ID: 929685850

View in Genome Browser
Species Human (GRCh38)
Location 2:44033538-44033560
Sequence GGAGAATGGTCACGGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929685850_929685857 14 Left 929685850 2:44033538-44033560 CCCTCACACCGTGACCATTCTCC No data
Right 929685857 2:44033575-44033597 AGTCCCACTTTTCTAACCACAGG No data
929685850_929685858 15 Left 929685850 2:44033538-44033560 CCCTCACACCGTGACCATTCTCC No data
Right 929685858 2:44033576-44033598 GTCCCACTTTTCTAACCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929685850 Original CRISPR GGAGAATGGTCACGGTGTGA GGG (reversed) Intergenic
No off target data available for this crispr