ID: 929709933

View in Genome Browser
Species Human (GRCh38)
Location 2:44256430-44256452
Sequence GTGTGCAGGGCTGCAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929709933_929709938 5 Left 929709933 2:44256430-44256452 CCAGCAGTTGCAGCCCTGCACAC No data
Right 929709938 2:44256458-44256480 CAAAATTGTAGAAAACATTTTGG No data
929709933_929709939 29 Left 929709933 2:44256430-44256452 CCAGCAGTTGCAGCCCTGCACAC No data
Right 929709939 2:44256482-44256504 TATTCACAATAACCAAAAAGTGG 0: 12
1: 146
2: 902
3: 2848
4: 7575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929709933 Original CRISPR GTGTGCAGGGCTGCAACTGC TGG (reversed) Intergenic
No off target data available for this crispr