ID: 929706113

View in Genome Browser
Species Human (GRCh38)
Location 2:44213926-44213948
Sequence TTCTTTATGAATGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 540}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929706113_929706118 17 Left 929706113 2:44213926-44213948 CCTTCTTCCTCATTCATAAAGAA 0: 1
1: 0
2: 2
3: 49
4: 540
Right 929706118 2:44213966-44213988 TTAGGAAGAGCTCTCTAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 120
929706113_929706117 -1 Left 929706113 2:44213926-44213948 CCTTCTTCCTCATTCATAAAGAA 0: 1
1: 0
2: 2
3: 49
4: 540
Right 929706117 2:44213948-44213970 AACTGGGTAGTTTTTATTTTAGG 0: 1
1: 0
2: 2
3: 298
4: 656
929706113_929706119 25 Left 929706113 2:44213926-44213948 CCTTCTTCCTCATTCATAAAGAA 0: 1
1: 0
2: 2
3: 49
4: 540
Right 929706119 2:44213974-44213996 AGCTCTCTAGTTTGGTCAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929706113 Original CRISPR TTCTTTATGAATGAGGAAGA AGG (reversed) Intronic
901272376 1:7962210-7962232 TTTTTAATGACTGAGAAAGATGG - Intronic
901674548 1:10875256-10875278 TTCTTGAGGCAGGAGGAAGAGGG - Intergenic
903073722 1:20744906-20744928 TTCTTGATGACTGTGGATGAGGG + Exonic
903429914 1:23287624-23287646 ATTTTCATGAAAGAGGAAGAGGG - Intergenic
903482162 1:23661665-23661687 CCCTCTATGAATCAGGAAGAGGG - Intergenic
904371321 1:30049190-30049212 GTCCATATGTATGAGGAAGAAGG - Intergenic
904860236 1:33532485-33532507 TGCTGTAGGAATGAGGAGGAAGG - Intronic
905565624 1:38962145-38962167 ATCTTTATGAGGGAGGCAGAGGG + Intergenic
905625195 1:39485393-39485415 TTCTGTATGGATGAGGAAACTGG + Intronic
905937791 1:41838574-41838596 TTCTTGATGAATTAGAAAGCAGG - Intronic
907488822 1:54795750-54795772 TTCTGTATCTATGAGGAGGAGGG + Intronic
907810475 1:57864847-57864869 TTCATTACGAATGAGCAAGGAGG - Intronic
907861630 1:58359234-58359256 TTCTTCATATATGAAGAAGAGGG - Intronic
908944991 1:69484844-69484866 CTCTTTATGAAGGAGGAAGCTGG + Intergenic
909239387 1:73192806-73192828 TTGTTTATGAACCAGCAAGAAGG - Intergenic
909592872 1:77371325-77371347 TTCTCTATGCAAGAGGACGAAGG + Intronic
909666900 1:78144274-78144296 TTCTTGGAGAATGAGGATGAGGG + Intergenic
909678016 1:78258977-78258999 TTCTTTAAGAATGTTGAATATGG - Intergenic
909877372 1:80824714-80824736 TTTTTAATGAATGAGGAAACAGG + Intergenic
910420405 1:87055325-87055347 TTCTTTACTGAGGAGGAAGATGG - Intronic
910575921 1:88763639-88763661 TTCTTTAAGTCTGAGGAGGATGG - Intronic
910773761 1:90854480-90854502 TTCTACATGAAGGAGGAAAAAGG - Intergenic
912164869 1:107031066-107031088 GCCTTTAAGAATGAGGATGAGGG - Intergenic
912197769 1:107419609-107419631 TTTTTTTTGAAGAAGGAAGAAGG - Intronic
913533319 1:119748595-119748617 TCCTTTGTGAAAGAGCAAGATGG - Exonic
915802288 1:158807334-158807356 ATCTGTAGGAATGAGGAAAATGG + Intergenic
916091137 1:161308779-161308801 ATCTTGATGTATAAGGAAGAGGG - Intronic
916299799 1:163261319-163261341 GTCTTTATGTATGAGCAGGAAGG - Intronic
917267896 1:173241374-173241396 TTCCTTTTGCATGAAGAAGACGG + Intergenic
917478377 1:175388209-175388231 TTCTTTATCCATGAGAAAGAAGG + Intronic
917665657 1:177222906-177222928 TTCTTAATGATGGAGGAGGATGG + Intronic
917908417 1:179613609-179613631 CTATCTATGAATGAGGAAGAAGG - Intronic
918079197 1:181192606-181192628 ATCCTGATGAATGAGGGAGAGGG - Intergenic
918639684 1:186824839-186824861 TTCTTTAGTAATGATGGAGATGG + Intergenic
919141892 1:193582740-193582762 TTCTGTATTTATGTGGAAGAAGG + Intergenic
919164298 1:193872711-193872733 TTCTTTAAGAATGTTGAATATGG - Intergenic
919797454 1:201329835-201329857 TTCTTTCTTAGTGAGGAAGACGG + Intronic
920605207 1:207376259-207376281 TTCTTAATGATTTAGGAACAAGG - Intergenic
920724345 1:208419792-208419814 TGCTTCATGAAAGAGTAAGATGG + Intergenic
920866900 1:209760486-209760508 TACTATATGACTGAGGAAGAAGG - Intronic
921066536 1:211626856-211626878 TGCTCTATCAATGAGGCAGAAGG - Intergenic
921101692 1:211934129-211934151 TTCTCTGTGATTGGGGAAGATGG - Intergenic
921693129 1:218176334-218176356 TTCTTGATGAAGGAGGAGCAAGG - Intergenic
922050534 1:221985838-221985860 TTCTTTATGAATGAACCAAATGG + Intergenic
922144706 1:222929514-222929536 TTCTTGTTGAACGAAGAAGAAGG + Intronic
922594270 1:226801921-226801943 TTCTTTATTACTTAGGAAGAAGG + Intergenic
922662631 1:227443548-227443570 TTGTTTATGACTGAGGGAGAGGG - Intergenic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
923697956 1:236273139-236273161 TTCTTTATGAGAGAGGAAGGCGG + Intronic
1064652284 10:17521677-17521699 TTGGATATGAATGAGGGAGAAGG - Intergenic
1065586239 10:27220071-27220093 TCCTTTCTGAATCAGGCAGAGGG + Intronic
1065863633 10:29893619-29893641 CTCTTTATAACTGAGGAAGATGG - Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1067454785 10:46411665-46411687 TTCTTTGAGAATGAGAAAGCAGG + Intergenic
1067632419 10:47972969-47972991 TTCTTTGAGAATGAGAAAGCAGG - Intergenic
1067658840 10:48218447-48218469 TTCTTTTTGAAGGAGGAAATGGG + Intronic
1067929382 10:50544965-50544987 TTCTTTATGAAGGAGCACAAGGG + Intronic
1067992137 10:51226452-51226474 GTCTTTATCAATGAGTATGAGGG + Intronic
1068529107 10:58164725-58164747 TGCTGAATGAATGAGCAAGAGGG - Intergenic
1068598514 10:58930868-58930890 TTTTTTAGAAATGAGGCAGAAGG - Intergenic
1068810885 10:61255080-61255102 TTCTTTATGAATGTTGAACATGG + Intergenic
