic
942798572 2:179850110-179850132 AAAAATAATAAAAAGCTGGGGGG + Intronic
943071410 2:183144775-183144797 TTAAACATTAACTAGGTGGGGGG + Intronic
943073122 2:183165254-183165276 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
943252011 2:185535724-185535746 TTAAATAATAAAACGGTGAGGGG - Intergenic
944198358 2:197079306-197079328 CTAAACAATAAAAAGATTAAAGG + Intronic
944700222 2:202239447-202239469 CTCAAAAAAAAAAAGGTGGCGGG + Intergenic
944714180 2:202362381-202362403 AAAAAGAAAAAAAAGGTGGGGGG - Intergenic
944865944 2:203861952-203861974 ATAAAAGAAAAAAAGGTGGGGGG - Intergenic
945764175 2:213953349-213953371 TTAAAGAATAAATAGGTTGGGGG + Intronic
945826483 2:214726037-214726059 CAAAAAAAAAAAAAGGTGGGGGG + Exonic
945929022 2:215836317-215836339 GTAAACAAAACCAAGGTGGGTGG - Intergenic
945978178 2:216286731-216286753 CTAAACACTAAAAAGATGATGGG - Intronic
946057330 2:216913606-216913628 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
946384082 2:219371266-219371288 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
946689914 2:222302067-222302089 AAAAAAAAAAAAAAGGTGGGCGG + Intronic
946914931 2:224509212-224509234 CTTAAGAAAAAAAAGGTGGGGGG - Intronic
946969125 2:225072470-225072492 CTTAACAACAAAAATGGGGGAGG + Intergenic
947411550 2:229846018-229846040 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
947648652 2:231765280-231765302 ATAAAAAATAAAAAAGTGGGAGG + Intronic
948064825 2:235069799-235069821 CTAAACAAAATGAAGGTGTGAGG + Intergenic
949038075 2:241828043-241828065 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1169374800 20:5057974-5057996 TCAAAAAATAAAAAGGAGGGGGG - Intergenic
1169449287 20:5697503-5697525 AAAAAAAAAAAAAAGGTGGGCGG + Intergenic
1170978427 20:21188583-21188605 CTAAAAAAAAAAAATGTGGAGGG - Intronic
1172087780 20:32401553-32401575 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1172557334 20:35853594-35853616 CTAAAAAATAAAAAATTGGCTGG + Intronic
1172744492 20:37196227-37196249 CTCAAAAAAAAAAAGGTGGGGGG - Intronic
1173094491 20:40012171-40012193 CTAAAAAAAAAAAAGCGGGGGGG - Intergenic
1173714161 20:45187772-45187794 ATAAACCATAAGAAGGTGGAAGG - Intergenic
1174023430 20:47550451-47550473 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1174587408 20:51619563-51619585 TTAAAAAAAAAAAAGGGGGGGGG + Intronic
1175318230 20:58066977-58066999 CAAAAAAAAAAAAAGTTGGGGGG + Intergenic
1175326726 20:58134626-58134648 CAAAAAAAAAAAAAAGTGGGGGG + Intergenic
1176848281 21:13893387-13893409 TAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1178122275 21:29481476-29481498 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1178375478 21:32064109-32064131 CAAAACAATAAGAAAATGGGGGG - Intergenic
1178603084 21:34011993-34012015 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1180552206 22:16549652-16549674 CTAAACCATAAGAGGGAGGGAGG - Intergenic
1181351823 22:22264407-22264429 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1181379271 22:22487146-22487168 CAAAACAATAAATAGGTGCCAGG + Exonic
1181847753 22:25725946-25725968 CTCAAAAAAAAAAAGGAGGGGGG + Exonic
1181941261 22:26479237-26479259 CTGAACAATAAAATGCTGTGTGG + Intronic
1182136831 22:27912990-27913012 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1182224041 22:28781941-28781963 TTAAAAAAAAAAAAGGGGGGGGG - Intronic
1182503451 22:30765187-30765209 ATAAAAAATAAAAATGGGGGAGG - Intronic
1182766841 22:32763936-32763958 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1182800650 22:33029331-33029353 ATAAACATTAAAAAAGTTGGAGG - Intronic
1183482126 22:38070877-38070899 CTGAGCTATACAAAGGTGGGTGG + Exonic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
