ID: 929719620

View in Genome Browser
Species Human (GRCh38)
Location 2:44354382-44354404
Sequence TGTCTCCCCATTATATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929719620_929719624 13 Left 929719620 2:44354382-44354404 CCTCCCAATATAATGGGGAGACA 0: 1
1: 0
2: 1
3: 8
4: 186
Right 929719624 2:44354418-44354440 ATGATGTAGTAATAGCAGAGAGG 0: 1
1: 0
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929719620 Original CRISPR TGTCTCCCCATTATATTGGG AGG (reversed) Intronic
905331453 1:37203038-37203060 TGTTTCCCCTTGTTATTGGGTGG + Intergenic
907052093 1:51336372-51336394 TCTCTCCCCTTTATATCTGGTGG - Intronic
907388460 1:54141024-54141046 TGTCTCCCCATTACACTTGCAGG - Intronic
909894531 1:81050715-81050737 TGTCTCACCATTTTTTTCGGGGG - Intergenic
911286893 1:96005825-96005847 TGTATCCCCAGCATTTTGGGTGG - Intergenic
913493901 1:119409621-119409643 TGTCTGCCAATTATCTTGGTGGG - Intergenic
913507552 1:119531875-119531897 TGTCTGCCAGTTATCTTGGGTGG - Intergenic
914380267 1:147109387-147109409 TTTCCCCCCATTATTTTGGAGGG - Intergenic
918571283 1:185996272-185996294 TCTCTCCACATTATCTTGGAAGG - Intronic
921719169 1:218451424-218451446 TTTCTCCCCATTCTATTGCATGG + Intergenic
921728643 1:218552400-218552422 TGTAACCCCAGTATTTTGGGAGG + Intergenic
924379611 1:243450146-243450168 TCTCTCCTCATTAGATTGTGAGG + Intronic
924822853 1:247511097-247511119 AGTCTCCCCAGTTTATTGTGTGG + Intronic
1064740206 10:18425408-18425430 TGTAACCCCATTACTTTGGGAGG + Intronic
1066125989 10:32343678-32343700 TGCCTCCAAATTATTTTGGGGGG + Intronic
1069113509 10:64475494-64475516 AATCTCTCCATAATATTGGGAGG - Intergenic
1069463536 10:68617414-68617436 TGTATCCCCAGCATTTTGGGAGG - Intronic
1071738942 10:88334655-88334677 TGTCTCCCCTCTAGATTGAGGGG + Intronic
1072670994 10:97429028-97429050 TATCTCCCCATTATGGTGGGAGG + Intronic
1072696245 10:97605150-97605172 TGTAACCCCATCATTTTGGGAGG + Intronic
1072981975 10:100106295-100106317 TGTATTCCTATTACATTGGGAGG + Intergenic
1073314101 10:102566371-102566393 TGTAACCCCATTACTTTGGGAGG + Intronic
1073545548 10:104345603-104345625 TGTCTCCCCACCAGACTGGGAGG - Intergenic
1074565009 10:114569661-114569683 TGTCACCCCATTATTTGGGAGGG - Intronic
1078383735 11:10868704-10868726 TGTATTCCCAGTACATTGGGAGG + Intergenic
1078741836 11:14073858-14073880 TGTCTTCCCATTATATTTACTGG - Intronic
1078825190 11:14923148-14923170 TGTTTCCCCCTTCTGTTGGGAGG + Intronic
1080332298 11:31153524-31153546 TGTAACCCCAGTATTTTGGGAGG + Intronic
1080699193 11:34630086-34630108 TGTCTCCTGTTTATATTTGGTGG + Intronic
1081184513 11:40025752-40025774 TGTCATCCCAGCATATTGGGAGG + Intergenic
1081191961 11:40115274-40115296 TACCTCCCCTTTAGATTGGGAGG + Exonic
1081452070 11:43180718-43180740 TGTGTCCCGATTTTCTTGGGAGG - Intergenic
1087041483 11:93805337-93805359 TGTATCCCCAGCATTTTGGGCGG + Intronic