1068990602 10:63146466-63146488 TTCTTTCTAAATCATGAAGATGG + Intronic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069208777 10:65729606-65729628 TTCTTTAAAAATGAGGGTGATGG + Intergenic
1069581078 10:69567430-69567452 ATCTTCATAAATGAGGAAAAGGG + Intergenic
1070519985 10:77244219-77244241 TTCCTGAGGAATGAGGATGAGGG - Intronic
1070546174 10:77454590-77454612 AACTTTATGAATGAGGAATGAGG - Intronic
1070872088 10:79764925-79764947 TTCTTTAAGAATGTGGAAGGAGG + Intergenic
1070985915 10:80689755-80689777 ATGTTTATGAATGGGCAAGAAGG + Intergenic
1071057848 10:81531543-81531565 TTCTTTAAGAATGAAGAATGGGG + Intergenic
1071214229 10:83380208-83380230 TTCACTCTGAATGAGGATGAAGG + Intergenic
1071294719 10:84211403-84211425 TCCTTTATAAATGAGGAAGAGGG - Intronic
1071639006 10:87287093-87287115 TTCTTTAAGAATGTGGAAGGAGG + Intergenic
1071656232 10:87450857-87450879 TTCTTTAAGAATGTGGAAGGAGG - Intergenic
1072014780 10:91335930-91335952 TTCTTTATGGAAGTGCAAGAAGG + Intergenic
1072185537 10:93034715-93034737 TTCTTTTATGATGAGGAAGAAGG + Intronic
1072292091 10:93973407-93973429 TTGTCCATGTATGAGGAAGAGGG + Intergenic
1072733217 10:97862009-97862031 TGCTGCATGAGTGAGGAAGAAGG + Intronic
1073001551 10:100289631-100289653 CTCTCTATGAATCAGGAAGTGGG + Intronic
1073235529 10:102012132-102012154 TTCTTTTTAAAGGAGGAGGAAGG + Intronic
1073386629 10:103130684-103130706 TCACTAATGAATGAGGAAGAGGG - Intronic
1073783971 10:106867581-106867603 TTCTTTAAGAATGTTGAATATGG - Intronic
1073879578 10:107965211-107965233 TTCTCTATAAGTGAGGAACAAGG - Intergenic
1074003540 10:109395301-109395323 TTCTTTAAGAATGTTGAATATGG - Intergenic
1075989356 10:126821626-126821648 TACTTTAAGCATGAGAAAGATGG + Intergenic
1078662783 11:13300444-13300466 GTTTTCATGAATGAGGAAGCAGG + Intronic
1079087596 11:17457944-17457966 GTCTTTATGAATGACAAAGAAGG - Intronic
1079256147 11:18832848-18832870 TTCTTTAAGAATGCTGAAAATGG + Intergenic
1079548128 11:21660204-21660226 TTGTCTATGAACTAGGAAGAAGG - Intergenic
1079844615 11:25449332-25449354 TCTGGTATGAATGAGGAAGAGGG - Intergenic
1080166193 11:29240749-29240771 TTCTTTATGAAGCAGGTAGTTGG + Intergenic
1080532728 11:33192740-33192762 TGCTTTAAGCACGAGGAAGAGGG + Intergenic
1080736826 11:35023809-35023831 TTCTTTAAGAATGTTGAATAGGG - Intergenic
1081271616 11:41091499-41091521 TTCTTTTAGAATGAGGAAAAAGG + Intronic
1082127641 11:48452113-48452135 TTCTTTAAGAATGTTGAATATGG + Intergenic
1082876088 11:57990730-57990752 TTCTTTAAGAATGTTGAAGCCGG + Intergenic
1083002274 11:59303636-59303658 TTATTAATAAATGAGTAAGAAGG - Intergenic
1083194388 11:61075340-61075362 TTGTTGATGAATGATAAAGAAGG + Intergenic
1083737367 11:64689137-64689159 TGCTTTATGGTTGAGGAAGCTGG - Intronic
1084331806 11:68434832-68434854 CTCTTTGTGAATGAGGACGTAGG - Intronic
1085039644 11:73319360-73319382 TTCTTAAAGAAGGAGGAAGGAGG - Intronic
1085588448 11:77733861-77733883 TTGTTTAGGAATGAAAAAGATGG - Intronic
1085866372 11:80299260-80299282 TTCTTTAAGAAGGAGCATGATGG - Intergenic
1086192350 11:84094589-84094611 TTATCTATGAACCAGGAAGAGGG - Intronic
1086372273 11:86166834-86166856 TTCTTTTTCAAAAAGGAAGAAGG + Intergenic
1086814531 11:91352445-91352467 TACTTTATAAATGAGAAACAGGG - Intergenic
1087002267 11:93433148-93433170 TAGTTTATGAATGAAGAAAATGG - Intronic
1087466100 11:98508318-98508340 TTCTTTGTGTATGTGGGAGAAGG + Intergenic
1087959487 11:104330563-104330585 TCCTTTATTAAGGAGGAACAGGG + Intergenic
1088390779 11:109312530-109312552 TTCTTTATAAATGAGAAATAAGG + Intergenic
1088700290 11:112405525-112405547 ATTTCTGTGAATGAGGAAGAGGG + Intergenic
1089355742 11:117851665-117851687 TTCTTTAGGAATAAAGAAAATGG - Intronic
1090027517 11:123180427-123180449 CTCTCTATGAACGAGGAAGCAGG + Intronic
1090190384 11:124762714-124762736 GTCTTCCTGAAGGAGGAAGAGGG + Intergenic
1090263051 11:125335410-125335432 TTCTCTGTGAATGAGGGAGGAGG + Intronic
1090703159 11:129314536-129314558 TTATAGATGAATGAGGAACAGGG - Intergenic
1091029350 11:132170669-132170691 TTCTTTATAAATGAGAAAGCTGG - Intronic
1091147724 11:133294543-133294565 TTCTTCATTGATGAAGAAGATGG + Intronic
1091385386 12:91463-91485 TTCTTAAAGAACCAGGAAGATGG - Intronic
1091390583 12:123843-123865 ATTTTTATAAATGAGGAACAGGG - Intronic
1091443671 12:530772-530794 ATTTTTACCAATGAGGAAGATGG + Intronic
1092126109 12:6075968-6075990 TTCACTATGAATGAGGGGGATGG + Intronic
1092662120 12:10749819-10749841 TTCTATATCAGTGAGGAAGATGG + Intergenic
1092766612 12:11858921-11858943 TTCTTTGTGAAAGATGGAGAGGG + Intronic
1093417443 12:18935786-18935808 TTCTTTAGTAAGGAGGGAGAGGG + Intergenic
1093649389 12:21625866-21625888 TTCTTTAAGAATGTTGAATATGG + Intergenic
1093661790 12:21766000-21766022 TCCATTGTGACTGAGGAAGAAGG - Exonic
1093985540 12:25528348-25528370 TACTTGTTGAATGAGGCAGAAGG - Intronic
1094405499 12:30111706-30111728 TTCTTCATCAAAGAGAAAGAAGG + Intergenic
1095553154 12:43468642-43468664 TGCTTTATTAATGAAGAAAAAGG - Exonic
1096961736 12:55585705-55585727 TTCTTTAGGAAAGAGAAACATGG - Intergenic
1097470258 12:59981704-59981726 TCATCTATGAATTAGGAAGAGGG + Intergenic
1097586492 12:61522080-61522102 TCCTGTATGAAGGATGAAGATGG + Intergenic
1098010795 12:66049034-66049056 TTTTTTTTGGAAGAGGAAGAAGG - Intergenic
1098014779 12:66092682-66092704 TTTGCTATGAATGAGTAAGATGG + Intergenic
1098196390 12:68006454-68006476 TCCTTCATGAGTGAGGGAGATGG - Intergenic
1099313773 12:81060548-81060570 TTCTTTAAGAATGTTGAATATGG + Intronic
