ID: 929675981

View in Genome Browser
Species Human (GRCh38)
Location 2:43930191-43930213
Sequence GTACTCCGGCTGCACCGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929675976_929675981 1 Left 929675976 2:43930167-43930189 CCCCCACTGAGAAGAGATCAAAA 0: 1
1: 0
2: 1
3: 17
4: 214
Right 929675981 2:43930191-43930213 GTACTCCGGCTGCACCGTGATGG 0: 1
1: 0
2: 0
3: 1
4: 47
929675979_929675981 -2 Left 929675979 2:43930170-43930192 CCACTGAGAAGAGATCAAAATGT 0: 1
1: 0
2: 2
3: 23
4: 258
Right 929675981 2:43930191-43930213 GTACTCCGGCTGCACCGTGATGG 0: 1
1: 0
2: 0
3: 1
4: 47
929675977_929675981 0 Left 929675977 2:43930168-43930190 CCCCACTGAGAAGAGATCAAAAT 0: 1
1: 0
2: 1
3: 16
4: 221
Right 929675981 2:43930191-43930213 GTACTCCGGCTGCACCGTGATGG 0: 1
1: 0
2: 0
3: 1
4: 47
929675978_929675981 -1 Left 929675978 2:43930169-43930191 CCCACTGAGAAGAGATCAAAATG 0: 1
1: 0
2: 0
3: 21
4: 240
Right 929675981 2:43930191-43930213 GTACTCCGGCTGCACCGTGATGG 0: 1
1: 0
2: 0
3: 1
4: 47
929675975_929675981 20 Left 929675975 2:43930148-43930170 CCATCAAAAGAGAGTTTTTCCCC 0: 1
1: 0
2: 0
3: 16
4: 270
Right 929675981 2:43930191-43930213 GTACTCCGGCTGCACCGTGATGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929675981 Original CRISPR GTACTCCGGCTGCACCGTGA TGG Intronic
901241365 1:7695663-7695685 GGACTGTGGCTGCACCATGAGGG + Intronic
905807025 1:40884537-40884559 GGACCCCGGCTGCACCGCGCTGG + Intergenic
1069606681 10:69743327-69743349 GTTGTCAGGCTGCAGCGTGAGGG + Intergenic
1083172583 11:60931769-60931791 GTACTCCAGCTGCCACGTGACGG - Exonic
1090408552 11:126492203-126492225 GGGCTCAGGCTGCAGCGTGAGGG + Intronic
1095482103 12:42647032-42647054 ATACTCCTGCTGTACCGTGTAGG - Intergenic
1096377394 12:51124581-51124603 CTCCTCCGGCTGCCCCATGAGGG - Intronic
1104418593 12:128616229-128616251 GTACTCCACCTGCCACGTGATGG - Exonic
1111183122 13:84694405-84694427 GTACTCTGGCTGCCCCTTGGTGG - Intergenic
1118894072 14:69931296-69931318 GGACTCAGGCTGCCCCTTGAAGG - Intronic
1123056170 14:105571782-105571804 GTCCTCGGGCTGCACCCTGCTGG - Intergenic
1123057762 14:105580023-105580045 GTCCTCGGGCTGCACCCTGCTGG + Intergenic
1123080602 14:105691912-105691934 GTCCTCAGGCTGCACCCTGCTGG - Intergenic
1123082044 14:105699956-105699978 GTCCTCGGGCTGCACCCTGCTGG + Intergenic
1132497966 16:272802-272824 GCACACCGGCTGCACCCTGCTGG - Intronic
1132785895 16:1656850-1656872 GTACTCCAGCTGCAGCTTGCTGG - Exonic
1138578825 16:57926332-57926354 GTGCTGCGTCTGCACTGTGATGG - Intronic
1147017016 17:37500022-37500044 GCAGTCCGACTGCACTGTGAGGG - Intronic
1152532241 17:80925416-80925438 GAACCCCGTCTGCACCGTGGCGG - Exonic
1153017412 18:596706-596728 CTACTCCAGCTGAACGGTGATGG - Intergenic
1163995979 19:21047846-21047868 GCACTCTGGCTGCACCTTGGTGG + Intronic
1167759877 19:51439308-51439330 GCACTCTGGCTGCACCGGGCAGG + Intergenic
925623510 2:5818468-5818490 GTTCTCCCGCTGCCCAGTGATGG - Intergenic
929675981 2:43930191-43930213 GTACTCCGGCTGCACCGTGATGG + Intronic
932715858 2:74100438-74100460 GTTCTGCGGCTCCACCTTGAGGG - Exonic
940878407 2:158921826-158921848 GTACTCAGCCTGCAGCGAGAGGG + Intergenic
942879969 2:180847611-180847633 TTACTGCGGCTGCACAGTTATGG - Intergenic
947644266 2:231726669-231726691 GAACTCAGGCTACAACGTGAGGG - Intergenic
1170998347 20:21388196-21388218 GTTCTCCTGCTGAACCGTGTGGG - Intronic
1176048061 20:63102831-63102853 GTTCCCAGGCTGCAGCGTGAGGG - Intergenic
954580342 3:51699834-51699856 GTACTCCTGCTGCATCTGGAGGG - Intronic
960277182 3:115741938-115741960 GCACTCCGGCTGCCCCTTGGTGG + Intergenic
961075787 3:123980386-123980408 GTCCTGCGGCTGCACCCTAATGG + Exonic
962601619 3:136995517-136995539 GTACTCCTGTTGCCCCGTGGTGG + Exonic
972567960 4:40285815-40285837 GTCCTCCGTCAGCACCCTGAAGG - Intergenic
1003590344 6:7431947-7431969 GGACTCAGGCTGCCCGGTGAGGG - Intergenic
1003626568 6:7746769-7746791 GAATACCGTCTGCACCGTGACGG - Intronic
1005005798 6:21286375-21286397 GTATTACTGCTGCACCATGATGG + Intergenic
1008479181 6:51967004-51967026 GTACTGCAGCTGCAGCCTGAAGG + Intronic
1014466882 6:121766841-121766863 GAACTCCAGCTGGACTGTGAAGG + Intergenic
1033597723 7:142868684-142868706 GAACTCCGTCAGCACCATGAGGG - Exonic
1035260455 7:157658623-157658645 GCACCCAGGCTGCACCCTGAAGG - Intronic
1049061510 8:140279688-140279710 GTCCTGCGGATGCACTGTGACGG - Intronic
1049499970 8:142957114-142957136 ATCCACCGGCTGCACTGTGAGGG - Intergenic
1057878332 9:98774406-98774428 GTGCCCCTGCTGCACAGTGAAGG + Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1203792594 EBV:159790-159812 GTACTGGGGGTGCGCCGTGAAGG + Intergenic
1200217324 X:154373799-154373821 GTGCTCCGAGTGCACCGTCAAGG - Intronic
1201576521 Y:15467060-15467082 GTACTCCTGCTGCCGCGTCATGG + Intergenic