ID: 929714861

View in Genome Browser
Species Human (GRCh38)
Location 2:44299468-44299490
Sequence ATCTCCTGCTAGGAGTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929714861_929714865 24 Left 929714861 2:44299468-44299490 CCATATTACTCCTAGCAGGAGAT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 929714865 2:44299515-44299537 TCTCATCTGCCTTCCTAGTAAGG 0: 1
1: 0
2: 1
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929714861 Original CRISPR ATCTCCTGCTAGGAGTAATA TGG (reversed) Intronic
905034625 1:34909607-34909629 ATCTCCTGCTCCCAGTAATTTGG - Intronic
906925378 1:50110347-50110369 GTCTCATGCTAGGAGTGATGGGG + Intronic
913975838 1:143454322-143454344 ATTTCCTTCTAGGAGTTTTATGG - Intergenic
914070232 1:144279941-144279963 ATTTCCTTCTAGGAGTTTTATGG - Intergenic
914108923 1:144686413-144686435 ATTTCCTTCTAGGAGTTTTATGG + Intergenic
915270285 1:154749018-154749040 ACCTCCTCCAAGGTGTAATATGG - Intronic
923234644 1:232020861-232020883 ATCCCCTGGTAGGAGGAAAAGGG - Intronic
1063237504 10:4133212-4133234 AACTCCTTGAAGGAGTAATACGG - Intergenic
1063431638 10:5995892-5995914 ATCTGTTGCCAGGAGTAAAATGG - Intergenic
1069439952 10:68419042-68419064 ATCTTTTGTTAGAAGTAATAAGG - Exonic
1074083885 10:110192606-110192628 ATCTCCACCTAGCAGTAACAAGG - Intergenic
1075736574 10:124668018-124668040 CTCCCCTGCTAGGAGGAATCTGG - Intronic
1080238537 11:30099717-30099739 ATTTCCTTCTAGAAGTAACATGG + Intergenic
1082212274 11:49519728-49519750 ATTTCCTGCTAGGAGAAATTTGG - Intergenic
1082736540 11:56862043-56862065 ATATCCTGCTAGGAATTATTGGG - Intergenic
1083604043 11:63966789-63966811 ACCTCCTGCAAGAAGTAATTTGG + Intergenic
1086637315 11:89104786-89104808 ATTTCCTGCTAGGAGAAATTTGG + Intergenic
1087688389 11:101290979-101291001 ATCTTCTGCTCAGAGTAATTGGG - Intergenic
1089195568 11:116692386-116692408 ATCTCCTGCCAGGAGTACCAAGG + Intergenic
1093447346 12:19275374-19275396 ATCTCCTGAGACAAGTAATATGG + Intronic
1094573667 12:31664154-31664176 ATCTTCGGATTGGAGTAATAAGG - Intronic
1094739816 12:33275643-33275665 ATCTCCACCTGGCAGTAATATGG + Intergenic
1095537488 12:43268760-43268782 TTCTCCTGCTGTGAGTAAAATGG - Intergenic
1095735568 12:45552930-45552952 GTCACCTGCTAGGAGCAATGTGG - Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1104408080 12:128535064-128535086 ATTTCCTGCTAGGGGCAATGGGG + Intronic
1105223399 13:18355417-18355439 ATTTCCTTCTAGGAGTTTTATGG + Intergenic
1115443875 14:33466930-33466952 ACCTCCTTCAAGGAGTGATATGG - Intronic
1118333456 14:64832254-64832276 ATCTCCTGCTTTAAGTAACAAGG - Intronic
1119297446 14:73544485-73544507 ATCTTCTCCTTGGATTAATAAGG + Intronic
1119301679 14:73576354-73576376 ATCTTCTCCTTGGATTAATAAGG + Intergenic
1124198761 15:27658050-27658072 ATCTCCTGGTAGAGGTAACAGGG - Intergenic
1129716152 15:77852297-77852319 ATCTCCTGCCCAGAGCAATAAGG - Intergenic