1100747120 12:97658459-97658481 TTCTTTTAGAAGGATGAAGATGG - Intergenic
1101726304 12:107391224-107391246 TGCTTTATAGATGAGGAAGCTGG + Intronic
1101757921 12:107635748-107635770 TTCCTTCTGAGTGAGGAAGAAGG - Intronic
1104199650 12:126575998-126576020 ATCTTTATAAATGATAAAGAAGG - Intergenic
1106206517 13:27601322-27601344 TTCTTTAATGATGGGGAAGAGGG - Intronic
1106731300 13:32544121-32544143 TCATTTATCAAAGAGGAAGATGG - Intergenic
1106786821 13:33115535-33115557 TGTTTTCTTAATGAGGAAGAAGG - Intronic
1107991745 13:45824793-45824815 TTTTTAATAAATGAGGAATAAGG - Intronic
1109382551 13:61583727-61583749 TACATTATAAATGAGGAAAATGG - Intergenic
1110152255 13:72269788-72269810 TTCTTTAAGAATGTTGAATACGG + Intergenic
1111652234 13:91106057-91106079 TTCTTTATGAAAAAGAAAAATGG + Intergenic
1112089779 13:96070506-96070528 TGCTTCCTGAATGAGGAAAAGGG + Intergenic
1112119112 13:96390446-96390468 CTTTTTATGAATGAGGAAGCAGG + Intronic
1113450923 13:110408601-110408623 TCCTTTAGGAGTGAGGAAGCGGG + Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115593379 14:34885709-34885731 CTCCTTCTGAATGAGAAAGAGGG + Intergenic
1115752024 14:36503622-36503644 TTATTTTTGAAGGGGGAAGAGGG - Intronic
1115868663 14:37776620-37776642 TTCTTTAAGAATGCTGAATATGG + Intronic
1115899262 14:38126722-38126744 TTTTTTGTGAAAGATGAAGAAGG + Intergenic
1116313595 14:43359098-43359120 TGCATTATGAATGAGGAGAAGGG - Intergenic
1116980172 14:51160751-51160773 TTATTTAAGAAAGAGGAAGTAGG - Intergenic
1117333288 14:54735493-54735515 TTCTTTATGAATGAAAAGGGAGG - Intronic
1117933622 14:60875497-60875519 TACTTTATGAATGAGGAAATGGG - Intronic
1118095999 14:62537529-62537551 TTCTTTAAGAATGTTGAATATGG - Intergenic
1118299852 14:64605681-64605703 TTCTGGATGAATGAGGGAGTTGG + Intergenic
1119468066 14:74875341-74875363 TACTTTATGGATGAGGAACCAGG + Intergenic
1119583004 14:75804457-75804479 TTCTCTAGGATTGAGGCAGATGG + Intronic
1120017132 14:79486787-79486809 TCCTGAATGAATGATGAAGAAGG + Intronic
1120064488 14:80024822-80024844 ATCTTTATGAATGACGAAATTGG - Intergenic
1120315012 14:82880710-82880732 TTATTTCTGAACCAGGAAGATGG - Intergenic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1120718100 14:87861956-87861978 TCCTTTCTGAATGAGGAATCTGG - Intronic
1120968634 14:90189688-90189710 TTCTTCTTGAATGAAGAAGAAGG - Intergenic
1123754688 15:23388011-23388033 TTCTTTTTGAAAGAAAAAGAGGG + Intergenic
1124997706 15:34739917-34739939 TTTTTAAGGAATGAGGAAAAGGG - Intergenic
1125584660 15:40811741-40811763 TTTTTTATAAATGAGGAAACAGG + Intronic
1127095236 15:55506173-55506195 TTGTTTATTATTGAGAAAGAGGG - Intronic
1128895679 15:71371581-71371603 TTCTTTAAGAATGTTGAATATGG + Intronic
1129194939 15:73958282-73958304 TTCTTTATGGGTGAGAGAGAGGG + Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129989021 15:79945458-79945480 TTCTTGCAGTATGAGGAAGACGG + Intergenic
1131161062 15:90105122-90105144 TACTTTTTGAAGGAGAAAGAGGG + Intergenic
1134889055 16:17822433-17822455 TTCTTACTCAAGGAGGAAGATGG - Intergenic
1135027690 16:19011254-19011276 TTCTTCAAGAATGGGGGAGATGG - Intronic
1135082125 16:19445410-19445432 TTTTTTATGCTTGAGAAAGATGG + Intronic
1136713107 16:32256405-32256427 TTCCCTATGAATGTGGATGATGG - Intergenic
1136754805 16:32673022-32673044 TTCCCTATGAATGTGGATGATGG + Intergenic
1136813307 16:33197342-33197364 TTCCCTATGAATGTGGATGATGG - Intronic
1136819783 16:33307422-33307444 TTCCCTATGAATGTGGATGATGG - Intergenic
1136826347 16:33363962-33363984 TTCCCTATGAATGTGGATGATGG - Intergenic
1136831413 16:33462733-33462755 TTCCCTATGAATGTGGATGATGG - Intergenic
1136998035 16:35204226-35204248 TTCCCTATGAATGTGGATGATGG + Intergenic
1137024441 16:35458332-35458354 TTCCCTATGAATGTGGATGATGG + Intergenic
1137670700 16:50276598-50276620 TAATTTATGAATGAGTGAGATGG + Intronic
1138317484 16:56082647-56082669 TTGTCTATGAACCAGGAAGAGGG - Intergenic
1138452661 16:57102980-57103002 TTCTTAATGTCTGGGGAAGAGGG - Intronic
1138788766 16:59877480-59877502 ACCTTTATAAATGGGGAAGATGG - Intergenic
1139237361 16:65354174-65354196 ATTTTTATCAATGTGGAAGATGG - Intergenic
1140377542 16:74456811-74456833 TTCTGTAAAGATGAGGAAGAGGG + Intronic
1141856824 16:86687250-86687272 TTCTTTGTTCATGAGGAATATGG - Intergenic
1202991884 16_KI270728v1_random:20317-20339 TTCCCTATGAATGTGGATGATGG - Intergenic
1203056949 16_KI270728v1_random:933357-933379 TTCCCTATGAATGTGGATGATGG + Intergenic
1143051643 17:4130850-4130872 TTTTTTAAGACTGAGGAAAAAGG + Intronic
1147354287 17:39881362-39881384 GTCTTTATGAAACAGGAAGAAGG + Intergenic
1147907092 17:43830515-43830537 TATTTTATGAATGAGGAAATGGG + Intronic
1148049891 17:44764712-44764734 CATTTTATGAATGAGGAAGGTGG - Intronic
1149195365 17:54113249-54113271 TTCTTTATGGATGAACAAAATGG + Intergenic
1150658383 17:67055532-67055554 TTCTTGGGGGATGAGGAAGAGGG + Intronic
1150683802 17:67304228-67304250 TCCATTAAGAAGGAGGAAGACGG + Intergenic
1150929903 17:69573183-69573205 TTCTTAAAGGAGGAGGAAGAGGG - Intergenic
1151139014 17:71974171-71974193 TTATTTATGAATGAGGTCGAGGG - Intergenic
1153209571 18:2746019-2746041 TTCTTTATAAATGAGGGAACTGG + Intronic
1153894918 18:9549949-9549971 TTCCTTAAGAGTAAGGAAGAGGG + Intronic
1153957187 18:10107485-10107507 TTCTTAAAAATTGAGGAAGAGGG - Intergenic
