ID: 929705891

View in Genome Browser
Species Human (GRCh38)
Location 2:44211456-44211478
Sequence CTTCTCAGTGCATCACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929705891 Original CRISPR CTTCTCAGTGCATCACAATC AGG Intronic
901383593 1:8891637-8891659 CTTCTCACTCTGTCACAATCTGG + Intergenic
902118700 1:14143155-14143177 CTTCTGGATGCATCACAATTAGG - Intergenic
904079624 1:27863791-27863813 CTTCTCACTGCATCATAACATGG - Intergenic
905948924 1:41928811-41928833 CTTCTCAGTGCATCAAACTGGGG + Intronic
906084711 1:43121552-43121574 CTCCTCAGTGCAACACAGTCAGG - Intergenic
906825390 1:48973960-48973982 CATCTCAGTACATCACAGACTGG + Intronic
907999649 1:59668052-59668074 CTTCTCAGCTCATCAGAATCAGG + Intronic
909530970 1:76681415-76681437 CTTCTCAGTGGAGTACAACCTGG - Intergenic
910876415 1:91882959-91882981 CTTCTAAGTGCAAGACAATAGGG - Intronic
911671063 1:100608243-100608265 CTTTTCAGTTAATCAAAATCAGG - Intergenic
912801402 1:112722147-112722169 CTTCTCTGTGCCACACACTCTGG - Intronic
913429200 1:118770946-118770968 CTTCTCAGTGCATCATATTGGGG + Intergenic
915956758 1:160226771-160226793 CTTCTCAGTCCATCCTAATCTGG + Intronic
916321384 1:163508746-163508768 CTTCTCAACGCATCATAATTTGG - Intergenic
917990937 1:180378160-180378182 CTTCTTAGTGCATCATATTAAGG - Intronic
918000861 1:180493978-180494000 CTTTTCAATGCATCACACTGGGG + Intronic
920207919 1:204306498-204306520 CTTCTCAGTGCCTCAGAATTGGG - Intronic
920498212 1:206470302-206470324 CTTCTCTGTGGCTCACACTCTGG + Intergenic
920943505 1:210506155-210506177 CCTCACAGTGCATCAAAATTAGG - Intronic
921366614 1:214380465-214380487 CTTCTCAGTGCATCAACTTCTGG + Intronic
921438847 1:215159869-215159891 CTGCTCAGTGCATCACATCTGGG - Intronic
921996938 1:221430393-221430415 CATCTCATTGCATTACAATTAGG + Intergenic
923395236 1:233555327-233555349 CTTCCCTGGGCATCATAATCAGG + Intergenic
924368703 1:243323674-243323696 CTTCTGAGTGCATCGCAGCCAGG + Intronic
1063563511 10:7150844-7150866 CTTGTCTGTGCCGCACAATCAGG - Intergenic
1063605711 10:7521224-7521246 CTTCTCACTGCTTCTCCATCAGG - Intergenic
1066748960 10:38633222-38633244 GTTCTAAGTGTATGACAATCTGG + Intergenic
1066967704 10:42284563-42284585 GTTCTAAGTGTATGACAATCTGG - Intergenic
1067390929 10:45863014-45863036 CTTCTCAGTACTTCACCAGCTGG + Intergenic
1067580801 10:47444255-47444277 CTTCTCTGTGCCCCACACTCTGG + Intergenic
1067805946 10:49394018-49394040 CTTCTCTGTGCATCTGAACCAGG - Intronic
1069091316 10:64202448-64202470 CTCCTCAGTGAATTACCATCTGG + Intergenic
1071348329 10:84714755-84714777 CTTCTCATTGCATCATCATGTGG + Intergenic
1075434369 10:122422462-122422484 CTTCTCAGTGGACCACTATTAGG - Intronic
1076491014 10:130861682-130861704 CTTCTCAGGCCATCACCACCAGG - Intergenic
1077676205 11:4195087-4195109 CTTCTCAGTGCATTGTTATCAGG + Intergenic
