ID: 929696363

View in Genome Browser
Species Human (GRCh38)
Location 2:44119624-44119646
Sequence CAATAACAGCAGAAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929696362_929696363 11 Left 929696362 2:44119590-44119612 CCTGGGCAACATAATGAGACTGA No data
Right 929696363 2:44119624-44119646 CAATAACAGCAGAAGTGTTCTGG No data
929696361_929696363 15 Left 929696361 2:44119586-44119608 CCAGCCTGGGCAACATAATGAGA 0: 870
1: 13266
2: 57092
3: 139513
4: 327843
Right 929696363 2:44119624-44119646 CAATAACAGCAGAAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929696363 Original CRISPR CAATAACAGCAGAAGTGTTC TGG Intergenic
No off target data available for this crispr