1154180934 18:12139346-12139368 TTCTTTAAGAATGTTGAAGCTGG + Intergenic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156886741 18:42143386-42143408 TTCTTTAAGAATGCTGAAAATGG - Intergenic
1159199725 18:65168213-65168235 TTCTTTAAGAATGTTGAATATGG - Intergenic
1164237202 19:23347597-23347619 TTGTTTGAGAGTGAGGAAGAAGG - Intronic
1164397935 19:27882182-27882204 TTCTTTGGGTTTGAGGAAGAAGG - Intergenic
1167068809 19:47207323-47207345 TGTTTTATGGATGAGGAAAAGGG + Intronic
1167091994 19:47350731-47350753 TTTTTTTTTAATGAGAAAGATGG + Intronic
925224030 2:2167075-2167097 TTCTTTATGAATAATAATGAGGG + Intronic
925334307 2:3082298-3082320 TTCTTTATTAATGAGGCAAGGGG + Intergenic
925823015 2:7819137-7819159 TTTCTTCTGAATGAGGAAGCTGG - Intergenic
927672233 2:25078460-25078482 TTCTTGGTGAATGCGGAGGAGGG + Intronic
927728205 2:25444727-25444749 TTATTTAACAATGTGGAAGAAGG + Intronic
927912958 2:26914584-26914606 TTCTTTATTGATGAGGCTGAAGG + Intronic
929421122 2:41790639-41790661 TCCTTTAGGAAAGAGGAAGAAGG - Intergenic
929560945 2:42956052-42956074 TTCTTTCCTAATGAGGAAGGTGG - Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930269916 2:49244001-49244023 TTCTTTAAGAATGTTGAATATGG - Intergenic
931638725 2:64362976-64362998 AGCTTTGGGAATGAGGAAGAAGG - Intergenic
931868598 2:66436883-66436905 TTTTTTCTGGAAGAGGAAGATGG + Intronic
932868018 2:75367338-75367360 TTCTTTAAGAATGCTGAAAATGG + Intergenic
933136643 2:78743682-78743704 GTTTTTATGAAAGAGGAATAAGG - Intergenic
933610455 2:84428960-84428982 TTCTTTATGAATGAGAAAACTGG - Intronic
933854783 2:86402660-86402682 ACCTTTATGAATGAGGAAACAGG + Intergenic
933856321 2:86418058-86418080 TTCCTTATGAAAAAGGAAGACGG - Intergenic
934169139 2:89324994-89325016 TTCTTTCTGAATGATAATGAGGG - Intergenic
934198154 2:89857590-89857612 TTCTTTCTGAATGATAATGAGGG + Intergenic
935372511 2:102362143-102362165 TACGTTCTGAAGGAGGAAGATGG + Intronic
935383046 2:102472932-102472954 GTCTCTATACATGAGGAAGAAGG - Intergenic
936659674 2:114528819-114528841 TTGATGATGAATCAGGAAGAAGG - Intronic
937167490 2:119835059-119835081 TCCTTTATAAAGCAGGAAGAAGG - Intronic
937171558 2:119876266-119876288 TTCTTTATGGAGCATGAAGAGGG + Intronic
937713531 2:125006184-125006206 TTCACAATGAATGAGGAACAAGG - Intergenic
938224101 2:129600881-129600903 TTCTTTAAGAATGTTGAATATGG + Intergenic
938995985 2:136678197-136678219 TACTTTACGTATGAGGAAAATGG + Intergenic
940197884 2:151115886-151115908 TTCTTCCTTTATGAGGAAGAAGG - Intergenic
940772856 2:157857430-157857452 TTCCTTATGGTGGAGGAAGACGG - Intronic
941388661 2:164884336-164884358 TCTTTTATGAGGGAGGAAGAGGG - Intergenic
941395409 2:164967651-164967673 TTCTTTAGGAATGGGGAAAGTGG + Intergenic
941460615 2:165767030-165767052 TTATTTATGAATGATGAAGAAGG - Intronic
941767963 2:169318653-169318675 TTCTTTATAAATGTGGAGCAGGG - Intronic
941895648 2:170626850-170626872 TTCTTTAGGAATGTTGAATATGG + Intronic
942294166 2:174501534-174501556 TTCTTTATGGTTGGGGTAGATGG + Intergenic
942474044 2:176296618-176296640 TTGTTTTTTAATGGGGAAGAGGG - Intronic
942865435 2:180667934-180667956 TTCTTTAAGAATGAGGATTATGG - Intergenic
943515800 2:188884945-188884967 TTCTTTATTAGTTAGCAAGATGG - Intergenic
943657688 2:190527085-190527107 TTCTTTAGGAAACAGGAACAAGG + Intronic
943755608 2:191553920-191553942 TTCTTTTTACCTGAGGAAGACGG + Intergenic
943918731 2:193674597-193674619 TTCTTTATACATGGAGAAGACGG + Intergenic
944255122 2:197617870-197617892 TTTTTTATCTATGAAGAAGAAGG - Exonic
944286844 2:197960127-197960149 TTTTTTATTAATGTGAAAGAAGG - Intronic
944687860 2:202133694-202133716 ATCTTCCTGAATGAGGAGGAGGG - Intronic
944789054 2:203105160-203105182 TTCTTTAAGAATGCTGAATATGG + Intronic
945523529 2:210859750-210859772 TTCTTTATAAATAAGATAGAGGG + Intergenic
946030807 2:216703311-216703333 TTGTTGGTGAATGAGGAAGGAGG + Intergenic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
946473190 2:219981926-219981948 GTTTTTAAGAATGAGGAAGTGGG + Intergenic
946545396 2:220736502-220736524 TTTTATATGAATGAACAAGATGG - Intergenic
946763007 2:223013695-223013717 TTCTTTAAGAATGTTGAATATGG - Intergenic
947166468 2:227267396-227267418 TTCTTTATGGAAGAGAAAGAGGG - Intronic
947282267 2:228468728-228468750 TTCTTTAAGATTGAGGAACTGGG + Intergenic
947881780 2:233521659-233521681 TTCTGTGTGAATTAGAAAGAAGG - Intronic
948261929 2:236610625-236610647 TTCTTTATGATAGAGTAGGATGG + Intergenic
1168736839 20:147639-147661 TTCTTGTTGAATAAGTAAGAGGG + Intergenic
1168848948 20:963630-963652 TTCATTAAGAATGATAAAGAGGG + Intronic
1168938126 20:1685658-1685680 TTCCTTCTTAAAGAGGAAGAGGG + Intergenic
1169526431 20:6431383-6431405 GTTTTTATAAATGAAGAAGATGG - Intergenic
1169724730 20:8716389-8716411 TTATTGATGAATGAGGTTGAGGG + Intronic
1170142150 20:13135296-13135318 TTCTTTCTGAGTTAGGAATATGG - Intronic
1170349134 20:15419793-15419815 TTCCTTAATTATGAGGAAGATGG + Intronic
1170350591 20:15436682-15436704 TGGTTAATGAAGGAGGAAGAGGG - Intronic
1170760274 20:19242659-19242681 CTCATTATGAATGAGGAAACTGG + Intronic
1171472469 20:25383087-25383109 TTCTTTACAGATTAGGAAGATGG - Intronic
1172473239 20:35216606-35216628 TTCTCAATGTATGAGGAAAATGG - Intergenic
1173092561 20:39987072-39987094 TACTTTTTGAAAGAGTAAGAGGG + Intergenic
1173366991 20:42395230-42395252 TTCTCTATGAAACAGGAAGCAGG - Intronic
1173388750 20:42612346-42612368 TTCTGAAAGAATGGGGAAGAGGG + Intronic