1079668188 11:23134399-23134421 CTTCTCCGTGCCCCACAAACAGG + Intergenic
1080757830 11:35219209-35219231 CTTCTCAGTGATTCAGAATGTGG + Intronic
1081036404 11:38151900-38151922 CTTCTTAGTGCATCATATCCTGG + Intergenic
1081950694 11:47040142-47040164 CCTCTCAGTGCATCACATCTGGG - Intronic
1087309249 11:96521241-96521263 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1087374613 11:97325963-97325985 CTTCTCTGTGTCTCACAAGCAGG + Intergenic
1087637288 11:100716308-100716330 CTTCACAGTGAACCACAAGCAGG - Intronic
1088772127 11:113045349-113045371 CTTCTCAGCGGGTCACAGTCAGG + Intronic
1090327244 11:125899708-125899730 ATTATCAGTGAATCAGAATCTGG + Exonic
1090621239 11:128562787-128562809 CTTCCCAGTGCTTCAAAGTCAGG + Intronic
1091552107 12:1543954-1543976 CTTCTCAGTGCATCATATCAAGG + Intronic
1095879201 12:47114402-47114424 CTTTTCAGTTCATTAAAATCTGG + Intronic
1096075785 12:48803217-48803239 CTTCCCAGTGCCTCACATTGGGG - Intergenic
1098209386 12:68147551-68147573 CTTCTTGCTGCATCACAACCTGG + Intergenic
1100878608 12:98991614-98991636 ATTCTAAGTGCTACACAATCTGG + Intronic
1103046743 12:117742051-117742073 GTTCTCAGTGCATCACAGCAGGG - Intronic
1104706151 12:130948975-130948997 CTTCTGAGGGCATCGCCATCAGG + Intergenic
1105025920 12:132848882-132848904 CATCACAGTCCATCACAACCTGG - Intronic
1105404946 13:20126134-20126156 CTTCTCAGTGCATCACACCAAGG - Intergenic
1108078443 13:46707363-46707385 CATCTCAGGGCATCACATTTGGG + Intronic
1110090201 13:71435291-71435313 CTTCTCAGTTCATCCCATTTGGG - Intergenic
1110316797 13:74117697-74117719 CTTCTCAGTGTATCACATCGGGG - Intronic
1111006138 13:82251797-82251819 CTTCTCAGATTATCTCAATCTGG + Intergenic
1113228479 13:108185058-108185080 CTGTTCAGTGAATCATAATCTGG + Intergenic
1117505244 14:56395861-56395883 CATCTCAGTGCATCATATTGGGG - Intergenic
1118335473 14:64850220-64850242 TTACTCAGTGCATCACCATTGGG + Intronic
1118481280 14:66168849-66168871 CTTCTCAGTGCATCATATCAAGG - Intergenic
1120189798 14:81430158-81430180 CTTCCCAGCCCAGCACAATCTGG + Intronic
1120955961 14:90081968-90081990 CTTCACACTGCATCAAAATATGG - Intronic
1124077808 15:26462276-26462298 GTTCTCTGTGCACCACAGTCAGG - Intergenic
1124112787 15:26807787-26807809 CATCTCAGTGCGTGACAATTTGG + Intronic
1124795817 15:32777233-32777255 CTGCTAAGTGGATCACAAGCCGG - Intronic
1124810910 15:32937173-32937195 CTTCTCAGTGGTTCCCAACCTGG + Intronic
1124888466 15:33709651-33709673 CTTCTCACTGCATCATAACATGG - Intronic
1126225057 15:46261222-46261244 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1126560576 15:50039007-50039029 CTTCTCACTACATTACACTCCGG + Intronic
1126899831 15:53303790-53303812 CTTCTGAGTGCATCACCAGCAGG + Intergenic
1127125767 15:55810443-55810465 CTTCTCAGTGCCTCATATTAGGG + Intergenic
1127953195 15:63830272-63830294 CTTCTCAATGCATCATATTGGGG - Intronic