1183926174 22:41207830-41207852 CTCAAAAAAAAAAAGCTGGGTGG - Intronic
1183980475 22:41536889-41536911 TTTAAAAAAAAAAAGGTGGGGGG + Intronic
1184174775 22:42782191-42782213 CTCAAAAAAAAAAAAGTGGGGGG - Intergenic
1184397528 22:44252129-44252151 ATAAATAATAAAAAGTTGGAGGG + Intronic
950083563 3:10240550-10240572 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
950213244 3:11139272-11139294 ATAAAAAAAAAAAAGGCGGGCGG - Intronic
950936088 3:16840832-16840854 CAGAACAATAAAAGGGTGGGTGG + Intronic
951194566 3:19809397-19809419 GTTAAAAAAAAAAAGGTGGGGGG + Intergenic
954014344 3:47673383-47673405 CTCAAAAAAAAAAGGGTGGGGGG + Intronic
954016430 3:47696064-47696086 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
954022252 3:47752487-47752509 CTAAAGAATAAAAAGGCAGCCGG + Intronic
954340200 3:49947249-49947271 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
954356736 3:50088299-50088321 CTAAAAAATAAAAAGGAGGCCGG - Intronic
954882054 3:53843180-53843202 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
956321908 3:68007307-68007329 CAAAACAAAAATCAGGTGGGAGG - Intronic
956428680 3:69163056-69163078 TTAAACAAGAAAAAAGTGGCCGG + Intergenic
956428801 3:69164132-69164154 CAAAACAATAAAAAGGAGTTGGG - Intergenic
956499516 3:69866822-69866844 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
956995992 3:74826603-74826625 TTAAAAAAAAAAAAGGTTGGGGG + Intergenic
957053068 3:75425160-75425182 AAAAAAAAAAAAAAGGTGGGCGG + Intergenic
957347402 3:78979745-78979767 ATAAGAAACAAAAAGGTGGGAGG + Intronic
957620904 3:82592697-82592719 CTAAACCACAAAAGGGAGGGGGG - Intergenic
957626434 3:82658655-82658677 AAAAATAATAAAAAGATGGGGGG - Intergenic
957665493 3:83219576-83219598 CCAAAAAAAAAAAAGGGGGGAGG - Intergenic
958032865 3:88134102-88134124 TTAAAAAAAAAAAAGGTGGGGGG + Intronic
959160788 3:102722148-102722170 CTAAAGAGTAAAAAGGTGTCTGG - Intergenic
959513994 3:107245114-107245136 TAAAAAAAAAAAAAGGTGGGGGG - Intergenic
959936664 3:112036566-112036588 CAAAAAAAAAAAAAGGAGGGGGG + Intronic
960416044 3:117386135-117386157 CAAAAAAAAAAAAAGGGGGGGGG + Intergenic
960627512 3:119695409-119695431 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
960694081 3:120378635-120378657 TTAAAAAAAAGAAAGGTGGGAGG - Intergenic
960878597 3:122321852-122321874 TAAAAAAATAAAAAAGTGGGTGG - Intergenic
960960272 3:123066017-123066039 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
961301768 3:125926377-125926399 AAAAAAAAAAAAAAGGTGGGTGG - Intergenic
961955216 3:130794380-130794402 CAAAAAAAAAAAAAGGGGGGGGG + Intergenic
961977770 3:131044430-131044452 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
962303401 3:134263837-134263859 CAACACAATAAAAAGGTTGAGGG - Intergenic
962426858 3:135277868-135277890 GAAAAAAAAAAAAAGGTGGGGGG + Intergenic
963179201 3:142336395-142336417 TGAAAAAATAAAAAGGTGGGTGG + Intronic
963309141 3:143689088-143689110 GTAGACAATAAAAACTTGGGGGG - Intronic
964028345 3:152105324-152105346 CCAAACTATAAAGAGCTGGGTGG + Intergenic
964224143 3:154378080-154378102 CAAAAAAAAAAAAAGGGGGGGGG - Intronic
964400799 3:156296468-156296490 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
964574761 3:158153336-158153358 ATAACCAATAAATAGGGGGGTGG - Intronic
964826050 3:160829194-160829216 CTAAACAAAAACAAGGAGGAGGG - Intronic
965347483 3:167569886-167569908 CAAAACAACAAAAAGATAGGTGG - Intronic
965399332 3:168198794-168198816 AGAAACAATAACACGGTGGGGGG + Intergenic
965539603 3:169859004-169859026 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
965608681 3:170521923-170521945 AAAAAAAAGAAAAAGGTGGGGGG + Intronic
965869142 3:173245692-173245714 GTAAACTACAAAAAAGTGGGGGG - Intergenic
