ID: 929700398

View in Genome Browser
Species Human (GRCh38)
Location 2:44157610-44157632
Sequence CTTTTTATGCTAAACATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929700398_929700401 1 Left 929700398 2:44157610-44157632 CCTACCATGTTTAGCATAAAAAG No data
Right 929700401 2:44157634-44157656 CATAACAGAAGTATGATACATGG No data
929700398_929700402 14 Left 929700398 2:44157610-44157632 CCTACCATGTTTAGCATAAAAAG No data
Right 929700402 2:44157647-44157669 TGATACATGGTCCTAGCCTCTGG No data
929700398_929700403 15 Left 929700398 2:44157610-44157632 CCTACCATGTTTAGCATAAAAAG No data
Right 929700403 2:44157648-44157670 GATACATGGTCCTAGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929700398 Original CRISPR CTTTTTATGCTAAACATGGT AGG (reversed) Intergenic
No off target data available for this crispr