1129549863 15:76436749-76436771 TATATCAGTGTATCACAATCTGG + Intronic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1137855796 16:51793346-51793368 CTTCTGAGTGCTTCTCAACCAGG + Intergenic
1143737059 17:8918851-8918873 CTTCTCAGTGCATTACAGCAGGG - Intronic
1146613245 17:34327208-34327230 CTTCTCAGTGCACCATTATCAGG - Intergenic
1151006668 17:70445650-70445672 CTTCTCAGTGCATCATATCATGG - Intergenic
1203171838 17_GL000205v2_random:155548-155570 CCTCTCAGTGCCTCAGAAGCCGG + Intergenic
1203173895 17_GL000205v2_random:177209-177231 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1153914688 18:9734867-9734889 CTTCTCAGCTCATCAGAATTGGG + Intronic
1155373817 18:25134652-25134674 CTTTTCACTCCATCCCAATCTGG + Intronic
1155600282 18:27538114-27538136 CTTCTCAGTGCATCATATCAAGG - Intergenic
1156538236 18:37884353-37884375 CCTTTCAGTACATCACTATCTGG - Intergenic
1158154365 18:54408773-54408795 CTTCTCAGTGCACCAAATTGTGG + Intergenic
1162883857 19:13681578-13681600 CTTCCTATTGCATCAGAATCAGG - Intergenic
1164999676 19:32750880-32750902 CTTCTCAGTGCATCCCAGCAGGG + Intronic
1165710711 19:38008922-38008944 CTCCTCAGTGCTTCACAGGCAGG - Intronic
927200304 2:20574142-20574164 CTTCTGAGTGCATCACAGTGAGG + Intronic
928417115 2:31104779-31104801 CTTCTCAGCCCATCACATCCAGG + Intronic
929420629 2:41786007-41786029 CTTCTAAGCACATCACAATTTGG + Intergenic
929705891 2:44211456-44211478 CTTCTCAGTGCATCACAATCAGG + Intronic
929732447 2:44510403-44510425 CTTCTCAGTGAATCATACTGGGG + Intronic
932090656 2:68803409-68803431 CCTCTCAACCCATCACAATCTGG - Intronic
933834365 2:86233201-86233223 TTTCTCAGTACATGAGAATCTGG + Intronic
934094403 2:88585765-88585787 CTTCTCAACCCATCACAGTCTGG - Intronic
934311952 2:91875344-91875366 GTTCTAAGTGTATGACAATCTGG + Intergenic
939227294 2:139379985-139380007 TTTCTCAGTGCCTCACAACTTGG - Intergenic
940421848 2:153488218-153488240 CTTCTCTGTGCATTTCAGTCAGG - Intergenic
941841507 2:170089440-170089462 CTTCTCAGTGAATCATATTTAGG - Intergenic
945302981 2:208231558-208231580 CTTCTCAGTGTATGACAATACGG - Intergenic
946262093 2:218501350-218501372 CTTCTAAGGGCATCACATCCAGG + Intronic
946371249 2:219282850-219282872 CTTCTCAGAGCTTCAGAACCGGG + Exonic
948230265 2:236344141-236344163 CTGCTAAGTGCACCACATTCGGG - Intronic
1168782867 20:509502-509524 CTTCTCACGTTATCACAATCTGG - Intronic
1169728238 20:8759241-8759263 TTTCTCAGTGCATCACATCACGG + Intronic
1170149403 20:13213777-13213799 CTTCTCAGTGCATCACATCAGGG - Intergenic
1170844560 20:19951437-19951459 CTTCTCAGAGCCTCACACTGGGG + Intronic
1171099734 20:22371750-22371772 TTTCTCAGTGCATCACCACTGGG - Intergenic
1172063424 20:32202857-32202879 CTTAGCAGTGCATCAACATCAGG + Intronic
1172496651 20:35390814-35390836 CTTCTCAGTGCATCATATCAGGG - Intronic
