ID: 929721372

View in Genome Browser
Species Human (GRCh38)
Location 2:44372061-44372083
Sequence CTTTAACAACCTATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929721372_929721375 29 Left 929721372 2:44372061-44372083 CCTAGCTCCATAGGTTGTTAAAG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 929721375 2:44372113-44372135 TAGAATTGACACATATCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
929721372_929721374 -4 Left 929721372 2:44372061-44372083 CCTAGCTCCATAGGTTGTTAAAG 0: 1
1: 0
2: 2
3: 12
4: 108
Right 929721374 2:44372080-44372102 AAAGAAGCAGCTTATCTTCTTGG 0: 1
1: 0
2: 1
3: 23
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929721372 Original CRISPR CTTTAACAACCTATGGAGCT AGG (reversed) Intronic
906767113 1:48443730-48443752 TTATAACAACCTCTGGAGTTGGG + Intronic
907149352 1:52268911-52268933 CTTTAAAAACCAATGTAGCAAGG - Intronic
907650878 1:56293792-56293814 CCTTTACCTCCTATGGAGCTGGG + Intergenic
908867596 1:68568843-68568865 CTATAAGAAGCTCTGGAGCTGGG - Intergenic
909687333 1:78364969-78364991 ATGTCACAACCTCTGGAGCTGGG + Intronic
913296979 1:117331456-117331478 TTTCAACAAGCTATGGTGCTAGG - Intergenic
918600915 1:186359794-186359816 CTTGAACAAGCTATGAAGGTTGG - Exonic
1065596090 10:27312951-27312973 CTTTAGCAACCTGAGTAGCTGGG - Intergenic
1068087887 10:52397868-52397890 CTTTAACAACCTAATGACCTTGG + Intergenic
1070450537 10:76553064-76553086 CTTTAACAGCTTATGGTGATGGG + Intronic
1071922047 10:90361401-90361423 CTTTCACCAACTATGAAGCTAGG - Intergenic
1072740917 10:97908583-97908605 CTTTAAGAACCTATAGGGATAGG + Intronic
1074572675 10:114638576-114638598 CTTTAACAACCTCTGCAGAAGGG - Intronic
1078626639 11:12964170-12964192 CCTTAACAATCCAAGGAGCTTGG - Intergenic
1078823739 11:14907034-14907056 CTAGAACAACATGTGGAGCTGGG - Intronic
1079009684 11:16817709-16817731 CTTTATGAACCTCTGGAACTTGG - Intronic
1079013213 11:16846652-16846674 CTTGAGCAACCTAGGGAGGTTGG + Intronic
1081452678 11:43187114-43187136 CTTTCAAAACCTAGGGAGCGAGG + Intergenic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1084454332 11:69258961-69258983 CTTTAACAAGCCCTCGAGCTGGG + Intergenic
1088673225 11:112164593-112164615 CTTTGACACCATATTGAGCTTGG - Intronic
1088689376 11:112312032-112312054 CTAGAACCAACTATGGAGCTGGG - Intergenic
1090033757 11:123230409-123230431 CTTTAATCACCTGTGAAGCTTGG + Intergenic
1091573386 12:1710980-1711002 TTATACCAACCTCTGGAGCTGGG - Intronic
1094436540 12:30426471-30426493 CTCTGACAACCTATAGAGCTAGG + Intergenic
1094543896 12:31385969-31385991 ATTTAAAAACCCATGGAGCCGGG - Exonic
1096536075 12:52275655-52275677 TTTCAACAACCTTTGGAGATAGG + Intronic
1097428539 12:59474999-59475021 TTTTACCAACCTCTGGAGTTGGG + Intergenic
1097644456 12:62219782-62219804 CTTTAACAACCTATTGAAAGAGG - Intronic
1108355946 13:49628794-49628816 CTTTAAAAACATATGTGGCTGGG + Intronic
1110311369 13:74053461-74053483 TCTTAACAACCTAATGAGCTAGG + Intronic
1112936474 13:104806076-104806098 CTTTAGCCTCCTATGTAGCTGGG + Intergenic
1120607862 14:86602104-86602126 ACCTAACAAGCTATGGAGCTGGG + Intergenic
1125061446 15:35430611-35430633 CTTTAAGACCCTATAAAGCTGGG + Intronic