966569316 3:181423555-181423577 GTAGACAATAAAAAGGTGGAGGG - Intergenic
966729387 3:183137815-183137837 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
966957803 3:184902114-184902136 TTAAAAAAAAAAAAGGGGGGGGG - Intronic
967493087 3:190115588-190115610 CTAAAGAAGAAAAAGTGGGGTGG + Intronic
967801802 3:193670380-193670402 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
967824304 3:193866570-193866592 CAAAAAAAAAAAAAGGTGGGGGG + Intergenic
967896974 3:194403901-194403923 CTAAATGTTAAAAAAGTGGGGGG + Exonic
968119702 3:196117144-196117166 CAAAAAAAAAAAAAAGTGGGGGG - Intergenic
968288406 3:197521439-197521461 CTAAACAACAGAAAGTTTGGAGG - Intronic
968408470 4:363758-363780 CAAAAAAAAAAAAAGGCGGGGGG + Intronic
969938523 4:10706927-10706949 CTAAACACCAAAAGGGAGGGGGG - Intergenic
970005421 4:11406251-11406273 TTAAGCAATAAAAAGGTGGTGGG + Intronic
970149476 4:13073800-13073822 CTAAAAAATAAAATGGCGGCTGG + Intergenic
970572120 4:17393334-17393356 CAAAAAAAAAAAAAGGGGGGGGG + Intergenic
970584218 4:17499976-17499998 AGAAAAAAAAAAAAGGTGGGGGG - Intronic
971457828 4:26860916-26860938 AAAAAAAAAAAAAAGGTGGGGGG - Exonic
971824250 4:31600037-31600059 CCTAACAAGAAAAAGGTGAGAGG - Intergenic
972370309 4:38417145-38417167 CTATACAATACCAAGGGGGGAGG + Intergenic
972458240 4:39275037-39275059 CTCAATAAGAAAACGGTGGGGGG + Intronic
972506984 4:39728965-39728987 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
972617301 4:40711868-40711890 TCAAAAAAAAAAAAGGTGGGGGG - Intergenic
972949224 4:44298409-44298431 CAGAAAAATAAAGAGGTGGGGGG - Intronic
973222355 4:47742994-47743016 CTAAATAATTAAATGGTGGTGGG + Intronic
973268901 4:48240379-48240401 CAACACAAGAAAAAGGTGGATGG + Intronic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
974062498 4:57048050-57048072 CTCAAAAAAAAAAAGGGGGGCGG - Intronic
975557383 4:75677859-75677881 CAAAAGTATTAAAAGGTGGGTGG + Intronic
975570795 4:75815952-75815974 CAAAACAAAAAAAAGGTGGGGGG - Intergenic
975773865 4:77761336-77761358 GAAAAAAAGAAAAAGGTGGGAGG + Intronic
976194778 4:82522109-82522131 CAAAACCATAAAAACATGGGAGG + Intronic
976623746 4:87156157-87156179 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
976813787 4:89124106-89124128 CAAAAAAAAAAAAAGGTGGGTGG - Intergenic
977556447 4:98491687-98491709 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
978505464 4:109451548-109451570 CCAAACAACAAAAAGATTGGGGG - Intronic
980533956 4:134090766-134090788 AAAAAAAATAAAAAGGTGGGAGG + Intergenic
980589800 4:134870701-134870723 GTAAACAAGAAAAAGGTGAGTGG - Intergenic
980780793 4:137488941-137488963 CTAAAAAATAAAAATTTAGGAGG - Intergenic
981176165 4:141686328-141686350 ATAAATAAATAAAAGGTGGGAGG + Intronic
981266814 4:142794182-142794204 CTAAAGAAAAACAAGGTAGGAGG + Intronic
981985620 4:150851312-150851334 AAAAACAAAAAAAAGGAGGGTGG + Intronic
982073471 4:151716269-151716291 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
982478749 4:155883182-155883204 CTAAAAAGTAAATATGTGGGAGG + Intronic
982672272 4:158335377-158335399 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
983298416 4:165895726-165895748 TAAAAGAAGAAAAAGGTGGGAGG + Intronic
983382162 4:167010062-167010084 ATAAACAATAAGTGGGTGGGGGG + Intronic
983791394 4:171801799-171801821 ATAAACAAAAAAAAGGGGGGGGG - Intergenic
984167662 4:176321155-176321177 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
984499199 4:180536901-180536923 ATAAAGAAGAAAAAGCTGGGAGG - Intergenic
985310760 4:188595567-188595589 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
988015222 5:25547980-25548002 CAAAAAAAAAAAAAGGGGGGGGG + Intergenic