1089098083 11:115936410-115936432 TCTCTCTCAATTATATTGAGGGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091516407 12:1187085-1187107 TGTCACCCCATCACTTTGGGAGG - Intronic
1092712675 12:11354208-11354230 TGTCTCCTCTTTATACTGAGAGG - Intronic
1092716472 12:11394182-11394204 TGTCTCCTCTTTATAATGAGAGG - Intronic
1095157262 12:38872479-38872501 TGTCTCCACATTCAAATGGGCGG - Intronic
1096444266 12:51674589-51674611 TGTATTCCCATCATTTTGGGAGG - Intronic
1097122144 12:56742325-56742347 TGTATTCCCAATATTTTGGGAGG + Intronic
1098950724 12:76637816-76637838 TGTAACCCCAGTATTTTGGGAGG - Intergenic
1100092622 12:90989894-90989916 TGTCTCCAAATAATATTGGTAGG + Intronic
1100578761 12:95918735-95918757 TGTCTCCCCATCATGGTGTGGGG + Intronic
1103627999 12:122235213-122235235 TGTAATCCCAGTATATTGGGAGG - Intronic
1104260330 12:127176330-127176352 TGTATTCCCAATATTTTGGGAGG + Intergenic
1104436639 12:128762124-128762146 TGTAACCCCAACATATTGGGAGG - Intergenic
1110228060 13:73140552-73140574 TGTATTCCCAATATTTTGGGAGG - Intergenic
1111839692 13:93434421-93434443 TCTCCCCCAATTATATTGTGGGG + Intronic
1118468226 14:66051106-66051128 TGTTTCCCCATTATGCTGTGGGG - Intergenic
1120830021 14:88989641-88989663 TGTAACCCCAGTATTTTGGGAGG - Intergenic
1121239001 14:92414477-92414499 TGTAATCCCAGTATATTGGGAGG + Intronic
1126865097 15:52927683-52927705 TGTCTCCCCTTGAAACTGGGTGG - Intergenic
1128834699 15:70799774-70799796 TGTATTCCCAGTACATTGGGAGG - Intergenic
1130958987 15:88647325-88647347 TGTCTGACCATTATATAGAGGGG + Intronic
1132392713 15:101450619-101450641 TGTCTCCAAATGACATTGGGAGG + Intronic
1132609583 16:808671-808693 CGTCTCTCCAATATATTGGTCGG - Intronic
1134591375 16:15456592-15456614 TGTCTTCCCAGCATTTTGGGAGG - Intronic
1134619544 16:15677207-15677229 TGTCTCCCGATTGTGGTGGGAGG + Intronic
1135189944 16:20346469-20346491 TGAGTCCCCATCACATTGGGAGG - Intronic
1136578456 16:31138372-31138394 TGTGTCCCCACTAGATTGGGAGG + Intergenic
1138655739 16:58490319-58490341 GTTCTCCCCATTGTACTGGGGGG - Intronic
1140613109 16:76625295-76625317 TGTAACCCCAGTATTTTGGGAGG + Intronic
1140888221 16:79262778-79262800 TGTCTCCCATTTAGATTGGCTGG - Intergenic
1141190403 16:81820595-81820617 TGTTTCCCCATTATACAGAGGGG - Intronic
1141301030 16:82815754-82815776 TGTCCACCCATTATACTGTGAGG + Intronic
1141539889 16:84711974-84711996 TGTAACCCCAGTACATTGGGAGG - Intronic
1142313995 16:89331740-89331762 TGTAGCCCCAATATTTTGGGAGG - Intronic
1143087558 17:4427505-4427527 TGTCATCCCATTACTTTGGGAGG - Intergenic
1148131826 17:45266825-45266847 TGCCTCCCCATTATCTCTGGTGG + Intronic
1148169704 17:45508748-45508770 AGTCCCCCCATTATATTGTGGGG - Intergenic
1148279502 17:46337066-46337088 AGTCCCCCCAGTATATTGTGGGG + Intronic
1148301719 17:46554922-46554944 AGTCCCCCCAGTATATTGTGGGG + Exonic
1148365652 17:47053912-47053934 AGTCCCCCCAGTATATTGTGGGG + Intergenic