1128217596 15:65945189-65945211 CTTTAAAAACCCAAGGGGCTGGG - Intronic
1133711737 16:8408217-8408239 CTTGATCAACCTATGGAAGTGGG + Intergenic
1134415972 16:14043694-14043716 CTTCAATAACCTCAGGAGCTAGG - Intergenic
1137884781 16:52091195-52091217 CTATTACAAGCTATGGTGCTGGG - Intergenic
1138188478 16:54995468-54995490 CTTTAACAACCAATGGGACCTGG - Intergenic
1139187389 16:64822943-64822965 AGTCAACAACCTCTGGAGCTTGG - Intergenic
1146542537 17:33710048-33710070 CTCCATCAACCTATGGAGCTTGG - Intronic
1155236257 18:23822602-23822624 ATATAACAACCTATGTACCTTGG + Intronic
1156174625 18:34528908-34528930 CATTTACAACCTATAGAGCAGGG - Intronic
1162288502 19:9759994-9760016 GTTTAAAAGCCTATGGGGCTGGG + Intronic
925932411 2:8719737-8719759 CTTTAACACCCCCTGGAGCCTGG + Intergenic
928534098 2:32222885-32222907 CTTTAAAATCCTATGGGGATGGG - Intronic
929204297 2:39273441-39273463 ATTTAACAACCTTTGTTGCTGGG + Intronic
929721372 2:44372061-44372083 CTTTAACAACCTATGGAGCTAGG - Intronic
930059275 2:47274822-47274844 CTTTCAGGCCCTATGGAGCTGGG - Intergenic
930678795 2:54233410-54233432 CTTTAGCCTCCTATGTAGCTGGG + Intronic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
943134294 2:183891995-183892017 TTTTACCAACCTCTGGAGTTGGG + Intergenic
943703650 2:191013059-191013081 TTTTAACATCTTATGGACCTTGG + Intronic
944285681 2:197947445-197947467 CTTTGAGAACCACTGGAGCTGGG + Intronic
1171996896 20:31738524-31738546 CTTTAGCCTCCTGTGGAGCTGGG + Intergenic
1175468093 20:59206703-59206725 CTACAACAACCTCTGAAGCTAGG + Intronic
1176703430 21:10088103-10088125 CTGTAACAACCTATGGTGCTTGG + Intergenic
1177420935 21:20855657-20855679 CTTTCACAACCTACAGACCTGGG - Intergenic
1178937645 21:36877067-36877089 CATTAACAGCCTAAGGAGGTTGG - Intronic
1183046284 22:35223034-35223056 CTTCAACCTCCTATGTAGCTAGG - Intergenic
1183777100 22:39973463-39973485 CTTTCAGAACCCCTGGAGCTCGG + Exonic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
954423431 3:50430813-50430835 CTTTGACTACCTAGGGAGATGGG - Intronic
954896736 3:53981556-53981578 CTTTAACAACTTTTAGGGCTAGG + Intergenic
956766555 3:72489184-72489206 CTTAAACAACCTATGGTTCTTGG + Intergenic
957004275 3:74926047-74926069 CTTTACCATGCTATGGGGCTGGG + Intergenic
959153605 3:102638916-102638938 CTTTGCTAACCTATGTAGCTTGG - Intergenic
962468230 3:135680394-135680416 CTTTTACAGCCCATGGACCTAGG + Intergenic
963915111 3:150852070-150852092 CTTAAACTACCTATGGAGGCAGG + Intergenic
967049278 3:185767412-185767434 CTTTAACATCTTATGGAAATGGG - Intronic
969238752 4:5886455-5886477 CTTTTCCAGCCGATGGAGCTGGG - Intronic
972698708 4:41472919-41472941 TCTTAACATCCCATGGAGCTAGG + Intronic
979104129 4:116663140-116663162 CCTTAATAAGCTATGGAGTTTGG - Intergenic
979126983 4:116985786-116985808 CTTTAAGAACCTTAGGATCTAGG + Intergenic
980375649 4:131944453-131944475 CTGTAATAACCTATGGTGCTTGG + Intergenic
982717343 4:158822748-158822770 CTTCAGCAACCTAAGTAGCTGGG + Intronic
987456281 5:18151043-18151065 CTGGAGCAACTTATGGAGCTGGG - Intergenic
987479811 5:18439620-18439642 GCTTAACAAACCATGGAGCTGGG + Intergenic
988605327 5:32673990-32674012 TTATACCAACCTCTGGAGCTGGG - Intergenic
