ID: 929713541

View in Genome Browser
Species Human (GRCh38)
Location 2:44288528-44288550
Sequence ACAGATACAGACACCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929713541 Original CRISPR ACAGATACAGACACCTACCA GGG (reversed) Intronic
903097513 1:20991863-20991885 AAGGAAACTGACACCTACCAAGG + Intronic
904801428 1:33095451-33095473 ACATATACAGAGACCTACCATGG + Intronic
905888534 1:41505009-41505031 GCAGACACAGACACCTTCTAGGG - Intergenic
906564298 1:46787193-46787215 ACACATACAGACACTTACCTTGG + Intronic
907219873 1:52898610-52898632 GCAGATACAGACACAAATCAAGG - Intronic
907659766 1:56381251-56381273 ATTGATGCAGACACCCACCATGG - Intergenic
909206111 1:72759734-72759756 ATATATACACACACATACCATGG - Intergenic
910814592 1:91277498-91277520 ACACACACACACACCCACCAGGG - Intronic
911198063 1:95015962-95015984 AAAGATCCAGCAACCTACCATGG + Intronic
911696597 1:100896105-100896127 ACAGACACAGACACACACCCGGG - Exonic
915935531 1:160088249-160088271 ACAGATACAGCCCCAAACCAGGG + Exonic
916102395 1:161404027-161404049 CCAGCTCCAGACACCTCCCATGG + Intergenic
916448109 1:164892654-164892676 ACACATACAGACACAGACAAAGG + Intronic
916703155 1:167319052-167319074 TCAAATACAGCCACCTACCTGGG - Intronic
917385157 1:174464881-174464903 ATGGATACAGCCTCCTACCATGG + Intronic
918337644 1:183535422-183535444 ACAGAATCAAACACCTACAAGGG - Intronic
918882695 1:190145835-190145857 ACATATATACACACATACCATGG + Intronic
918960029 1:191262698-191262720 ACATACACACACACCCACCATGG + Intergenic
920374789 1:205502170-205502192 GCAGAGGCAGTCACCTACCAAGG - Intergenic
921098490 1:211908161-211908183 ACATATACAGACACACACAAAGG - Intergenic
921265980 1:213420940-213420962 ACAGAGACAGACATCACCCAGGG - Intergenic
921278832 1:213545521-213545543 ACAGAGACAGACACTCACAAAGG - Intergenic
923658001 1:235935060-235935082 ACACACACAGACACCCATCAGGG - Intergenic
924269972 1:242322090-242322112 ACACATGCAGACACTTCCCAAGG - Intronic
924941592 1:248815942-248815964 ACAGATACAGACAACTGCCTTGG - Intronic
1062834695 10:627926-627948 ACAGATGCAGACACAGACCCTGG - Intronic
1062858959 10:794876-794898 ACAGTCACAGCCCCCTACCAGGG + Intergenic
1063586923 10:7360519-7360541 ACAAATACAAACACCAAACACGG + Intronic
1065006863 10:21388182-21388204 ACAGCTACAAATACCTTCCAGGG - Intergenic
1066190158 10:33048610-33048632 ACACACACAGACACACACCATGG - Intergenic
1068888869 10:62127442-62127464 ACAGTTACAGAGATCTATCAAGG - Intergenic
1070142249 10:73747000-73747022 ACAGAAACAGAAACATACCTTGG - Exonic
1070375195 10:75823768-75823790 ACACATACACACACACACCATGG + Intronic
1071069666 10:81677027-81677049 ACTAATACAGACACGTACTAAGG - Intergenic
1076530191 10:131139727-131139749 ACACATACAGACACATACACAGG - Intronic
1076909949 10:133382215-133382237 ACAATGACAGACACCTCCCAAGG - Intronic
1078917122 11:15788712-15788734 ACAGATAAGGATCCCTACCATGG + Intergenic
1079627099 11:22628992-22629014 ACACACACACACACATACCATGG - Intronic