1173443348 20:43096661-43096683 CTTCTCAGTGCATCTGGATCTGG - Intronic
1173850005 20:46211678-46211700 CTTCACAGAGCAGCAGAATCAGG - Intronic
1174591997 20:51653461-51653483 CTTCTCAGATCATCAGCATCTGG + Intronic
1175353360 20:58342743-58342765 CTTCTCAAAGCATCCCAGTCTGG - Intronic
1176329887 21:5538855-5538877 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1176397870 21:6282096-6282118 CCTCTCAGTGCCTCAGAAGCAGG + Intergenic
1176439287 21:6707008-6707030 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1176463549 21:7034077-7034099 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1176487110 21:7415856-7415878 CCTCTCAGTGCCTCAGAAGCAGG - Intergenic
1177495662 21:21887572-21887594 GTTCTCACTGCATTACAAACCGG - Intergenic
1180538709 22:16421172-16421194 GTTCTAAGTGTATGACAATCTGG + Intergenic
1180678578 22:17606715-17606737 CTTCTCATGCCATAACAATCTGG + Intronic
1181376575 22:22463511-22463533 CTTCTCATAGCATCACCATAAGG - Intergenic
1185217002 22:49606909-49606931 CTTCTCAGGGAGACACAATCTGG + Intronic
949096815 3:96192-96214 CTTCTCAGTGGAACACAAGAGGG - Intergenic
950408932 3:12821799-12821821 CTTCCCAGTGCATCACATCAGGG + Intronic
952064539 3:29552801-29552823 CTTCTTAGGGCATTACACTCTGG + Intronic
953036811 3:39219085-39219107 CTTCTCACTGCATCACACGAGGG + Intergenic
953543306 3:43841661-43841683 CTTCTCAGGGCATCCCACTGTGG + Intergenic
955774200 3:62416026-62416048 TTTCTCAGTGCTTCAGAATGCGG + Intronic
956540259 3:70328716-70328738 CTCCTCACTGCATCACTCTCTGG - Intergenic
959569347 3:107866739-107866761 CATCTTAGTGCCACACAATCGGG - Intergenic
961981698 3:131086071-131086093 CTTCTCAGTACATCATATTAAGG + Intronic
963059589 3:141214436-141214458 CTTCTCAGCACATCACTACCAGG - Intergenic
964062111 3:152537514-152537536 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
964459494 3:156908086-156908108 CTTCTCAGTGCATCATATCAGGG + Intronic
964555834 3:157936954-157936976 CTTCTCAGGCATTCACAATCTGG - Intergenic
965327142 3:167320736-167320758 TTTCTCAGTGCGTGACATTCTGG - Intronic
966457352 3:180132964-180132986 CTTGTCAATGCACCACAATGTGG + Intergenic
966714234 3:183000085-183000107 CTTCTCTGTGCCCCACAAACAGG + Intergenic
966754015 3:183351478-183351500 CTTCTCAGTGCTAGACAAACAGG - Intronic
966899836 3:184473261-184473283 CTTTTCAGGGCAGCACACTCAGG + Intronic
967709036 3:192684641-192684663 CTTTTCAGTGATTCAAAATCAGG + Intronic
971481339 4:27117480-27117502 CTTCTCATTGCATCCCAGGCTGG + Intergenic
974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG + Intergenic
977791554 4:101110706-101110728 CTTCTCAATGCCTCAGAATATGG - Intronic
978734962 4:112075499-112075521 CTTCTCAAAGCATGAAAATCAGG + Intergenic
979503786 4:121469971-121469993 CTACTCAGTGCATCATACTGTGG + Intergenic