1173417738 20:42872639-42872661 TAATTTATGAATCAAGAAGAAGG - Intronic
1173659091 20:44720585-44720607 TATTTTATGAATGAGGAAACAGG + Intronic
1174379531 20:50147738-50147760 TTCTTTATGGATGAGAATTAAGG - Intronic
1174716377 20:52763213-52763235 CTCTTTATAGATGAGGAAGTCGG - Intergenic
1174761154 20:53208454-53208476 TGATTTGTGAATGAGGAAGCTGG + Intronic
1177643365 21:23872103-23872125 CTCATTAAGAATGAGGAAAATGG - Intergenic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1180250174 21:46580746-46580768 TTCTTTAAGAATGTTGAATATGG + Intergenic
1180599065 22:17002281-17002303 TTCTTTAAGAATGTTGAAAACGG - Intronic
1183099707 22:35576364-35576386 TTTTATAATAATGAGGAAGAAGG + Intergenic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1184183178 22:42845053-42845075 TTCTTTAGCGATGAGGAAGAAGG + Intronic
1184520251 22:44989482-44989504 TTGTTCATGAATGAGGAACGAGG + Intronic
949233692 3:1782617-1782639 ATGTTTATGAATGAGCAATATGG - Intergenic
949318413 3:2782552-2782574 TTCTTTGTTAATAAGGAAGGTGG - Intronic
950320583 3:12049067-12049089 TGCTCAATGAATGAGAAAGAAGG - Intronic
951358124 3:21693575-21693597 ATCTTTATGGATGAGAAAAATGG - Intronic
952130901 3:30361572-30361594 TTCTTCAGGAATGAAGAAAATGG - Intergenic
953601238 3:44366962-44366984 TTCTCTATGATTGAAGGAGATGG - Intronic
953859238 3:46528299-46528321 TTTTTTTTTAATGAGAAAGACGG + Intronic
955012384 3:55030992-55031014 TTCTTAATGTGTGGGGAAGAGGG + Intronic
955058616 3:55477267-55477289 ATTTTTATGAAAGAGGAACATGG - Intronic
955778007 3:62454384-62454406 TCCTTTATGAATGAGGAAACTGG + Intronic
956138982 3:66126764-66126786 ATCCTTAGGAATGAGGAATATGG + Intergenic
956988514 3:74733430-74733452 TTCTAGATGAATGAGGCATATGG + Intergenic
956989755 3:74749928-74749950 TTATTTAAGAATGAAGAACAGGG - Intergenic
957993495 3:87657247-87657269 TTTTTTATTATTGATGAAGAAGG - Intergenic
958116392 3:89224483-89224505 TTATTTCTGAAGAAGGAAGATGG + Intronic
958540051 3:95459459-95459481 ATCTTGATAAATTAGGAAGAAGG - Intergenic
958609029 3:96400579-96400601 TTTTGTATGAAGGATGAAGAAGG - Intergenic
958869495 3:99540747-99540769 TTTTTTTTGAAAGAGGATGAAGG - Intergenic
959001877 3:100973598-100973620 TTCATTATGAATGAAGATAAGGG + Intronic
959361650 3:105401736-105401758 TTCCTTAATAATGAGAAAGACGG - Intronic
959538441 3:107513247-107513269 TTGTTTTTGAAGGAAGAAGATGG + Intergenic
959998885 3:112709788-112709810 TTCTTTAAGAATGTTGAATATGG + Intergenic
960428183 3:117535157-117535179 TATTTTATGAATGAGGAAATTGG - Intergenic
960641396 3:119827317-119827339 ATCTCTATGAATAATGAAGAGGG - Intronic
960659844 3:120045490-120045512 TTTTTTTTAAATAAGGAAGAGGG - Intronic
963215994 3:142748785-142748807 TTCTTTATAAATGAGATAGGAGG - Intronic
963737346 3:149034777-149034799 TTATTGATGAAGGAGGAAAAAGG + Intronic
963983484 3:151566214-151566236 TAGTTTATGAATTAGGAAGCAGG + Intergenic
964328687 3:155575997-155576019 TTCTTATGGATTGAGGAAGAAGG - Intronic
964431694 3:156613697-156613719 TTCTTTCTCAATGAGAAAGCAGG + Intergenic
964691702 3:159457189-159457211 TCCTTTTTAAATGAGGAAGTTGG - Intronic
965219298 3:165905538-165905560 CTATTTATGAAGGAGGAAGGAGG - Intergenic
965243901 3:166241273-166241295 TTCTTAATGAACAAGGCAGATGG - Intergenic
965249514 3:166325111-166325133 GTCTTTTTGAACGAGGAACAAGG + Intergenic
965376177 3:167926999-167927021 TTATTCATGTAGGAGGAAGAGGG - Intergenic
965472372 3:169110435-169110457 GACTTGATGAAAGAGGAAGAGGG + Intronic
965812441 3:172605342-172605364 TATTTTATGAAGGAAGAAGAAGG - Intergenic
966293459 3:178388050-178388072 CTCTTTTTGAATGAGAAAAATGG - Intergenic
966487372 3:180486217-180486239 TTCTTTAAGAATGTTGAATATGG - Intergenic
966693401 3:182763986-182764008 CTCTTTATGATTGAGCAAGTAGG + Intergenic
966772078 3:183512975-183512997 TTCTCTATAAATGAGAAAGTTGG - Intronic
967185335 3:186939845-186939867 TGCTTTATGGATGAGGATGGGGG + Intronic
967360536 3:188625254-188625276 TTTCTTATGAATGGGCAAGATGG - Intronic
967384666 3:188899626-188899648 TTCTCTAAGAAAGAGGGAGACGG - Intergenic
967399269 3:189042507-189042529 TACTTTTTGAATGAAGAGGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968137376 3:196228792-196228814 TTCTTCCTGAGTGGGGAAGAGGG - Exonic
970124906 4:12798085-12798107 TTCGTTAAAAAGGAGGAAGATGG + Intergenic
970430325 4:15983159-15983181 TTCTACAGGAATGAGGAAAACGG + Intronic
970462796 4:16292409-16292431 CTGTTTATCAATGAGGAAGTGGG + Intergenic
970554677 4:17219459-17219481 TTCTTCATGAATGAGGAAACAGG - Intergenic
970726753 4:19055139-19055161 ATCATCATGAATGAGCAAGAAGG + Intergenic
971370227 4:26013086-26013108 TTTTTTATGAAGCAGGGAGAGGG - Intergenic
971453729 4:26823890-26823912 TTCTGTATAAAGAAGGAAGAGGG - Intergenic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
971888001 4:32477658-32477680 TTCTTTATGAATTTGCAAAATGG - Intergenic
972027977 4:34411421-34411443 TTCTTTAAGAATGACAAATATGG + Intergenic
972786503 4:42331400-42331422 TTCTATTTGTATGAAGAAGATGG + Intergenic
973051426 4:45602800-45602822 TTCTTTGTCATTGATGAAGAGGG - Intergenic
973178418 4:47237494-47237516 TTCATTCTGACTGAGGAAAATGG + Intronic
973200013 4:47489932-47489954 GCCTTTTTGAATGAGGAAGATGG + Intronic
973216200 4:47672011-47672033 TACATGATGAATGAGGAAGCTGG + Intronic
974621753 4:64364862-64364884 TTTTTTTTCATTGAGGAAGAAGG + Intronic
975255261 4:72227478-72227500 TTCTATATGAAAGAGTAATAAGG - Intergenic