1080384495 11:31803150-31803172 ACAGAGTCAGACACATGCCAAGG + Intronic
1082890751 11:58136182-58136204 AGAGTTACAGACATCCACCAGGG + Intronic
1083539495 11:63502568-63502590 ACAGATACAGTCACATTCTAAGG - Intergenic
1084459608 11:69289165-69289187 ACTGGTAGAGCCACCTACCAAGG - Intergenic
1086140659 11:83495216-83495238 ACAGACACACACATCTACCACGG - Intronic
1087809148 11:102591518-102591540 GCAGACACAGATACCTAGCAAGG - Intronic
1088260612 11:107940200-107940222 ACACACACAGACACACACCAGGG + Intronic
1088372031 11:109101205-109101227 ACAGAGAGAGACACACACCATGG - Intergenic
1088470025 11:110181067-110181089 GCAGATCCAGACACATTCCAAGG - Intronic
1089320827 11:117625676-117625698 TCTGATACAGAGATCTACCATGG - Intronic
1089456770 11:118630301-118630323 CCAGATACAGTCACCTCTCAGGG - Intronic
1091026827 11:132148887-132148909 ACAGATGTAAACACCTAGCAAGG - Intronic
1091999546 12:5020941-5020963 ACAGATACAAATCCCTACCTTGG - Intergenic
1092140682 12:6181358-6181380 ACACATACAGACACACACCCAGG - Intergenic
1092915481 12:13185458-13185480 ACAAATACAAAAACCCACCATGG - Intergenic
1093045215 12:14435364-14435386 ATAGATACAGACACATACAGAGG + Intronic
1094169752 12:27479441-27479463 ACAAATACAGACAGCAACCCTGG - Intronic
1096542570 12:52316289-52316311 ACAGATACACACACACACCTTGG + Intronic
1097370388 12:58771774-58771796 ACAGACACACACACACACCATGG + Intronic
1097505890 12:60469258-60469280 ACAGACACTGAGACCTACCAGGG - Intergenic
1098263729 12:68697547-68697569 ACAGATACAGCAAACCACCATGG + Intronic
1098940453 12:76528726-76528748 ATAGCTACAGACAGCTACTAGGG + Intronic
1099243169 12:80162653-80162675 ACAGAGACAGACATGTACCCAGG - Intergenic
1099395443 12:82132746-82132768 ACAGAAAAAGAGACCTAGCAAGG - Intergenic
1100856489 12:98762055-98762077 ACAGATGCAGACACGTTCAAGGG + Intronic
1100960775 12:99960608-99960630 ACAGATTCAGACACAGTCCAGGG - Intronic
1101276483 12:103207305-103207327 ACTGATACAGAGCCCTAACAGGG + Intergenic
1101295061 12:103413840-103413862 ACACATACACACACACACCATGG - Intronic
1102486378 12:113260512-113260534 ACAGGTGCAGACAACTGCCAGGG - Intronic
1102543670 12:113639685-113639707 AAAGATACAGCCACCCACCCAGG + Intergenic
1103888125 12:124217902-124217924 ACAGACACAGACACCACCCAGGG + Intronic
1104536635 12:129623628-129623650 ACACATACACACACACACCATGG - Intronic
1104860704 12:131921924-131921946 ACATATGCAGACACATGCCAGGG + Exonic
1104962195 12:132493601-132493623 ACAGGTACAGAGACCTGCCCCGG - Intronic
1106433167 13:29701712-29701734 ACACACACACACACATACCATGG + Intergenic
1107085677 13:36425628-36425650 ACAGATCCATACACCTACAGTGG + Intergenic
1107725730 13:43297243-43297265 ACAGATACATCAACCTAACAGGG - Intronic
1108713111 13:53053588-53053610 ACAGATTTAGACCCCTCCCATGG - Intergenic
1108835494 13:54541693-54541715 ACACACACACACCCCTACCAAGG - Intergenic
1109178016 13:59179332-59179354 ACACATACAGACACATACAATGG - Intergenic