988528133 5:32004090-32004112 TTAAAAAAAAAAAAGGTGGGGGG + Intronic
989494220 5:42092672-42092694 CTGAAAAATAAACAGCTGGGTGG - Intergenic
989579146 5:43015929-43015951 CAAAACAGAAAAACGGTGGGAGG - Intergenic
990321924 5:54638304-54638326 CTAAAAAATAAAAAGGGGGAGGG + Intergenic
990640297 5:57775989-57776011 TTAAAAAAAAAAAGGGTGGGGGG - Intergenic
990779031 5:59337329-59337351 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
990932793 5:61112211-61112233 CAAAAAAAAAAAAAGGGGGGGGG - Intronic
991045168 5:62214818-62214840 CAAATCAACAAAAAGGTAGGAGG + Intergenic
991336428 5:65553099-65553121 GCAAAAAATAAAAAGGTGGGGGG + Intronic
991406031 5:66301935-66301957 AAAAAACATAAAAAGGTGGGGGG + Intergenic
991646527 5:68806486-68806508 ATAAACATTGAAAAAGTGGGGGG + Intergenic
991902771 5:71477003-71477025 TAAAAAAAAAAAAAGGTGGGGGG - Intronic
991984475 5:72269894-72269916 ATAAAAAATAAAAATGTGGCCGG + Intronic
992044567 5:72872749-72872771 CTCAAAAAAAAAAAGCTGGGGGG - Intronic
992213397 5:74502913-74502935 CTAAAAAAAAAAAAGGAGAGTGG + Intergenic
992272882 5:75083731-75083753 CAAAAAAAAAAAAAGTTGGGGGG + Intronic
992426269 5:76661100-76661122 GTTAAAAATAAAAAGGTGTGGGG - Intronic
992899258 5:81277154-81277176 TTAGAAAAAAAAAAGGTGGGAGG + Intergenic
993048993 5:82903504-82903526 TTAAACAATAAAAATTTGGGTGG - Intergenic
993555317 5:89329531-89329553 TTAAAAAAAAAAAAAGTGGGGGG + Intergenic
993665414 5:90689324-90689346 AAAAAAAAAAAAAAGGTGGGTGG - Intronic
995054535 5:107744800-107744822 CTAACCAAGAAGCAGGTGGGTGG + Intergenic
995250780 5:109991051-109991073 CTGAACAAAAAAGAGGTGGAGGG + Intergenic
995420745 5:111963805-111963827 CAAAACAAGAAAAATGTGAGTGG + Intronic
996453124 5:123649725-123649747 GTTAACAAAAAAAAGGCGGGGGG - Intergenic
996484880 5:124021209-124021231 CTAAAGAATAGAGAAGTGGGTGG - Intergenic
996564313 5:124863562-124863584 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
997443157 5:133922909-133922931 TAAATAAATAAAAAGGTGGGGGG - Intergenic
997966337 5:138359457-138359479 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
998035198 5:138909354-138909376 TTAAAAAAAAAAAGGGTGGGGGG - Intronic
998106971 5:139474935-139474957 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
998283120 5:140831512-140831534 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
998520072 5:142792315-142792337 CTAAAAAATAAGAAGGTGTATGG - Intronic
998623458 5:143819639-143819661 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
998812080 5:145976443-145976465 GAAAAAAAAAAAAAGGTGGGGGG + Intronic
999471940 5:151862839-151862861 CTAGACAAAAAAAATGTGGGAGG - Intronic
1000081777 5:157855141-157855163 CGAAAAAAAAAAAAGGCGGGGGG + Intronic
1000808808 5:165834887-165834909 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1000861065 5:166456676-166456698 TTAAAAAAAAAAAAGGTGGGGGG - Intergenic
1000976798 5:167774131-167774153 CTCAATAATAAAAGGGAGGGAGG + Intronic
1001062807 5:168508305-168508327 ATAAAAAAAAAAAAGGCGGGTGG - Intronic
1001507472 5:172291264-172291286 AAAAAAAAAAAAAAGGTGGGCGG - Intergenic
1001893491 5:175359374-175359396 CTTAAAAAAAAAAAGGTGTGGGG - Intergenic
1001897048 5:175391497-175391519 CAAACAAACAAAAAGGTGGGGGG - Intergenic
1002445854 5:179289344-179289366 CTGAATAATAAATAAGTGGGAGG + Intronic
1003041548 6:2692629-2692651 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1003192181 6:3883945-3883967 CTTAAAAAAAAAAAGGTGGAGGG + Intergenic
1003438672 6:6119935-6119957 ACAAACAAAAAAAAGGGGGGAGG - Intergenic
1005443934 6:25901823-25901845 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
1005732663 6:28713693-28713715 CTAAAAAAAAAAAAAGAGGGGGG - Intergenic
1005745441 6:28832848-28832870 TTAAAAATTAAAAAGGTGGCCGG + Intergenic