1148972272 17:51494095-51494117 AGTCTTCTAATTATATTGGGAGG - Intergenic
1149174699 17:53855295-53855317 TGTCTCCCAATACTATTGTGTGG - Intergenic
1150194193 17:63277913-63277935 TGTATTCCCATCATTTTGGGAGG + Intronic
1150256494 17:63749831-63749853 TGTATTCCCAGCATATTGGGAGG + Intronic
1152359162 17:79822556-79822578 TGTCATCCCAGCATATTGGGAGG - Intergenic
1156232659 18:35169555-35169577 TTTCTCCCCTTAATATTGGAAGG + Intergenic
1156802863 18:41139072-41139094 TGTCACCACATTATATTCAGTGG - Intergenic
1157346611 18:46841970-46841992 TGTAATCCCATTATTTTGGGAGG + Intronic
1157494358 18:48144600-48144622 TGTCATCCCAGTATTTTGGGAGG - Intronic
1158606357 18:58899721-58899743 TGTCATCCCAGCATATTGGGAGG - Intronic
1158700785 18:59744042-59744064 TGTCTGACCATTTGATTGGGAGG - Intergenic
1160400282 18:78605558-78605580 CGTCTCCTCATTTTATTAGGTGG - Intergenic
1161801361 19:6418217-6418239 TGCCTCCCCATTAAAGTGGCAGG - Intronic
1162946581 19:14047611-14047633 TGTCATCCCATCATTTTGGGAGG - Intronic
1163363254 19:16861368-16861390 TGTCACCCCAGTACTTTGGGAGG + Intronic
1164921554 19:32092259-32092281 TTTGTCCCCATTATATAGGTGGG - Intergenic
1165968657 19:39606101-39606123 TGTAATCCCATTATATTGAGAGG - Intronic
1166713139 19:44949852-44949874 TGTCACCCCAGTACTTTGGGAGG - Intergenic
1168503601 19:56914360-56914382 TGTAATCCCATTACATTGGGAGG + Intergenic
926737645 2:16085910-16085932 TGTCTCCCCATTTGATTTGGAGG + Intergenic
927778484 2:25920709-25920731 TGTCACCCCAGCATTTTGGGAGG + Intergenic
927977302 2:27348545-27348567 TGTATTCCCAGTATGTTGGGAGG + Intronic
929719620 2:44354382-44354404 TGTCTCCCCATTATATTGGGAGG - Intronic
935486209 2:103657502-103657524 TGTAATCCCATCATATTGGGAGG - Intergenic
936174713 2:110209731-110209753 TATCTCCACAGTATTTTGGGGGG + Intergenic
936448951 2:112619026-112619048 TGTATCCCCAATACTTTGGGAGG - Intergenic
937148106 2:119664544-119664566 TGTCTCCCCCTATTATTGCGTGG - Intergenic
940624071 2:156150351-156150373 TGTCTCACCAGCATTTTGGGAGG + Intergenic
942786000 2:179703484-179703506 TGTCTCCCCATTAAAATGTCAGG + Intronic
944689306 2:202145653-202145675 TATCTCCCCATTCTCTTGAGAGG + Intronic
946460967 2:219868526-219868548 TGTCTGACCATTATCTAGGGTGG - Intergenic
948739863 2:240038677-240038699 TATCTCCCCTTTATATTTGAAGG + Intergenic
1170962355 20:21036645-21036667 TGTCTCCCTATTTTATTTTGTGG - Intergenic
1171561188 20:26127541-26127563 TGTTTTCCCAGTATTTTGGGAGG - Intergenic
1173296123 20:41759724-41759746 ACTCTCCCTATTATATTAGGAGG + Intergenic
1179245325 21:39628485-39628507 TGTCTCAACATTTTAGTGGGAGG + Intronic
1183552293 22:38497041-38497063 TGTAATCCCATTATTTTGGGAGG + Intronic
1185356600 22:50376196-50376218 TGTAACCCCAGCATATTGGGAGG + Intronic
949483299 3:4513827-4513849 TGTCATCCCATTACTTTGGGAGG + Intronic
951797321 3:26554339-26554361 TGTCTCTCCTTTATATTTGAAGG - Intergenic
955360413 3:58269252-58269274 TGTCTGCCCATTTTCTTGGGAGG - Intronic