988820074 5:34874560-34874582 ATTTAACAACAAAAGGAGCTGGG + Intronic
990117122 5:52402924-52402946 CTATACCAACCTCTGGAGTTGGG + Intergenic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
993072052 5:83177466-83177488 CTTTAAAAACATATCGAGCTTGG + Intronic
993375320 5:87143500-87143522 CTTCAACATCCTAAGTAGCTGGG - Intergenic
993396119 5:87391109-87391131 CTTTAACAACCTCTGAGCCTTGG + Intronic
994642924 5:102432814-102432836 CTTTCACAACCTATGTAGAGAGG - Intronic
996487362 5:124052578-124052600 CTATAACAAAATATGGAGATTGG - Intergenic
998254400 5:140573742-140573764 CTTTTACCACCTATGGAGAAAGG + Intronic
999582319 5:153052591-153052613 CTTTAAAAAAGCATGGAGCTGGG + Intergenic
999583077 5:153061354-153061376 CTGTAACATGCTATGGAGCTGGG - Intergenic
1001653030 5:173328744-173328766 CTTTAACAGCAACTGGAGCTTGG - Exonic
1003912750 6:10757693-10757715 CTTTAAAAAGGTAAGGAGCTGGG + Intronic
1005999697 6:30955537-30955559 CTTTAACAAGCTCCGGGGCTGGG + Intergenic
1012690074 6:102299481-102299503 ATATAACAAGCTCTGGAGCTTGG - Intergenic
1017373793 6:153743473-153743495 CTATGTCAACCTATGCAGCTTGG - Intergenic
1018592315 6:165440673-165440695 CTTTAACACTCTATGAATCTAGG + Intronic
1020119777 7:5496465-5496487 CTTTAGCCACCTATGGATCCAGG - Intronic
1021059645 7:16095268-16095290 CTTTAATAAACTATGCAGTTGGG + Intronic
1021311034 7:19096266-19096288 ATTTAACAACCCATTAAGCTAGG - Intronic
1024332913 7:48174540-48174562 TTTTAACAATCTATAGAGTTAGG - Intronic
1028692516 7:93669538-93669560 CTTTATAACCTTATGGAGCTGGG - Intronic
1032588673 7:133172116-133172138 ATTAAACAACCCATGGTGCTGGG - Intergenic
1033820167 7:145125530-145125552 GTTTAACATTCTTTGGAGCTTGG + Intergenic
1037259422 8:16991123-16991145 CTTTACCAACCTGGAGAGCTGGG - Intergenic
1038639255 8:29310917-29310939 TTATAACAACCTCTGGAGTTGGG + Intergenic
1040953878 8:52960857-52960879 TTATACCAACCTCTGGAGCTGGG + Intergenic
1046403382 8:113738184-113738206 TTCTAACAACTTATGGAACTCGG + Intergenic
1051901237 9:22043580-22043602 CTTTCACAACCTAAGGAGTGGGG - Intergenic
1053640694 9:40075120-40075142 CTGTAATAACCTATGGTGCTTGG + Intergenic
1053765442 9:41390352-41390374 CTGTAATAACCTATGGTGCTTGG - Intergenic
1054321385 9:63671104-63671126 CTGTAATAACCTATGGTGCTTGG + Intergenic
1054544057 9:66301511-66301533 CTGTAATAACCTATGGTGCTTGG - Intergenic
1059695099 9:116723194-116723216 CATTAGCAAGGTATGGAGCTGGG + Intronic
1059814901 9:117901239-117901261 CTTTGAAAAACTCTGGAGCTAGG + Intergenic
1062711300 9:137976495-137976517 CTTTACCAACTTATGTAGGTAGG + Intronic
1202788466 9_KI270719v1_random:58202-58224 CTGTAACAACCTATGGTGCTTGG + Intergenic
1185981857 X:4788702-4788724 CATTAACAACCTATGAAACTGGG + Intergenic
1190791045 X:53700648-53700670 CTTTAAGAACCTTTAGATCTTGG - Intergenic
1193800915 X:85935058-85935080 CTTGAACAGCCTGTGGAACTGGG - Intronic
1199504671 X:148548204-148548226 CTTTACCTACCTATGGCCCTTGG + Intronic
1199831922 X:151556015-151556037 TTATACCAACCTCTGGAGCTGGG - Intergenic
1201556197 Y:15266752-15266774 TTATACCAACCTCTGGAGCTGGG + Intergenic
1202089619 Y:21176129-21176151 TTATACCAACCTCTGGAGCTGGG - Intergenic