1006236806 6:32640558-32640580 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007116715 6:39348277-39348299 CCAAACTATTGAAAGGTGGGAGG + Intronic
1007446847 6:41913111-41913133 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1007466089 6:42052320-42052342 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1007555249 6:42760260-42760282 CAAAACAAAAAAAAATTGGGAGG + Intronic
1007573368 6:42909266-42909288 AAAAAAAAAAAAAAGGTGGGAGG - Intergenic
1007868745 6:45007730-45007752 CAAAAAAAAAAAAAAGTGGGGGG - Intronic
1008077081 6:47156211-47156233 CTAAATAATGAAAAGCTGTGAGG - Intergenic
1008082282 6:47207117-47207139 CAAAACAATTATAAGGTGGGAGG + Intergenic
1008123357 6:47642653-47642675 CAAAAAAAAAAAAAGGGGGGGGG + Intergenic
1008339927 6:50352455-50352477 GTAAACAATAAAAAGGTAATGGG + Intergenic
1009053586 6:58308589-58308611 TTACACAATATAAATGTGGGTGG + Intergenic
1009237528 6:61141959-61141981 TTACACAATATAAATGTGGGTGG - Intergenic
1009692368 6:67052474-67052496 CTAAAAAATAAAATGGTGAAAGG - Intergenic
1010242014 6:73624911-73624933 AGAATCAATAAACAGGTGGGAGG - Intronic
1010779651 6:79930654-79930676 TTAAACCAAAAAAAGGTTGGGGG + Intronic
1012246532 6:96932567-96932589 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1012652452 6:101772686-101772708 CTAAAGAATCAAAAGTTGAGAGG - Intronic
1012965816 6:105671478-105671500 TAAAACAATAACAAGGGGGGGGG + Intergenic
1013236824 6:108204194-108204216 CTAAACACTCAATAGGTGGTCGG + Intergenic
1013244311 6:108272045-108272067 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1013310899 6:108892764-108892786 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1013321848 6:109000096-109000118 AGAAACAATAAAAAGATGAGTGG + Intronic
1013326494 6:109049669-109049691 ATAAAAAATAAAAAGGAGAGGGG + Intronic
1013421767 6:109973382-109973404 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1013929382 6:115512848-115512870 TTAAATAATAAAATGGTGGAAGG - Intergenic
1013982458 6:116147983-116148005 TCAAAAAAAAAAAAGGTGGGGGG + Intronic
1014019687 6:116572763-116572785 CTAAACAATGAAAGGGAGAGGGG - Intronic
1014133165 6:117857765-117857787 TTTAAAAATAAAAAGGTGTGGGG - Intergenic
1014225336 6:118840734-118840756 CAAAAAAAAAAAAAGGGGGGGGG - Intronic
1014988066 6:128036732-128036754 TTAAAAAAAAAAAAGGAGGGAGG - Intronic
1015535253 6:134260823-134260845 CTAAAAATAAAAAAGGTGAGCGG + Intronic
1015704619 6:136074230-136074252 CAAAAAAAAAAAAAGGCGGGGGG + Intronic
1016042842 6:139449938-139449960 TTAAAAAAAAAAAAGGTTGGGGG - Intergenic
1017139687 6:151179429-151179451 AAAAACAAAAAAAAAGTGGGTGG + Intergenic
1017354950 6:153493706-153493728 GTAAACATTAAAAAAGTTGGGGG - Intergenic
1017442148 6:154474410-154474432 CTCAAAAAAAAAAAAGTGGGGGG + Intronic
1017666533 6:156724589-156724611 TTAAAAAAAAAAAAGGGGGGGGG + Intergenic
1018139812 6:160819978-160820000 GTAAACAAGAAAAAAGTGAGAGG - Intergenic
1018231435 6:161679676-161679698 TTAAAAAAAAAAAAGGGGGGGGG - Intronic
1018325553 6:162663920-162663942 CTCTAAAAAAAAAAGGTGGGGGG + Intronic
1018418878 6:163624834-163624856 CAAAAAAACAAAAAGGCGGGGGG - Intergenic
1018488814 6:164271155-164271177 AGAGACAATAAAAAGATGGGTGG + Intergenic
1019589203 7:1821080-1821102 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1020466350 7:8483957-8483979 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1020768656 7:12358371-12358393 CTCAAAAAATAAAAGGTGGGGGG + Intronic
1021172299 7:17413651-17413673 GTAAACAGTAAAAATGTTGGTGG + Intergenic
1021278394 7:18685018-18685040 TTTAACAACAAAAAAGTGGGAGG - Intronic
1021294119 7:18882644-18882666 CCAAAAAAAAAAAAAGTGGGTGG + Intronic