1110516572 13:76419733-76419755 ACAGAAACACACACAAACCAGGG + Intergenic
1111242567 13:85494912-85494934 ACACATGCAGACATCTACCTGGG + Intergenic
1112251485 13:97784651-97784673 ACAGATTAAGACACATACCCAGG + Intergenic
1116317007 14:43410288-43410310 ACAGACACACACACATACCATGG - Intergenic
1119411251 14:74432132-74432154 ACACACACACACACCTTCCAAGG - Intergenic
1119647002 14:76355225-76355247 AAAGATAGGGACAGCTACCAGGG + Intronic
1122106478 14:99460712-99460734 AGAGAAACAGCCACCTACTAAGG - Intronic
1123878072 15:24644910-24644932 ACTGAAACAGACACTTACCCTGG - Intergenic
1125545250 15:40498586-40498608 ACAAATACTGAACCCTACCACGG - Intergenic
1127681677 15:61303865-61303887 AGAGATACAGCTACCCACCAAGG - Intergenic
1128076079 15:64826393-64826415 ACAGATAATGATAACTACCATGG + Intergenic
1128659680 15:69489585-69489607 ACAAGTACACACATCTACCATGG - Intergenic
1131308095 15:91263576-91263598 ACAGACACAGACACATATTAAGG + Intronic
1132411485 15:101581452-101581474 CCAGATACACACACCTGTCATGG + Intergenic
1133139030 16:3731094-3731116 TCAGGTACAGACACCAACCCGGG + Intronic
1134366896 16:13587475-13587497 ACACACACACACACATACCATGG + Intergenic
1135838621 16:25852372-25852394 ACAGATACAGCAAACCACCATGG - Intronic
1136641161 16:31566456-31566478 ACATATACAGACACTAAACATGG + Intergenic
1136663814 16:31790875-31790897 ACACATACAGACACTAAACATGG - Intronic
1139080925 16:63520035-63520057 AAATATCCAGACACCTAACAGGG - Intergenic
1139162472 16:64527795-64527817 ACTAATACAGAGACCTATCAGGG + Intergenic
1141459657 16:84170380-84170402 ACAGACACACACACCTCTCAGGG + Intronic
1141688154 16:85582001-85582023 ACAGATACTGCCAGCTACCTGGG + Intergenic
1141931616 16:87208423-87208445 ACAGAGAAAGACACAAACCAGGG + Intronic
1144172011 17:12666947-12666969 ACCCACACAGACACCTTCCATGG - Intronic
1149773316 17:59338535-59338557 ACACATACAGAAACATTCCATGG + Intronic
1152872195 17:82761652-82761674 ACTGATACACACACCAACAATGG - Intronic
1153682886 18:7517261-7517283 ACAGACACAGACACACAACAGGG - Intergenic
1156154030 18:34280549-34280571 ACAGATGCATGCACCTCCCATGG - Intergenic
1157238008 18:45982135-45982157 ACAGACACACACACATACAAAGG - Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162035535 19:7936524-7936546 AGAGATGCAGGCACCTGCCACGG - Intronic
1164257168 19:23538294-23538316 TCAAATACAGCCACCTACCTGGG + Intronic
1166258903 19:41624704-41624726 AGAGATACAGACACCGGCCACGG - Intronic
1166466824 19:43040014-43040036 ACAGACACAGACACACACAAAGG + Intronic
1166472959 19:43096090-43096112 ACAGACACAGACACACACAAAGG + Intronic
1167680020 19:50913293-50913315 ACAGAGACAGAAACCTGCCAGGG - Intergenic
1167738927 19:51312329-51312351 ACAGATGAAGACCCCTAACAGGG - Intronic
1168467156 19:56612407-56612429 ATACATACACACACATACCATGG + Intronic
925040583 2:730614-730636 ACTGCTTCAGACACCTTCCACGG - Intergenic
926547987 2:14265531-14265553 ACACATACAGACACCTGACTAGG - Intergenic
927175457 2:20403247-20403269 ACATAGACAGACACCTGTCACGG + Intergenic