1130913704 15:88288940-88288962 CTCTCCTCCTAGGAGGAAGAGGG + Intergenic
1139334658 16:66223367-66223389 ATGAGCTGCTAGGAGTAAAAGGG - Intergenic
1140614654 16:76647543-76647565 AGCTGCTGCTAGAACTAATACGG - Intergenic
1147915868 17:43885423-43885445 ATCTCCTGCTAAAAGGAATCAGG - Intronic
1149857787 17:60097930-60097952 GTTTCCTTCTAGGAGTTATATGG - Intergenic
1152504039 17:80735286-80735308 ATCCACTGCAAGGAGTAACAGGG - Intronic
1153207998 18:2724362-2724384 ATCTACTTCCATGAGTAATATGG - Intronic
1153851504 18:9099597-9099619 ATCTCCTGCCAAGAGGATTAAGG - Intergenic
1156699281 18:39805938-39805960 CTCTCCTGCGAGGAGCAATTAGG - Intergenic
1160016042 18:75141490-75141512 ATCTCCTTATTGGAGTATTAGGG + Intergenic
1165491375 19:36125268-36125290 AGCTCCTGCCGGGACTAATATGG - Intronic
925389325 2:3484702-3484724 ATCTGCTGCTAGGAGTTGTGAGG - Intronic
928052497 2:28013955-28013977 AGCTCATGCTTGGAGTAAAAGGG - Intronic
929714861 2:44299468-44299490 ATCTCCTGCTAGGAGTAATATGG - Intronic
929826768 2:45315013-45315035 GTCATCTGCCAGGAGTAATATGG + Intergenic
931034563 2:58224598-58224620 AGCTGCTGCTAGGAATAAAATGG + Intronic
933420307 2:82036692-82036714 ATTTCCTGCTAAGAGTATAAGGG - Intergenic
934180536 2:89615294-89615316 ATTTCCTTCTAGGAGTTTTATGG - Intergenic
934290836 2:91689557-91689579 ATTTCCTTCTAGGAGTTTTATGG - Intergenic
943657670 2:190526805-190526827 ATCTCCAGCAAGGAGAAATTTGG + Intronic
948172914 2:235919875-235919897 ATCTCCTGGTATGGGTTATATGG - Intronic
1169392062 20:5198470-5198492 ATCTCCTGCCAGGATTTCTAAGG + Intergenic
1171103165 20:22405426-22405448 ATCTCATGCTAGGTGGAATTTGG + Intergenic
1174554010 20:51381203-51381225 ACCTCCTGCTAGGACTGATGTGG - Intergenic
1176155154 20:63615966-63615988 ATCTCTAGGTAGTAGTAATATGG + Intronic
1176731948 21:10507852-10507874 ATTTCCTTCTAGGAGTTTTATGG + Intergenic
1177355266 21:19998783-19998805 ATCTCCTGCCAGGAGTCATGGGG + Intergenic
1183342890 22:37291720-37291742 CTCTCCTTCTCTGAGTAATATGG - Intronic
1183824858 22:40378107-40378129 GTCACCTGGGAGGAGTAATATGG + Intronic
1184871044 22:47238663-47238685 ATCTCTGGCTGGGAGTAAGAGGG + Intergenic
953429750 3:42829484-42829506 ATCTCCTGGTAGGAACATTAGGG - Intronic
955017680 3:55087925-55087947 ATCACCAGCTAGGAGGAAGAAGG - Intergenic
956248754 3:67213650-67213672 TGCTCCTGCTAGGACTGATAAGG + Intergenic
958898832 3:99861652-99861674 ATCTCTTGCTGGGGGTAATAGGG - Intronic
966732241 3:183161100-183161122 ATCCTCTGCTAGGAGTACTGGGG - Intronic
969359820 4:6656375-6656397 ATCTCCTGCTTGGAATAGCACGG + Intergenic
970134821 4:12910779-12910801 ATCACTTGCTAGGAGTGAGAAGG + Intergenic
972221158 4:36956940-36956962 CTCTCCTGCTAAATGTAATATGG - Intergenic
979166484 4:117538897-117538919 CTCTCCTGCTTGGAGAGATAAGG + Intergenic
984460803 4:180034407-180034429 ATCACCTGCTAATAGTGATAAGG - Intergenic