1021443773 7:20710367-20710389 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
1023040510 7:36168757-36168779 CAAAAAAAAAAAAAGGTTGGGGG + Intronic
1023096758 7:36669369-36669391 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1023217278 7:37876412-37876434 ATAAACAATAAAAAGGTAATTGG + Intronic
1023428457 7:40064290-40064312 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1023612828 7:41988461-41988483 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1023959861 7:44917263-44917285 CTAAAAAAAAAAAAGGTAGCAGG - Intergenic
1024302574 7:47898897-47898919 CTAAAAAAAAAAAAGGAGAGAGG + Intronic
1024355496 7:48410152-48410174 TTAAAAAAAAAAAAGCTGGGTGG - Intronic
1024690229 7:51793238-51793260 CTCAACAATAAAAAGATGGCTGG + Intergenic
1025004013 7:55341576-55341598 ACAAACAAAAAAAAGGCGGGGGG + Intergenic
1025948469 7:66123749-66123771 CAAAAAAAAAAAAAGGTGGGGGG + Intronic
1026110631 7:67456259-67456281 CTTAAAAAAAAAAGGGTGGGGGG + Intergenic
1027014835 7:74773196-74773218 CTCAAAAAAAAAAAAGTGGGAGG + Intergenic
1027367771 7:77476245-77476267 ATAAAACAGAAAAAGGTGGGGGG - Intergenic
1027737209 7:81948446-81948468 TTTTTCAATAAAAAGGTGGGGGG - Exonic
1028832555 7:95343372-95343394 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1029191941 7:98778146-98778168 CTAAAAAAAAAAAAAGTTGGAGG - Intergenic
1029338629 7:99924241-99924263 CTAAACAGTAAAATAGGGGGAGG - Intronic
1029372761 7:100159719-100159741 CAAAAAAAAAAAAAGTTGGGGGG + Exonic
1029574990 7:101397535-101397557 CTCAAAAAAAAAAAGGAGGGGGG - Intronic
1029577813 7:101415149-101415171 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1029765150 7:102621780-102621802 CAAAAAAAAAAAAAGGGGGGGGG - Intronic
1029801335 7:102950812-102950834 ATAGACAATAAAAAGATTGGTGG + Intronic
1030741370 7:113113805-113113827 CGAAAAAAAAAAAGGGTGGGGGG + Intergenic
1030778782 7:113571326-113571348 TTAAACAAGAAAAAGGAGGTGGG + Intergenic
1031317078 7:120272218-120272240 ATAAACACAAAAAAGGTGGGTGG + Intergenic
1031489432 7:122369134-122369156 CAAAAAAAAAAAAAGGGGGGGGG - Intronic
1031639994 7:124150848-124150870 GTAAACAATAAAAAGATCAGTGG - Intergenic
1031867495 7:127053785-127053807 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1033948942 7:146759698-146759720 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1034061918 7:148099846-148099868 CCAAAAAAAAAAAAGGAGGGAGG - Intronic
1034103191 7:148468849-148468871 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1034340099 7:150347258-150347280 CCAGAAAATAAAAAGGAGGGAGG - Intergenic
1034483105 7:151338539-151338561 TTAAACAAAAAAAAGGTGCCGGG - Intergenic
1034610184 7:152360053-152360075 ACAAACAAAAAAAAGGGGGGTGG + Intronic
1034657892 7:152743857-152743879 CAAAAAAAAAAAAAAGTGGGGGG - Intergenic
1034946683 7:155266936-155266958 ATTAAAAAAAAAAAGGTGGGAGG - Intergenic
1034981397 7:155479990-155480012 CAAAAAAAAAAAAAAGTGGGGGG + Intronic
1035589679 8:802927-802949 CTAAATAAAGGAAAGGTGGGTGG + Intergenic
1035847045 8:2876280-2876302 CTTAATATTAAAAACGTGGGAGG + Intergenic
1037052512 8:14394135-14394157 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1037364277 8:18105668-18105690 ATAAAAAATAAAAAGATGGCTGG - Intergenic
1038141386 8:24849080-24849102 CAAAACCATAAAATGGGGGGGGG + Intergenic
1038522182 8:28243182-28243204 CTAAGAAAAAAAAAGGTTGGGGG - Intergenic
1038571939 8:28670206-28670228 CTCAAAAAAAAAAAGGTTGGGGG + Intronic
1038605158 8:28994167-28994189 CAAAAAAAAAAAAAGGCGGGGGG + Intronic
1038797714 8:30724536-30724558 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1038941981 8:32315064-32315086 TTAAAAAAGAAAAAGTTGGGTGG - Intronic
1039343512 8:36677243-36677265 TTAAAAAAAAAAGAGGTGGGGGG - Intergenic