979860221 4:125683794-125683816 CTTCTCACCCCAGCACAATCTGG + Intergenic
980427249 4:132642154-132642176 TTTCTCAGTGCATCATATTTTGG + Intergenic
980743349 4:136980887-136980909 CTCTTCAGTGCATTCCAATCAGG - Intergenic
981112068 4:140947025-140947047 CTTCTCAGTGAATTTCAATTAGG + Intronic
983057975 4:163121838-163121860 CTTCTCAGTCTTTCCCAATCTGG - Intronic
984835473 4:184015895-184015917 CTACTCAGTTCTTCTCAATCTGG + Intronic
985277627 4:188253669-188253691 TTTCTCTGTGCATCGTAATCAGG + Intergenic
987513593 5:18875443-18875465 CTTCTCAGTTGATTATAATCTGG - Intergenic
988200898 5:28066944-28066966 CTTTTCTGTGCCTCACAAGCAGG - Intergenic
989249951 5:39301151-39301173 ATTCTCAGTGCATCATATTATGG - Intronic
990252682 5:53932517-53932539 CTTCTAAGCGGATCACCATCTGG + Intronic
990599535 5:57343595-57343617 CTTGTGAGTGCATCACTAGCTGG + Intergenic
990781755 5:59372592-59372614 CTTCTCTGTGCCCCACAAGCAGG - Intronic
992801141 5:80297164-80297186 CTTCTCAGTGCATCACACAGGGG + Intergenic
992882503 5:81124493-81124515 CTCCTCTGGGCATCACAATCTGG + Intronic
995062985 5:107831584-107831606 ACTCTCAGTGCCTCACATTCAGG + Intergenic
995088149 5:108140005-108140027 CTCCTCAGTGTATTATAATCTGG + Intronic
999717790 5:154375908-154375930 CTTCTCAGTCCATCAGACTTTGG - Intronic
1004317761 6:14605391-14605413 TTTCTCTGAGCATCACTATCTGG + Intergenic
1006269818 6:32955583-32955605 CTTCTCAGCCCACCACAATCTGG - Intronic
1007117463 6:39353710-39353732 CCTCTCACTGCCTCACATTCTGG - Intronic
1008701931 6:54111114-54111136 CTTCTCATTGCTGCACAATCTGG + Intronic
1010567812 6:77438919-77438941 CTTCTCAGTGCATTATATTAAGG - Intergenic
1010825041 6:80462889-80462911 GCTCCCAGTGCATCACAATCTGG - Intergenic
1011038552 6:83004518-83004540 ATTGTCAGTGCATCCCAATTGGG - Intronic
1012105568 6:95153609-95153631 CTTCTTAGTGCATCACAACATGG - Intergenic
1012350439 6:98243737-98243759 CTTTTAAGTGTACCACAATCTGG + Intergenic
1012926280 6:105271350-105271372 CTTCTCAGTGCATCCTATTGGGG - Intergenic
1013414366 6:109911861-109911883 CTTCACTGTGCATCACTTTCTGG + Intergenic
1014295279 6:119610054-119610076 CTTCTCAGCCCACTACAATCTGG - Intergenic
1014462585 6:121715029-121715051 CTTTTCAGTACATCCCCATCAGG - Intergenic
1015325561 6:131919215-131919237 CTTCTCTGTGCCCCACAAGCAGG - Intergenic
1016186461 6:141203582-141203604 CTTCTCATTGAATCACATTAAGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1020513662 7:9090303-9090325 CCTCTCAGTGCCTCTCAACCTGG + Intergenic
1020603037 7:10300474-10300496 CCTCTCCCTGCATCATAATCAGG + Intergenic
1021061279 7:16116215-16116237 CTTCTCAGTGCATCATATCAGGG - Intronic
1021910586 7:25382429-25382451 ATGCTCAGTGAATCAGAATCAGG - Intergenic
1023248174 7:38229572-38229594 CTTCCCAATGACTCACAATCTGG - Intronic
1024427207 7:49239982-49240004 CTTCTCTGTGTTTCACAAGCAGG + Intergenic
