ID: 929694549

View in Genome Browser
Species Human (GRCh38)
Location 2:44103013-44103035
Sequence TGTCCCTGTGATACAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929694544_929694549 22 Left 929694544 2:44102968-44102990 CCTTTCTGGAAATTAACAGCTCG No data
Right 929694549 2:44103013-44103035 TGTCCCTGTGATACAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929694549 Original CRISPR TGTCCCTGTGATACAGTGGG GGG Intergenic
No off target data available for this crispr