975840288 4:78466406-78466428 TTCTTTATCATTGAGGAAGGGGG + Intronic
975919182 4:79363588-79363610 TTCTTTATGCATAAGGATTAGGG + Intergenic
975990405 4:80254013-80254035 TTATTTATTAATAAGGCAGAGGG - Intergenic
976815628 4:89145756-89145778 TTCTTTATGAATGGGCTAAATGG - Intergenic
977645328 4:99405437-99405459 TGCTTTAGGAATGAGAAAAATGG - Intergenic
978650112 4:110993055-110993077 TACTTCAGGAATGAAGAAGATGG + Intergenic
978943661 4:114468769-114468791 ACCTTGATGAATGAAGAAGAGGG + Intergenic
979085745 4:116407407-116407429 TTCTTTAAGAATGTTGAATATGG - Intergenic
979192461 4:117878666-117878688 TTTTTCATGAATGTGGAAGGAGG - Intergenic
979596787 4:122543191-122543213 TTCTTAAAGGATGAGAAAGAGGG - Intergenic
979660224 4:123244581-123244603 TTGTTTAAGAATGATGGAGAGGG + Intronic
979753466 4:124309213-124309235 TTCCTAATTAATGAGGAAAAAGG + Intergenic
980025514 4:127761294-127761316 TTCTTTCTTGATGAGAAAGAAGG - Intronic
980029526 4:127811010-127811032 TTATTTATGAATTACCAAGATGG + Intronic
980104732 4:128576896-128576918 TTCTTTTTGAATTAGGTTGAAGG - Intergenic
980209919 4:129773536-129773558 TTCATTGTAAATGAGGAAGTAGG - Intergenic
980214041 4:129828090-129828112 TTTATTATGTTTGAGGAAGAAGG + Intergenic
980461368 4:133119027-133119049 TTCTATAAGAATGAGAAACAGGG - Intergenic
980473648 4:133280997-133281019 TTCTTTATGTATCAGGATTAAGG + Intergenic
980671471 4:136012998-136013020 TACTTTATGAAGGTGGAAGTTGG + Intergenic
980797397 4:137701934-137701956 TACTTAAAGAATGAAGAAGAAGG + Intergenic
981149635 4:141366688-141366710 TTCTTTAAGAATGTTGAAGCCGG + Intergenic
981387811 4:144152207-144152229 TTCTTTAAGAATGTTGAATATGG + Intergenic
982876014 4:160650714-160650736 TTCTTTATGAGGGAGAAAGTGGG + Intergenic
983628927 4:169829379-169829401 TTCTTTAAGAATGTTGAACATGG - Intergenic
983694252 4:170509388-170509410 TTCTTTAAGAATGTTGAATATGG + Intergenic
983767863 4:171508616-171508638 TTCTTTGAGAATGTTGAAGAAGG - Intergenic
983874096 4:172856149-172856171 TTATTTAAGAATCAGCAAGAAGG - Intronic
984566692 4:181339632-181339654 TACTTTATGAAATAGAAAGAAGG - Intergenic
985045934 4:185940371-185940393 TTCTTCATGTATGGGGAATAAGG - Intronic
985263138 4:188133465-188133487 TTCTTTATAAATGAGAAATTAGG - Intergenic
986168888 5:5299516-5299538 TTTTTTTTTAATGGGGAAGAGGG + Intronic
986378641 5:7161126-7161148 TTCTTTAAGAATGTTGAATATGG + Intergenic
986834523 5:11620476-11620498 TTCTGTATGAAGGAAGAATAAGG - Intronic
986883677 5:12207426-12207448 TTCTTTAAGAATGTTGAATATGG + Intergenic
987165424 5:15193352-15193374 CTGTTTATGAAGGAGCAAGAAGG - Intergenic
987852206 5:23370668-23370690 TTCTTTCTGCATTAGAAAGAAGG + Intergenic
987937309 5:24482648-24482670 TTCCTAATAATTGAGGAAGAAGG + Intergenic
989192078 5:38680345-38680367 TTCTCTATGTATGACGATGATGG + Intergenic
989784800 5:45314202-45314224 TTCTTTAAGAATGTTGAATATGG - Intronic
990995183 5:61726147-61726169 TGATTTATGAATGTGGAGGAAGG + Intronic
991131305 5:63125487-63125509 CTCTTTCTGAATGAGGGAGATGG + Intergenic
991776517 5:70090549-70090571 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
991855804 5:70965996-70966018 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
991869819 5:71098774-71098796 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
992639895 5:78760268-78760290 TTCCTCGTGAATGAGGAAAATGG - Intronic
993102781 5:83561626-83561648 TTATTTATGAAAGAAGAAGAAGG - Intronic
993405034 5:87500450-87500472 TTTTTTTTGAATGAGGATTAAGG + Intergenic
993705430 5:91164228-91164250 TTCTTTATCAATAATGAAGCTGG - Intergenic
994064471 5:95521500-95521522 TTCTTTAAAAAGGAGAAAGAAGG + Intronic
994318197 5:98359231-98359253 TTCTTTAAGAATGCTGAATATGG + Intergenic
994707759 5:103226300-103226322 TTCTTTAAGAATGATAAAAATGG - Intergenic
995660629 5:114478740-114478762 TTCTTTAAGAATGTTGAATATGG - Intronic
997430788 5:133839418-133839440 TGCATTATGAATCTGGAAGAGGG - Intergenic
998274111 5:140735620-140735642 TTCTTTATGATTGAGATGGATGG - Intergenic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
1000143608 5:158431071-158431093 TCCTTTGTAAATGATGAAGAGGG + Intergenic
1000508662 5:162154086-162154108 ATCTTCATGCATGAGGGAGAAGG - Exonic
1000577194 5:162988889-162988911 TCCTCTATGAATGAGAAAGTGGG - Intergenic
1003222814 6:4176885-4176907 TTCTTTTTAAATGAGAAATATGG - Intergenic
1003698282 6:8435247-8435269 CTCCTTCTGGATGAGGAAGATGG + Exonic
1003710715 6:8586344-8586366 TTCTTTAAGAATGTTGAATATGG - Intergenic
1003713387 6:8618891-8618913 TTCTTTAAGAATGTTGAATATGG + Intergenic
1003859395 6:10308350-10308372 TTCTTTTTGAATGACCAAGTAGG - Intergenic
1004321128 6:14632587-14632609 TTTTTAATAAATGAGGAAGAAGG + Intergenic
1004561387 6:16754904-16754926 TTCTTTAAGGATGAGGAAGCAGG + Intronic
1004764409 6:18709331-18709353 TCCTTTATGAACCAGGAAGTGGG - Intergenic
1004826910 6:19432663-19432685 TACTTTTGAAATGAGGAAGAGGG + Intergenic
1005118348 6:22363286-22363308 TTCTTTATGGATTCTGAAGAAGG + Intergenic
1005373667 6:25160006-25160028 TTCTTTAAGAATGTTGAATATGG - Intergenic
1006060971 6:31418715-31418737 TTCTTTCTAAATTAGTAAGAGGG + Intergenic
1006164313 6:32055824-32055846 GTGTTTGTGAGTGAGGAAGATGG - Intronic
1006220872 6:32490165-32490187 ATCATGATGAATGAGGAACAGGG - Intergenic
1006428009 6:33978153-33978175 TTATTTGTGAAGGAGGAGGAAGG + Intergenic
1006611889 6:35298957-35298979 TTCTTAATGACCGAGGTAGAGGG + Intronic