956579524 3:70795014-70795036 AGTCTCCCCTTATTATTGGGTGG + Intergenic
957375833 3:79356082-79356104 TGTAATCCCATTATTTTGGGAGG + Intronic
958797758 3:98724157-98724179 TGTGATCCCATTACATTGGGAGG + Intergenic
958988014 3:100805555-100805577 AGTCTCACCATAATGTTGGGAGG + Intronic
960303411 3:116032359-116032381 TGTCTCACCCTTACATTGGTTGG + Intronic
960505521 3:118488777-118488799 TTTCTCCCAATTCTATTGGAAGG + Intergenic
963467444 3:145701338-145701360 TGCCTCCAAATTAAATTGGGGGG - Intergenic
964173604 3:153799322-153799344 AGTCTCCCAATTTTATTGTGTGG - Intergenic
965573505 3:170194979-170195001 TGTAACCCCAGCATATTGGGAGG + Intergenic
965658255 3:171013775-171013797 TATCTCCTCTTTATATAGGGTGG + Intronic
965963270 3:174454277-174454299 TGTCTCCCCTTATTATTGTGTGG - Intronic
966684476 3:182679219-182679241 TGACTCCCCATTTTACTTGGTGG + Intergenic
968649937 4:1756529-1756551 TGTATGCCCATTTTATTGTGGGG - Intergenic
970231045 4:13911601-13911623 TGTTTCCCCATTAAGTTTGGAGG - Intergenic
971420832 4:26472651-26472673 TTTCTCCCCTTTATATTTGTAGG + Intergenic
972228405 4:37041919-37041941 TGTGACTACATTATATTGGGAGG + Intergenic
973991893 4:56417523-56417545 TGTAACCCCAGTATTTTGGGAGG + Intronic
974700198 4:65433807-65433829 TGTAACCCCATCATTTTGGGAGG + Intronic
975954349 4:79820278-79820300 TGTCCCACCATTATATTTTGTGG - Intergenic
978029807 4:103927488-103927510 TGTAATCCCATTATTTTGGGAGG + Intergenic
978235440 4:106452365-106452387 TGTAATCCCATTATTTTGGGAGG - Intergenic
978551934 4:109937138-109937160 TGTCTCCCACTTTTATTGTGTGG + Intronic
978619451 4:110623514-110623536 TGTCTCCTTTTTATATGGGGTGG - Intronic
982539306 4:156647709-156647731 TGTTTCCCCATTTTGTTGTGGGG + Intergenic
985421323 4:189787944-189787966 TGCCTCCCCCTTTTTTTGGGCGG - Intergenic
990331522 5:54730792-54730814 TTTCTCACCATTATATTTGATGG + Intergenic
991171917 5:63637412-63637434 TGTCTCCTCATTAGATGGTGAGG + Intergenic
992982117 5:82186775-82186797 TTTCTCCCCATTAGCTTGGCTGG + Intronic
995448080 5:112268591-112268613 TGTAACCCCAGTATTTTGGGAGG + Intronic
996310827 5:122102527-122102549 TGTAACCCCAGTATTTTGGGAGG + Intergenic
999877034 5:155818775-155818797 TGTAATCCCATTATGTTGGGAGG - Intergenic
1000911443 5:167027820-167027842 TGTAACCCCAATATTTTGGGAGG + Intergenic
1001517273 5:172364765-172364787 TCTCTCCCCACTCTGTTGGGTGG + Intronic
1004328426 6:14699061-14699083 TGTATCCCCATTTACTTGGGAGG - Intergenic
1007695674 6:43732904-43732926 TGTCACCCCAGCATTTTGGGAGG + Intergenic
1010065089 6:71673237-71673259 TTTCTCCCGATTATAGTGGTGGG + Intergenic
1010212376 6:73372289-73372311 TGGCACCCCATTATCTTGTGGGG + Intronic
1011021816 6:82822379-82822401 TGTAGCCCCAGCATATTGGGAGG + Intergenic
1012483984 6:99699814-99699836 TGTAACCCCAGTATTTTGGGAGG - Intergenic
1013093646 6:106923722-106923744 TATCTCCCCTTTAAACTGGGAGG + Intergenic
1018388634 6:163326942-163326964 TGTCTCAACATAAGATTGGGTGG - Intergenic