1039465583 8:37783158-37783180 AAAAAGAAAAAAAAGGTGGGGGG + Intergenic
1039513233 8:38108517-38108539 TAAAAAAAAAAAAAGGTGGGGGG + Intronic
1039798725 8:40936578-40936600 CTAAAAAATAAAAAGAAGGAAGG + Intergenic
1040751478 8:50714064-50714086 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1041324897 8:56653510-56653532 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1041388566 8:57329558-57329580 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1041435396 8:57834176-57834198 CTAATCATGAAAAAGTTGGGTGG - Intergenic
1041555742 8:59153056-59153078 CAAAACTATAAAAAGATCGGTGG - Intergenic
1042366694 8:67945426-67945448 GGAGACAATAAAAAGGTCGGTGG + Intergenic
1043012770 8:74901098-74901120 TTAAGTAATATAAAGGTGGGTGG - Intergenic
1043494982 8:80790808-80790830 ATAAAAAATAAAAAGGGAGGAGG + Intronic
1046331757 8:112725224-112725246 CTAAACAGAAAAAAGAAGGGAGG + Intronic
1046667049 8:117015643-117015665 CTCCAGAAAAAAAAGGTGGGTGG - Intronic
1047563669 8:126016943-126016965 ATAACCTATAAAAATGTGGGAGG + Intergenic
1047708207 8:127523669-127523691 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1047826291 8:128579852-128579874 CTCAGCATTAAAAATGTGGGAGG - Intergenic
1048581766 8:135734841-135734863 CTAGACAGGAAAAAGGTGGGGGG - Intergenic
1048768663 8:137871025-137871047 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1048912843 8:139152628-139152650 TTAAAAAAAAGAAAGGTGGGGGG + Intergenic
1050017489 9:1250230-1250252 TTAAAAAAAAAAAAGTTGGGGGG - Intergenic
1050739961 9:8808454-8808476 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1051079216 9:13277225-13277247 CTAGTCAATAAAAAGGAGTGTGG + Intronic
1051623692 9:19078120-19078142 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1051816640 9:21115545-21115567 CTAACTGAAAAAAAGGTGGGGGG + Intergenic
1052330736 9:27265264-27265286 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1052764708 9:32629518-32629540 ATAAACAATAAAATAATGGGCGG + Exonic
1052876810 9:33573961-33573983 ATAAACAATAAAAAACTGGTCGG + Intergenic
1053260754 9:36661490-36661512 CTAAAGAATAAGAAGATGGGAGG + Intronic
1053450466 9:38189729-38189751 TTAAACAAAAAACAGGTGGCTGG - Intergenic
1053499198 9:38570425-38570447 ATAAACAATAAAAAACTGGTCGG - Intronic
1054760935 9:69003465-69003487 TTAAAAAAAAAAAAGGGGGGGGG + Intronic
1055060700 9:72065850-72065872 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1056043258 9:82689186-82689208 CAAAAAAAAAAAAAGGGGGGGGG + Intergenic
1056142318 9:83695193-83695215 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
1056368301 9:85928483-85928505 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1056610106 9:88120572-88120594 ATAAACAATAAAAAACTGGCCGG + Intergenic
1056651688 9:88470593-88470615 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1057144016 9:92746368-92746390 CTAAACAATAAAAAATTAGCTGG + Intronic
1057162249 9:92896758-92896780 ATAAACAATAAAAAACTGGTCGG - Intergenic
1057366670 9:94428592-94428614 GTAAAAAAAAAAAAGGGGGGGGG - Intronic
1057609702 9:96529823-96529845 AGAAAGAATAAAAAGGTTGGAGG - Intronic
1057656664 9:96959471-96959493 TAAAAAAATAAAAAGGGGGGGGG + Intronic
1057696982 9:97330076-97330098 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1059018100 9:110543926-110543948 TTAAGCAGAAAAAAGGTGGGGGG - Intronic
1059159107 9:112017289-112017311 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1059181148 9:112213726-112213748 CGAAAAAAAAAAAAGGTAGGGGG + Intergenic
1059712767 9:116884812-116884834 CAAAAAAAAAAAAAAGTGGGTGG - Intronic
1060087762 9:120716775-120716797 CTCAAAAAAAAAAAAGTGGGGGG - Intergenic