1007228466 6:40331189-40331211 GTCTTTAGGAAGGGGGAAGACGG - Intergenic
1007257746 6:40540662-40540684 TTCATTATGAAGGAGAAACACGG + Intronic
1010058804 6:71598019-71598041 TCCTTCAGGAATAAGGAAGATGG + Intergenic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1012604096 6:101135280-101135302 TTTTTTATGAATGTGGTAGACGG - Intergenic
1012690054 6:102299194-102299216 TTCTTTAGAAATAAGGATGAGGG - Intergenic
1012908691 6:105095728-105095750 ATCTTTATGTATTAGGAAGCTGG + Intergenic
1014178201 6:118353174-118353196 TTCTTTATGGTTTAGTAAGATGG - Intergenic
1014852267 6:126356365-126356387 TTCTTTGGGAAAGATGAAGACGG + Intergenic
1014955569 6:127611261-127611283 TTCTTTATGGATCAGGTATAGGG + Intergenic
1015197994 6:130545036-130545058 TTCCTAATGATTGAGGAGGAAGG + Intergenic
1015242977 6:131046694-131046716 TTCTTTTTTAAGGGGGAAGAAGG + Intronic
1015866746 6:137734735-137734757 TTGTTTAATAATGAGGAAGATGG - Intergenic
1016134401 6:140521089-140521111 TACTTTATAAATAAGGATGAAGG - Intergenic
1016773488 6:147878236-147878258 CTATCTATGAATCAGGAAGAGGG - Intergenic
1017518377 6:155179029-155179051 TTCTTTATAGATGAGGCAGTTGG + Exonic
1017728686 6:157295277-157295299 TTCTTTATGGAAGAGGGAGTGGG - Intronic
1018884105 6:167918035-167918057 TTCTTTTTGAAGGAGAAGGAGGG + Intronic
1020464235 7:8458490-8458512 TTCTTAAGGAATAAGGATGAGGG - Intronic
1020693629 7:11389915-11389937 TTCTTTAAGAATGTCGAATATGG + Intronic
1021727335 7:23561277-23561299 TAACTTATGAGTGAGGAAGAGGG - Intergenic
1021808202 7:24377423-24377445 TTATATTAGAATGAGGAAGAGGG + Intergenic
1021916801 7:25442371-25442393 TTCTTTAAGAATGCGGAGGGAGG + Intergenic
1022843658 7:34189604-34189626 TTATTTATAAATAAGGAACATGG - Intergenic
1023015576 7:35966925-35966947 TTGTGTATGAATGAAAAAGAGGG + Intergenic
1023203755 7:37725733-37725755 TTCTTTTTGTAGGTGGAAGAAGG + Intronic
1023970245 7:44985669-44985691 TCCTTTCTGGCTGAGGAAGAAGG + Intergenic
1024065356 7:45727758-45727780 TTGTGTATGAATGAAAAAGAGGG - Intergenic
1024463922 7:49689136-49689158 TTCTTTATGTTTCAGGAGGAGGG - Intergenic
1025836292 7:65096890-65096912 TTCCCTATGATTGAGGAAGCTGG - Intergenic
1026391005 7:69901620-69901642 CTCTTTATGAATCATGGAGAAGG + Intronic
1027984091 7:85263236-85263258 TTCTTTAAGAATGAGGACAAGGG - Intergenic
1028176769 7:87669772-87669794 TTCTTTAAGAATGTTGAATATGG + Intronic
1028293579 7:89098760-89098782 TTCTTTTTAAATGGGGATGAAGG + Intronic
1028329847 7:89576579-89576601 TTCTTTAAGAATGTTGAATATGG - Intergenic
1028643668 7:93072114-93072136 TTCTTTAAGAATGTTGAAGATGG + Intergenic
1029805247 7:102989217-102989239 TTCCTTGTGAATGCAGAAGAAGG + Intronic
1029985243 7:104917004-104917026 TTCTTTATTAGTGAGCAGGATGG + Intergenic
1031282716 7:119824202-119824224 ATTTTAAGGAATGAGGAAGAGGG + Intergenic
1031512950 7:122671374-122671396 TAATTAATGAATCAGGAAGAGGG + Intronic
1031647662 7:124246336-124246358 TTTTAAATGAAAGAGGAAGAAGG - Intergenic
1032297240 7:130650746-130650768 TTCCTGATGAAAGAGGCAGATGG + Intronic
1033712042 7:143957594-143957616 TTCTTTTATAATGAGGGAGAAGG + Intergenic
1033884591 7:145929618-145929640 TTTTTTTTTAATGTGGAAGATGG - Intergenic
1034069259 7:148167101-148167123 TGCTTTATAAATTATGAAGAGGG + Intronic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034365453 7:150542516-150542538 TTTTTCATGATTGAGAAAGATGG + Intergenic
1034505882 7:151490550-151490572 TTCTGTAAGAATAAGGAACAGGG + Intronic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1035310811 7:157967402-157967424 TCCTTTCTGAATGCGGATGACGG + Intronic
1035464243 7:159064449-159064471 TTCGTTGTGAGTGAGGATGATGG + Intronic
1036052742 8:5218075-5218097 CTTTTTGTGAATGAGGAATATGG - Intergenic
1036949274 8:13125545-13125567 CTCTTTACAAATGAGGAAGCTGG + Intronic
1037017853 8:13930806-13930828 TTCCTTAAAAATGAGGAAAAAGG - Intergenic
1037641164 8:20744496-20744518 TTCTTTAAGAATGTTGAATATGG - Intergenic
1038222006 8:25618226-25618248 TTGTTTATAAATGACAAAGAAGG + Intergenic
1039551549 8:38446708-38446730 TTTTTTATAAATAATGAAGAAGG - Intronic
1039668760 8:39570317-39570339 CTATCTATGAATGAGGAAGCAGG + Intergenic
1039860664 8:41454525-41454547 TTCTCTATCAATTAGGAAGTGGG - Intergenic
1041285357 8:56255494-56255516 TTATCTAGGAATGGGGAAGAGGG + Intergenic
1041572692 8:59355314-59355336 GACCTTATGAATGAGGAAGCTGG + Intergenic
1041820636 8:62028575-62028597 TTATTTATGAAAGAGGAGAAAGG + Intergenic
1042007425 8:64197175-64197197 CTTGTTATGTATGAGGAAGAGGG + Intergenic
1042760503 8:72267144-72267166 TTCTTTGTGTTTGAGGAGGAAGG + Intergenic
1043314001 8:78897374-78897396 TGCTTTATGAATGACAATGAAGG - Intergenic
1044132254 8:88538788-88538810 TTTCTTATTAATGTGGAAGATGG - Intergenic
1044168599 8:89020654-89020676 TCCTTTATGCAGGAGGAAAATGG - Intergenic
1044233733 8:89807192-89807214 TTCTTAAAGAGTGAGGGAGAGGG + Intergenic
1044590095 8:93905964-93905986 TGCTTTATAGATGAGGAACAGGG - Intronic
1045062698 8:98423096-98423118 TTCTTGATGCATCAGGAGGAAGG + Intronic
1045979501 8:108168084-108168106 TTCTTTAAGAATGTTGAATATGG - Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047039202 8:120974180-120974202 TTCTTTATGTATGTGTATGAAGG + Intergenic
1048969817 8:139639174-139639196 TGCTTTATGGATGAGGAAGGTGG - Intronic
1049149487 8:141025400-141025422 TTCATTCTGAAGGTGGAAGAAGG - Intergenic
