ID: 929687543

View in Genome Browser
Species Human (GRCh38)
Location 2:44047544-44047566
Sequence GGCTAAGTTGGTGGAAATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929687543_929687549 -9 Left 929687543 2:44047544-44047566 CCCCAATTTCCACCAACTTAGCC No data
Right 929687549 2:44047558-44047580 AACTTAGCCTGGCTCAGATGAGG No data
929687543_929687551 4 Left 929687543 2:44047544-44047566 CCCCAATTTCCACCAACTTAGCC No data
Right 929687551 2:44047571-44047593 TCAGATGAGGAAACAAAGAATGG No data
929687543_929687553 11 Left 929687543 2:44047544-44047566 CCCCAATTTCCACCAACTTAGCC No data
Right 929687553 2:44047578-44047600 AGGAAACAAAGAATGGGCCTTGG No data
929687543_929687552 5 Left 929687543 2:44047544-44047566 CCCCAATTTCCACCAACTTAGCC No data
Right 929687552 2:44047572-44047594 CAGATGAGGAAACAAAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929687543 Original CRISPR GGCTAAGTTGGTGGAAATTG GGG (reversed) Intergenic
No off target data available for this crispr