927579182 2:24225995-24226017 ACAGATACAAACCAGTACCATGG - Intronic
928480360 2:31676558-31676580 CAAGATACAGATCCCTACCAGGG - Intergenic
929713541 2:44288528-44288550 ACAGATACAGACACCTACCAGGG - Intronic
930424039 2:51190930-51190952 CCAGACACATACACCCACCAAGG - Intergenic
931235606 2:60410349-60410371 ACAGGGACAGATATCTACCAGGG + Intergenic
932659237 2:73638282-73638304 GCAGATACAGACAGACACCAGGG - Intergenic
932665793 2:73697952-73697974 GCAGATACAGACAGACACCAGGG - Intergenic
933490794 2:82983840-82983862 ACAGAGACAGACATATACAAAGG - Intergenic
934110908 2:88741418-88741440 ACACATACACACACACACCATGG - Intronic
934901117 2:98160831-98160853 ACAGAGACGGACGGCTACCATGG - Intronic
935334516 2:102003735-102003757 ACAGACACAGACACCGACATGGG - Intronic
935874940 2:107496241-107496263 ACAGAAACAGACACATACAGAGG - Intergenic
936598451 2:113872350-113872372 ACAGATACAGACACACACATAGG + Intergenic
937017937 2:118623181-118623203 ACAGAACCAGACACCAGCCAGGG + Intergenic
937755983 2:125539354-125539376 ACAGATACAGAAATGTACCAAGG - Intergenic
938981581 2:136532157-136532179 ACAGATGTGGACTCCTACCATGG + Intergenic
940209454 2:151241597-151241619 ACAGAAACACACACCAAACAAGG - Intergenic
940549522 2:155135411-155135433 ACACACACACACACCTATCAGGG + Intergenic
940589920 2:155709901-155709923 ACAGATACATTCACTTTCCAGGG - Intergenic
941026135 2:160458287-160458309 ACAGATCCAGAAACTTGCCACGG + Intronic
943152427 2:184131300-184131322 TCAAATACAGACACCTGGCAAGG - Intergenic
946203234 2:218083843-218083865 CCACATACACACACCTACTAAGG + Intronic
946784526 2:223228507-223228529 AGAGATGCAGAAGCCTACCATGG + Intergenic
947301015 2:228688804-228688826 AGAGAGACAGACACATACCAGGG - Intergenic
948537449 2:238656703-238656725 ACAGATCCAGAAACATACAAGGG + Intergenic
1169140282 20:3223867-3223889 ACTGAGACAGACACCTGCCTGGG - Exonic
1169254909 20:4089345-4089367 ACACACACAGACACACACCATGG - Intergenic
1169550741 20:6698763-6698785 ACAGCTAGAGCCAACTACCAGGG - Intergenic
1170130438 20:13013360-13013382 ACAGACACAGGTACTTACCACGG - Intronic
1170996431 20:21364425-21364447 ACACATACATACCACTACCACGG + Intronic
1173387993 20:42606268-42606290 ACACACACAGGCACCTACCAAGG + Intronic
1174810104 20:53638204-53638226 ACACACACACACACCTGCCATGG - Intergenic
1174871506 20:54186693-54186715 ACAGATTCCCTCACCTACCAGGG - Intergenic
1180935652 22:19623536-19623558 ACAGAAACAGACACACAACAAGG - Intergenic
1182044668 22:27264891-27264913 ACAGACACATCCACCTGCCATGG + Intergenic
1182638381 22:31747642-31747664 ACACCTACAGACACCAACAATGG + Intronic
1183603547 22:38854377-38854399 ATAGATACAGCAACCCACCATGG - Intergenic
950342054 3:12256224-12256246 ACACATACACACACACACCATGG - Intergenic
955134682 3:56204909-56204931 ACACACACAGACACGTCCCATGG - Intronic
955450326 3:59059193-59059215 ACACACACACACACATACCATGG - Intergenic
956377393 3:68629442-68629464 ACATATATACACACATACCATGG - Intergenic