1049369449 8:142256877-142256899 TTCTTGGTGAATGAGGACCAGGG + Intronic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050451036 9:5781307-5781329 TTCTTTAAGAATGTTGAATATGG - Intronic
1050582573 9:7075963-7075985 TTTTCTATGACTGAGGAAAAGGG - Intronic
1051169555 9:14306536-14306558 TTATTAATTAATGAGGTAGAGGG - Intronic
1051357181 9:16250327-16250349 TTCTTTGGGAAAGAGGCAGAAGG - Intronic
1051560155 9:18431660-18431682 TTCTTTATCAAGGTGGAAGAAGG - Intergenic
1051613758 9:18987279-18987301 TTCTTGGAGTATGAGGAAGAGGG - Intronic
1053572842 9:39327742-39327764 TACTGTATGTATGAGGAGGAGGG + Intergenic
1054094406 9:60886451-60886473 TACTGTATGTATGAGGAGGAGGG + Intergenic
1054115876 9:61162363-61162385 TACTGTATGTATGAGGAGGAGGG + Intergenic
1054124302 9:61291269-61291291 TACTGTATGTATGAGGAGGAGGG - Intergenic
1054591880 9:67020181-67020203 TACTGTATGTATGAGGAGGAGGG - Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1054929592 9:70622169-70622191 GTCACTATGAATGAGGAAGCAGG + Intronic
1055260355 9:74425975-74425997 TTCTTTAAGAATGTTGAATATGG - Intergenic
1055316615 9:75040184-75040206 TTCTTTTGAAATCAGGAAGATGG + Intergenic
1055516331 9:77037183-77037205 TGCTTTAAGAATGAGGAGGTGGG - Intergenic
1056950073 9:91034723-91034745 TCCTTGGTGAGTGAGGAAGAAGG - Intergenic
1057438111 9:95061013-95061035 ATCTTTATGATTTAAGAAGAGGG - Intronic
1057638382 9:96793726-96793748 TTCTTTAAGAATGTTGAACATGG + Intergenic
1058062092 9:100508818-100508840 TTCCTTATGAATGTGAAAAAAGG + Intronic
1058614492 9:106811005-106811027 TTCTTTAAGAATGTTGAATATGG - Intergenic
1058955883 9:109948024-109948046 AACTTAATTAATGAGGAAGATGG + Intronic
1059786732 9:117594317-117594339 TTATGTATGGATGAGGAAGTTGG - Intergenic
1060249467 9:121973533-121973555 TTCTTTAAGAATGTTGAATATGG + Intronic
1060878926 9:127104125-127104147 TTCTCAATGAGTGAAGAAGAAGG - Intronic
1061633036 9:131885529-131885551 TACTTGACGAATGAGGAAGCTGG + Intronic
1062033642 9:134373075-134373097 TCCGTTATGGATGAGGAAGCGGG + Intronic
1062639853 9:137513529-137513551 TTATTTATGACTCAGGAATAAGG + Intronic
1185958139 X:4514704-4514726 TTCTACATGAATGAATAAGAAGG + Intergenic
1186307130 X:8273938-8273960 TTTTCTATGAATGAAGAAAATGG + Intergenic
1186450339 X:9667323-9667345 TTCTGTGTGTATGAGGAAGTTGG + Intronic
1186531337 X:10298951-10298973 TTCTTTCTTAATCAGGAAGATGG - Intergenic
1186743291 X:12539928-12539950 TTCTTTAAGAATGTTGAAGCTGG - Intronic
1186757423 X:12687347-12687369 TTGATAATGAATGAGGAAAAAGG - Intronic
1187181706 X:16948673-16948695 CTCTTTAGGAATTGGGAAGAAGG + Intronic
1187347844 X:18483252-18483274 TTCTTAATGAATGAGAAAATAGG + Intronic
1187963350 X:24586917-24586939 TTAATTATGAATGAGGAAAATGG + Intronic
1188255526 X:27957968-27957990 TTCTTTATAAATGTGGCATAAGG - Intergenic
1188702269 X:33279561-33279583 TTTTTTAAGAATGATTAAGAGGG + Intronic
1189164206 X:38843891-38843913 TTCGTTTCCAATGAGGAAGAAGG + Intergenic
1189533632 X:41912934-41912956 CTTTTTATAAATGAGGAAGCAGG + Intronic
1189793965 X:44629701-44629723 CTCTCTATGAAACAGGAAGAAGG + Intergenic
1190112706 X:47604981-47605003 TTCTTTGTGATTGGGGTAGAAGG + Exonic
1190980098 X:55449549-55449571 TTCATTATTAATTAGGAAAAAGG + Intergenic
1191007406 X:55724330-55724352 TTTTTTATGGATGAGGAAAAAGG - Intronic
1191087110 X:56580835-56580857 TTCTTTAAAAATGATGAAAATGG + Intergenic
1191152823 X:57239350-57239372 ATCTTTAAGAATGATGAATATGG + Intergenic
1191891429 X:65946747-65946769 TTCTTTAGGAATGATAAATATGG + Intergenic
1191928530 X:66342951-66342973 TTCTTTAAGAATGTTGAATATGG + Intergenic
1192550396 X:72048950-72048972 GTCTGTAAAAATGAGGAAGAAGG + Intergenic
1192563951 X:72147138-72147160 TTGTTCATTGATGAGGAAGAGGG - Intergenic
1193050198 X:77091097-77091119 TTCTTTAAGAATGTTGAATATGG - Intergenic
1193051196 X:77101712-77101734 TTCTTTAAGAATGTTGAATATGG + Intergenic
1193061324 X:77211199-77211221 TTCTTTAAGAATGTTGAATATGG + Intergenic
1193171340 X:78340086-78340108 TTCTTTAAGAATGCTGAATATGG + Intergenic
1193695582 X:84703729-84703751 ATCTTTATGAAGGAGAAAGGAGG + Intergenic
1193805384 X:85987485-85987507 TTCTTTAAGAATGTTGAATATGG - Intronic
1194241294 X:91452789-91452811 TACCTTATGAATGAATAAGAGGG + Intergenic
1194269161 X:91788732-91788754 TACTTTGTGACAGAGGAAGAGGG + Intronic
1195404074 X:104493636-104493658 TTCCTTAAGAATGAGGAGCAGGG + Intergenic
1195642431 X:107191296-107191318 TTATCTATGAATGAGAAATATGG - Intronic
1196205158 X:112931094-112931116 TTATATATGAATGAGGAAACGGG + Intergenic
1196326566 X:114412339-114412361 TTCTTTGTGACTGTGGAATATGG - Intergenic
1196583404 X:117401599-117401621 TTCTTTAGGAATGTTGAATATGG - Intergenic
1196642097 X:118073945-118073967 TACTTTATAAATGAGGAAACTGG + Intronic
1197423863 X:126271688-126271710 TTCTTTAAGAATGTTGAATATGG + Intergenic
1197960706 X:132002894-132002916 ATCTTTGTGAATGAGAAAGCTGG + Intergenic
1198367874 X:135960415-135960437 TGATGTATGAATGAGGATGATGG + Intergenic
1198944490 X:141995577-141995599 TTCTTTATATAGCAGGAAGAGGG - Intergenic
1199047358 X:143191194-143191216 TTCTTTTTGAAAGATGATGAAGG - Intergenic
1199481553 X:148304027-148304049 TTCTTTAAGAATGTTGAATATGG + Intergenic
1199486198 X:148351209-148351231 TTCTTTAAGAATGTTGAATATGG + Intergenic
1200586376 Y:5009737-5009759 TACTTTGTGACAGAGGAAGAGGG + Intronic
1201314271 Y:12628352-12628374 TTCTTTAAGAATGTTGAATATGG + Intergenic