1018388656 6:163327070-163327092 TGTCTCAACATAAGATTGGGTGG - Intergenic
1020234590 7:6346023-6346045 TGTAATCCCAGTATATTGGGAGG - Intronic
1021071917 7:16251262-16251284 AGTCTCCCCCTATTATTGGGTGG - Intronic
1022141595 7:27497744-27497766 TGTAATCCCATTATTTTGGGAGG + Intergenic
1027721291 7:81744817-81744839 TTTCTGGCCATTATATTTGGAGG - Intronic
1029199809 7:98831543-98831565 TGTCTCTCCAGTGTTTTGGGAGG - Intergenic
1029649566 7:101881919-101881941 TGTCATCCCAGTATTTTGGGAGG + Intronic
1030179665 7:106692627-106692649 TGTATTCCCAGTATGTTGGGAGG - Intergenic
1032605286 7:133344071-133344093 TGTAATCCCAGTATATTGGGAGG - Intronic
1033347750 7:140539078-140539100 TGTCATCCCAGTATTTTGGGAGG - Intronic
1033463421 7:141568377-141568399 TGTCTCCGCATGATTTTGGCTGG + Intronic
1034132629 7:148734498-148734520 TGTCACCCCAGCATTTTGGGAGG - Intronic
1035334627 7:158119824-158119846 TGTCTCCCCCTTAGATAAGGGGG + Intronic
1036554009 8:9841179-9841201 AGTCTCCCAATAATATTGTGTGG - Intergenic
1036957193 8:13200852-13200874 TGTATCCCCAATAGTTTGGGGGG - Intronic
1037442147 8:18927466-18927488 TGTCTTCCCAGTACTTTGGGAGG - Intronic
1038301771 8:26357290-26357312 TATAGACCCATTATATTGGGGGG - Intronic
1039526502 8:38220964-38220986 TGTAATCCCAGTATATTGGGAGG - Intergenic
1041969211 8:63717864-63717886 TGTCTCCCCATTATTTTGGAAGG + Intergenic
1043639434 8:82432793-82432815 TTTATCCCCAGTATATTGAGAGG - Intergenic
1044163332 8:88948523-88948545 TGTCTTCTCAGTATATTTGGGGG + Intergenic
1044444807 8:92263372-92263394 TGTCTACTGATTATATTGGGTGG - Intergenic
1046986566 8:120394937-120394959 TGTGTCCCCTTTAAATTGGGAGG + Intronic
1047373820 8:124277560-124277582 TGTCACCCCAGTACTTTGGGAGG + Intergenic
1049015276 8:139915501-139915523 TGTAACCCCAGTATTTTGGGAGG - Intronic
1049476640 8:142799967-142799989 TGTCTCCCCGTAAAATGGGGTGG + Intergenic
1055385419 9:75756947-75756969 TGTCATCCCAGTATTTTGGGAGG + Intergenic
1056232312 9:84559219-84559241 TATCTCCCCTTTCTGTTGGGGGG - Intergenic
1059965913 9:119613497-119613519 TGTATACCAATTATAATGGGGGG - Intergenic
1059999337 9:119944094-119944116 TGTTCCCCCATTTTATAGGGGGG + Intergenic
1061304177 9:129723022-129723044 CGTCTCCCCATCCTATTGCGGGG + Intergenic
1185602832 X:1352019-1352041 TGTCACCCCAGCATTTTGGGAGG - Intronic
1185801600 X:3016266-3016288 TGTATCCCCAGTACTTTGGGAGG - Intronic
1186307562 X:8279073-8279095 TTTCTTCTCATTATTTTGGGAGG - Intergenic
1189775858 X:44469806-44469828 TGTCATCCCAGTACATTGGGAGG + Intergenic
1191597695 X:62964291-62964313 TGTCTCCCAATATTATTGTGTGG + Intergenic
1191994006 X:67070515-67070537 AGTCTCCCAATATTATTGGGTGG - Intergenic
1195070500 X:101274461-101274483 TGTAACCCCAGTATTTTGGGAGG - Intronic
1201280351 Y:12337018-12337040 TGTCATCCCATTACCTTGGGAGG - Intergenic
1202150419 Y:21839036-21839058 TGAATCCCCAGTATATTGGGGGG - Intergenic