956529913 3:70206810-70206832 ACACATACAGAAACCCACTATGG + Intergenic
958683396 3:97360027-97360049 ACAGATAAAGACACCTCCCTCGG - Intronic
960496047 3:118376415-118376437 ACAGACACACACACCTCACATGG - Intergenic
960549236 3:118955250-118955272 ACACATACACACACACACCATGG + Intronic
961253840 3:125529115-125529137 ACAGACACAGCCACCTACAATGG + Exonic
962144517 3:132825972-132825994 ACACACACACACACATACCATGG - Intergenic
962574598 3:136745274-136745296 ATAAATACATACACCTACTATGG + Intronic
962603689 3:137014255-137014277 ACAGATACAGACACAGAGCGAGG - Intergenic
962648354 3:137462962-137462984 ACAGGTACAGCCACAGACCATGG + Intergenic
963668779 3:148225155-148225177 ACATATACACACACGTAACAGGG - Intergenic
964432935 3:156624548-156624570 TCAGTTACAGATACATACCAAGG + Intergenic
966229445 3:177635160-177635182 ACATATACATATACATACCATGG - Intergenic
966812801 3:183863138-183863160 ACAGATACAGACAGGTACCAAGG + Intronic
966966263 3:184997667-184997689 CCAGATACTGATAACTACCATGG + Intronic
967173397 3:186841891-186841913 ACACACACACACACATACCAAGG + Intergenic
968149751 3:196327685-196327707 ACAGAAACCGCCACCTTCCAGGG + Intronic
968688256 4:1975899-1975921 CCAAATACAGTCACCTTCCAAGG + Intronic
970756682 4:19435718-19435740 ACAAAACCAAACACCTACCAAGG - Intergenic
971511974 4:27437736-27437758 ACAGATACATACACACATCAAGG - Intergenic
971678415 4:29666167-29666189 AAAGATACAAACTCCTTCCAGGG + Intergenic
971779950 4:31020396-31020418 ACACATACACACACATAGCAAGG - Intronic
972103350 4:35449228-35449250 ACACATATACACACATACCATGG - Intergenic
972760810 4:42102198-42102220 ATATATACATACACATACCATGG + Intergenic
972863810 4:43205429-43205451 ATATATACAGGGACCTACCAAGG + Intergenic
972955126 4:44379543-44379565 ACACATACACACACCTGCAATGG - Intronic
974444000 4:61955635-61955657 ATAGGTACAGAAAACTACCATGG - Intronic
976986853 4:91311611-91311633 AGAAATACAGACAGCTACTAAGG - Intronic
977021062 4:91760775-91760797 ACAGAGACAGACACACACAAGGG + Intergenic
977111232 4:92958280-92958302 ACTGATAAAGACATCTACAAAGG - Intronic
979026828 4:115588002-115588024 ACAGGTACAGCCAACCACCATGG + Intergenic
981828731 4:148976008-148976030 ACAGAAACTGCGACCTACCAGGG + Intergenic
982046110 4:151447775-151447797 ACAGACACAGACAGGTACAAAGG + Intronic
982419110 4:155173039-155173061 ATATATACACACACATACCATGG - Intergenic
986241485 5:5964120-5964142 ACAGTGACAGAAATCTACCATGG + Intergenic
986861557 5:11932035-11932057 ACACAGACAGACACCAAACACGG - Intergenic
986953865 5:13125842-13125864 ACAGATACAGCAAACCACCATGG + Intergenic
987029902 5:13966196-13966218 ACACATACACACACACACCATGG - Intergenic
989218341 5:38927626-38927648 ACAGGCACAGACACCTAGTAGGG - Intronic
989316554 5:40086958-40086980 ACACACACAGACACATACAAAGG + Intergenic
989994628 5:50813800-50813822 ACATATACACACACATTCCAGGG - Intronic
991537563 5:67688728-67688750 ACATATAAAAACTCCTACCATGG + Intergenic