1060347018 9:122826111-122826133 CAAAACAAAAAAAAGGTGGTGGG + Intronic
1060388700 9:123259062-123259084 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1060435429 9:123588620-123588642 CAAAAAAAAAAAAAGGGGGGGGG + Intronic
1060577220 9:124707757-124707779 CTTCAAAATAAAAAGGTGGGGGG - Intronic
1060844339 9:126823682-126823704 CTAAATAATAAAAAGTAGGATGG - Intronic
1061067919 9:128290295-128290317 CAAAAAAATAAAAAGGTAGCCGG + Intergenic
1061095288 9:128453334-128453356 TTAAAAAAAAAAAAGGCGGGGGG - Intergenic
1061534234 9:131237711-131237733 ATAAAAAAAAAAAAGGTGGGGGG + Intergenic
1185734613 X:2487361-2487383 CAAAACAAAACAAAAGTGGGTGG - Exonic
1185741442 X:2536125-2536147 CTAAAAAATAAAAAAGGGGCCGG - Intergenic
1186458016 X:9725992-9726014 AAAAAAAAAAAAAAGGTGGGAGG + Intronic
1186474331 X:9845523-9845545 AGAAAAAACAAAAAGGTGGGTGG - Intronic
1186886716 X:13921574-13921596 CTAAAAAAAAAAAAAGGGGGGGG - Intronic
1187149245 X:16667129-16667151 CAAAAAAAAAAAAAGGCGGGGGG - Intronic
1187188348 X:17009425-17009447 CTCAAAAAAAAAAAGTTGGGAGG - Intronic
1187225250 X:17369783-17369805 CTGAACAGTTAAAAAGTGGGGGG + Intergenic
1187233621 X:17445743-17445765 CTAAAAAAAAAAAAGGGGGGGGG + Intronic
1187372113 X:18718128-18718150 GTAAAGAATAAAAAGGTTGTTGG - Intronic
1188213984 X:27455720-27455742 CTAAACAACAAAAAGGGAGAGGG - Intergenic
1188355302 X:29183367-29183389 TTGAACAATCAAATGGTGGGGGG - Intronic
1189453356 X:41160508-41160530 CTAAACAAAAAAAGGGAGGTGGG + Intronic
1189464983 X:41271741-41271763 CTAAAAAATATAAAGTTGGCTGG + Intergenic
1189654609 X:43230323-43230345 ATAAAGAATAATAAAGTGGGAGG + Intergenic
1190312213 X:49124553-49124575 CTAAAAAAGAAAAAGGTCGGGGG + Intergenic
1190312979 X:49130267-49130289 CAAAAGAATAAAAAAGAGGGAGG + Intergenic
1190795000 X:53732596-53732618 CAATACAGCAAAAAGGTGGGGGG + Intergenic
1191907863 X:66113634-66113656 CTAAAAAAAGAAAGGGTGGGGGG + Intergenic
1192533623 X:71910728-71910750 AGAAAAAAAAAAAAGGTGGGTGG + Intergenic
1192991405 X:76461802-76461824 AAAAACAAAAAAAAGGCGGGGGG - Intergenic
1193111794 X:77737422-77737444 CCAAAAAAAAAAAAGGGGGGGGG + Intronic
1193177856 X:78415700-78415722 CCAAACGATACAAAGGTAGGTGG + Intergenic
1193639509 X:83994854-83994876 CCAAAGACAAAAAAGGTGGGGGG - Intergenic
1193785755 X:85757862-85757884 AAAAAAAATACAAAGGTGGGGGG - Intergenic
1193864717 X:86717240-86717262 ATAAACAATGGAAAGGTGAGGGG - Intronic
1194200242 X:90945564-90945586 TTAAAGAAAAAAAAAGTGGGGGG + Intergenic
1194511468 X:94801231-94801253 CTAACAAAAAAAAAGGTGGGGGG - Intergenic
1194791518 X:98156852-98156874 CAAAGCAATCATAAGGTGGGGGG + Intergenic
1195308983 X:103611688-103611710 ATAAACCATAAAAAAGTAGGAGG + Intronic
1195379397 X:104256457-104256479 CAAAAAAAAAAAAAGGGGGGGGG - Intergenic
1196078123 X:111599887-111599909 AAAAACAAAAAAAAGGGGGGGGG + Intergenic
1196531005 X:116786160-116786182 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1196785977 X:119421913-119421935 CTCAAAAATAAAAAGGGGGTGGG - Intronic
1196888396 X:120269121-120269143 GCAAAAAAAAAAAAGGTGGGGGG - Intronic
1197192944 X:123669160-123669182 CAAAAAAAAAAAAAGGAGGGAGG + Intronic
1197303314 X:124807671-124807693 TTAAAAAATCAAAATGTGGGGGG + Intronic
1197325431 X:125087987-125088009 CTACAGTATAGAAAGGTGGGTGG + Intergenic
1197801016 X:130348785-130348807 TTAAAAAAAAAAAAGGGGGGGGG - Intronic
1198443704 X:136690014-136690036 CTTATAAATAAAAATGTGGGGGG + Intronic
1198627855 X:138599334-138599356 CTAAAAAAAAAAAAAGAGGGTGG + Intergenic
1198853455 X:140990517-140990539 TTAAACAATAAAAACGTGAAGGG - Intergenic
1200105051 X:153707371-153707393 CTAAAAAAAAAAAGGGGGGGAGG + Intronic
1201606650 Y:15792965-15792987 TTAAATAATAAAAAGGGGAGAGG - Intergenic