987507876 5:18796933-18796955 ATTTACTGCCAGGAGTAAGAGGG - Intergenic
988475837 5:31584808-31584830 ATTTCCAGTTAGGAGTAATGAGG + Intergenic
990037239 5:51336382-51336404 ATCTCCTTCTAGGCATAATTGGG - Intergenic
993153720 5:84194372-84194394 TTCTCATCCTAGGAGTAAAAGGG - Intronic
993465453 5:88240526-88240548 ATCTCAAACTAAGAGTAATAAGG + Intronic
996248623 5:121298266-121298288 ACCTTCTGCTAAGATTAATATGG + Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
998668662 5:144328725-144328747 ATCTCCAGCTATGAGTAGCAGGG - Intronic
999466342 5:151809690-151809712 ATCTGCTTTTAGAAGTAATATGG + Exonic
1010757602 6:79684350-79684372 ATATCATACTAGCAGTAATAAGG - Intronic
1013457022 6:110339265-110339287 TTCTCCCGCTAGGAGTCATTTGG + Intronic
1013987599 6:116214450-116214472 ATGTTCTGCTAGGAGAAAAAAGG + Intronic
1014095770 6:117459178-117459200 ATCTACTGCTTAGAGTAATTTGG - Intronic
1016821588 6:148351515-148351537 ACCTCATGCTAGGAGAAAGAAGG - Intronic
1016957725 6:149642539-149642561 ATTCCCTGCTAGGGGAAATATGG + Intronic
1020940777 7:14533891-14533913 ATATCCTGCAAGAAGTACTAAGG + Intronic
1021271160 7:18588113-18588135 ATGTCCTTCTGGGAGTAATAAGG + Intronic
1023745675 7:43320407-43320429 ATCTCCTGCCAGCAGTGCTATGG + Intronic
1024622167 7:51170097-51170119 ATCTTCTGCTAGTATTTATATGG + Intronic
1032473380 7:132194317-132194339 AGCCCCTGCTAGGAGGAATTAGG - Intronic
1032866351 7:135929118-135929140 AACTCCTGCTGGTAGTAAAAGGG - Exonic
1034597641 7:152213600-152213622 ATTTCCTTCTAGGAGTTTTATGG - Intronic
1034929984 7:155153919-155153941 AACTCCTGCTTGGAGAAATGAGG + Intergenic
1035195984 7:157220877-157220899 AGCTCCTGCTGGGAGTGACATGG - Intronic
1036055599 8:5250083-5250105 ATCTTCTGCTATCAGTAATCAGG + Intergenic
1039203573 8:35123750-35123772 ACCTCCTCCTAGCAATAATAAGG + Intergenic
1039465797 8:37784279-37784301 ATCTCCTGCATGGAGGAAAAGGG + Intronic
1044964161 8:97558699-97558721 AACTCCTGCTAGGAATGACAGGG - Intergenic
1046175021 8:110564163-110564185 ATTTCCTGCTATAAGTATTAAGG - Intergenic
1050906005 9:11006823-11006845 AACTCCTGCTATGAGAAAAATGG + Intergenic
1056552721 9:87664615-87664637 CACTCCTGCTAGGAGAAATCCGG - Intronic
1056880308 9:90385294-90385316 ATCTCCTGTCAAGAGAAATAAGG - Intergenic
1185658208 X:1702966-1702988 TTCTCCTGCTTGGAGTAGTGGGG + Intergenic
1186359542 X:8825681-8825703 ATCTCCTTCTAGGAGCAATGTGG + Intergenic
1190752111 X:53371711-53371733 ATGTCCTGCTATGAGAAATGAGG - Intergenic
1193069690 X:77294957-77294979 ATGTCCTGCCAGGAGTCATCAGG - Intergenic
1198232626 X:134706389-134706411 ATCTCCAGCTGGCAGTAATGAGG + Intronic
1202271111 Y:23075114-23075136 ATCTCCTGCTCATAGTAACATGG - Intergenic
1202294915 Y:23345568-23345590 ATCTCCTGCTCATAGTAACATGG + Intergenic
1202424106 Y:24708858-24708880 ATCTCCTGCTCATAGTAACATGG - Intergenic
1202446683 Y:24961227-24961249 ATCTCCTGCTCATAGTAACATGG + Intergenic