996208870 5:120780128-120780150 ACAGATTCTCAGACCTACCATGG + Intergenic
996665348 5:126052627-126052649 ACAGAAACAGACACAAAACAAGG + Intergenic
998973531 5:147618792-147618814 ACATTTAAAGACATCTACCACGG + Intronic
999849009 5:155517230-155517252 ACAGAGACAAACACATACAAAGG - Intergenic
1000395085 5:160766376-160766398 ACACACACAGACACTCACCATGG + Intronic
1001243963 5:170091890-170091912 ACAAATAGAGACACCAAGCATGG - Intergenic
1001351602 5:170972817-170972839 ATAGAAACAGACACCTACCCTGG - Intronic
1001687746 5:173607296-173607318 ACAAACACTGACACATACCACGG + Intergenic
1003415216 6:5901275-5901297 ACAAACACATACACATACCATGG + Intergenic
1003996329 6:11544420-11544442 ACTGATGCAAACACTTACCAGGG - Intronic
1004739511 6:18444570-18444592 ACAGATACATCAACCTAGCAAGG - Intronic
1005107804 6:22244319-22244341 ATATATACACACACATACCATGG + Intergenic
1006396881 6:33793380-33793402 ACTGAAATAGACACCCACCATGG - Intergenic
1006696882 6:35938708-35938730 ACATATAGAGACAGCTACCTGGG + Intergenic
1007110570 6:39311215-39311237 ACAGCTACTGACAGCTACCATGG + Intronic
1009324064 6:62328414-62328436 ACACACACACACACCTTCCAAGG + Intergenic
1009661909 6:66623939-66623961 ACAGATACAAACAACAATCAAGG - Intergenic
1009909124 6:69904369-69904391 ACAGATACAGCCACTGACGAAGG + Intronic
1010274531 6:73953731-73953753 ACACATACATATACATACCATGG - Intergenic
1011042114 6:83040886-83040908 ACAGACACAGAAACCTAGGAAGG + Intronic
1012729148 6:102858215-102858237 ACACATACACACACATACCATGG - Intergenic
1014350528 6:120338146-120338168 ACATATACACACACACACCATGG - Intergenic
1014571388 6:123012995-123013017 ACAGATACAGACACAGACATAGG - Intronic
1014899776 6:126948444-126948466 AGAGACACACACACCTCCCAAGG + Intergenic
1015336522 6:132045442-132045464 ACACACACACACACATACCATGG + Intergenic
1015953106 6:138573838-138573860 AGAGATTCACACACTTACCAGGG + Intronic
1016414553 6:143819371-143819393 ACAGATACAGACCCCTTTCTTGG - Intronic
1017304891 6:152905829-152905851 ACAGAGTCAGTCACCTTCCATGG - Intergenic
1017685304 6:156907573-156907595 ACAGATACCAAAACCTAACAAGG - Intronic
1018776183 6:167018376-167018398 ACACACACACACACATACCATGG - Intronic
1019960220 7:4452829-4452851 ACGGATCCATACACCTAACACGG + Intergenic
1020986949 7:15147645-15147667 AGAGCTACAGCCAACTACCAAGG + Intergenic
1022224437 7:28348436-28348458 ACACACACAGACACCTTGCATGG + Intronic
1022857107 7:34325811-34325833 AGAAATACAGATACCTACAAAGG + Intergenic
1023008941 7:35908015-35908037 GCAGATCCAGAGACTTACCATGG - Intergenic
1024720780 7:52135657-52135679 ACAGATACACACACATAAAATGG + Intergenic
1026654817 7:72247627-72247649 ACAAATACAGATGTCTACCAGGG - Intronic
1028790412 7:94847640-94847662 AAAGATACAGACAGCTAACTAGG - Intergenic
1029423882 7:100485044-100485066 ACAGACACAGACCCCGACAAAGG - Intronic
1032418568 7:131758702-131758724 ACAGAAACTGACACCTACTGGGG - Intergenic
1033668086 7:143462552-143462574 ACAGAGACAGAAATCTAGCATGG - Intergenic