1026255923 7:68711118-68711140 CTTCTCAGTACATAAAAATTAGG + Intergenic
1027877402 7:83788116-83788138 CTTTTCAGTAAATCACAATATGG + Intergenic
1029368605 7:100132873-100132895 CTTCTCTGTGCCTCAAAACCTGG + Intergenic
1030209805 7:106985053-106985075 CTTCTCAGTGCATCACAGCATGG + Intergenic
1031695390 7:124845465-124845487 CTTCTCAGTGCATCACATCAAGG + Intronic
1032562766 7:132909637-132909659 CTTCACAGTGGAGCACAATGAGG + Intronic
1036595479 8:10207976-10207998 GTTCTCAGGGCTTCAAAATCTGG + Intronic
1037631703 8:20663478-20663500 GTCCTCAGTGCCTCACTATCTGG + Intergenic
1038446823 8:27610384-27610406 CTGCTCAGTGCCTCTCTATCAGG - Intronic
1039192097 8:34987689-34987711 ACTCTCAGTGCATCACAGTAGGG + Intergenic
1040645327 8:49390297-49390319 CTTCTCTGTGAATCAAAATTAGG + Intergenic
1043508845 8:80930380-80930402 CTCCCCAGTGCAACAAAATCAGG - Intergenic
1043604179 8:81979636-81979658 CAAATCAGTGCTTCACAATCTGG - Intergenic
1043632855 8:82358199-82358221 CTTCTCAGTTCATCACATCATGG - Intergenic
1044127376 8:88474745-88474767 CTTCACTGTGCCTCACAAGCAGG - Intergenic
1044599866 8:93992762-93992784 CTTATCAGGGCCTCTCAATCAGG - Intergenic
1050036544 9:1442191-1442213 CTTCTCATTGCATCACAGCCTGG + Intergenic
1050435902 9:5610576-5610598 GTTCTCAGTGAAGCACAGTCTGG + Intergenic
1051845232 9:21444566-21444588 CCTCTCAGGGAATCACAACCTGG + Intergenic
1054723263 9:68624528-68624550 CTTCTCAGTGTGTCACATTAGGG - Intergenic
1056907360 9:90665363-90665385 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1057561184 9:96129162-96129184 CCTCCCACTGCATCACAAGCTGG - Intergenic
1058584945 9:106497422-106497444 CTTCTAAGGGCATCTCAAGCAGG + Intergenic
1203432208 Un_GL000195v1:101471-101493 CCTCTCAGTGCCTCAGAAGCAGG + Intergenic
1187451924 X:19405301-19405323 CTTCTCAGTGCCTCATAACAAGG - Intronic
1187631657 X:21179536-21179558 TTTATCAGTGCATCATAATATGG - Intergenic
1188743762 X:33817092-33817114 CTTCTCTGTGCCTCACAAACAGG + Intergenic
1191642396 X:63441633-63441655 CGTCTCAGTGCTCCACAATCAGG - Intergenic
1192005935 X:67212400-67212422 CCTCTCAGTACCACACAATCAGG + Intergenic
1192620708 X:72677240-72677262 CTTCTCAGTGCATCATAGCAGGG + Intronic
1195346440 X:103954712-103954734 CTTCTCTGTGCCCCACAAGCAGG - Intronic
1195537220 X:106022587-106022609 CTTCACAGTGCTTCTGAATCTGG - Intergenic
1195567809 X:106363204-106363226 CTTCTCTGTGCCCCACAAGCAGG + Intergenic
1195891794 X:109703226-109703248 CTTCTCAGTGAATCAAACTAGGG - Intronic
1196165043 X:112529598-112529620 TTTCTGAGTACATCAGAATCAGG - Intergenic
1197404208 X:126029771-126029793 CTTCTCTGTGCACCACAAGCAGG + Intergenic
1197480859 X:126984217-126984239 ATTCTAAGTGCACCACAACCAGG - Intergenic
1198644052 X:138787264-138787286 TTTCTCTGTGCAGCAAAATCTGG - Intronic
1198948773 X:142045129-142045151 TTTCTCAGTGAATCAAAATTAGG + Intergenic