1034989305 7:155538020-155538042 ACAGACACAGACACGTAAGAGGG + Intergenic
1035028157 7:155840323-155840345 ACACACACACACACCTAGCAAGG + Intergenic
1035093788 7:156335388-156335410 ACAGAAACACACACCAAACATGG - Intergenic
1035746918 8:1967626-1967648 CCAAATACAGTCACCTTCCAAGG + Intergenic
1038182132 8:25239381-25239403 CCAAACACAAACACCTACCAAGG - Intronic
1038315343 8:26479868-26479890 AGAGAAACAGACTCATACCAGGG + Intronic
1038677569 8:29637284-29637306 ACATACACACACACATACCATGG + Intergenic
1039000766 8:32977438-32977460 ACACACACACACACCCACCATGG - Intergenic
1039376426 8:37038835-37038857 ACATATACACACACATATCATGG - Intergenic
1040434192 8:47373938-47373960 ACAGAAACACATGCCTACCAGGG - Intronic
1042582837 8:70300948-70300970 ATAGATACAGAAACCTAACTGGG + Intronic
1043629376 8:82309457-82309479 ACAGAGACAGACACCCACACAGG + Intergenic
1044253755 8:90035678-90035700 AAAGACACAGAAACCTAACAAGG - Intronic
1044304299 8:90619919-90619941 ACATATACATACATATACCAAGG + Intergenic
1045638799 8:104223811-104223833 ACAGATAGAGACACCAACTACGG - Intronic
1046238218 8:111455245-111455267 ACACATACACACACATACAATGG + Intergenic
1047693163 8:127377184-127377206 ACAGATGGAGACACATACAAAGG + Intergenic
1049520718 8:143088613-143088635 ACACAAACAAACACATACCAGGG + Intergenic
1050712913 9:8486154-8486176 ACAGCTACAGACATCCACAAGGG - Exonic
1052108086 9:24545048-24545070 ATAGATAAAGACACCTAAGAGGG + Exonic
1052173506 9:25429307-25429329 AAAGATTCAGTCACCTACAAAGG + Intergenic
1054907062 9:70420840-70420862 ACACATACAGCCACCCACCGGGG + Intergenic
1057239192 9:93393090-93393112 CCAGCTACAGACACACACCAAGG - Intergenic
1059034320 9:110737190-110737212 TCTGAGACAGAAACCTACCATGG + Intronic
1059062778 9:111051045-111051067 ACAGTTACACATACCTACCCAGG - Intergenic
1059933642 9:119285767-119285789 CCAGATACACACCACTACCAAGG - Intronic
1061617319 9:131788752-131788774 ACAGATACACACATGTACAATGG + Intergenic
1186295392 X:8143119-8143141 GCTGACACAGACACCTACGAGGG - Intergenic
1187589304 X:20698991-20699013 ACACATACACACACACACCATGG + Intergenic
1189993561 X:46617401-46617423 GCAGGTACAGACTCCTACCATGG + Intronic
1190310185 X:49111816-49111838 ACAGAAGCAGACCCCTGCCAGGG + Intergenic
1192497069 X:71623111-71623133 GCAGATACAGACCCCTGCCCAGG - Intergenic
1193962424 X:87942056-87942078 ACTGAGACAGCCACATACCAAGG - Intergenic
1194344393 X:92745213-92745235 ACAGACACTGCAACCTACCAGGG - Intergenic
1194379171 X:93174153-93174175 ATAGATGCAGACAACTAACATGG + Intergenic
1197864350 X:131001972-131001994 ATAGGTACAGAAAACTACCATGG - Intergenic
1198185312 X:134248763-134248785 ACAGGTCCAGACACTAACCAGGG + Intergenic
1198511838 X:137360011-137360033 ACACATACACATACCTACAATGG - Intergenic
1199646200 X:149915174-149915196 ATAAATACATACACCTACTATGG + Intergenic
1200652738 Y:5861854-5861876 ACAGACACTGCAACCTACCAGGG - Intergenic
1201251787 Y:12066122-12066144 ACACATACACACACACACCATGG + Intergenic