ID: 929723714

View in Genome Browser
Species Human (GRCh38)
Location 2:44400435-44400457
Sequence GGCACTCACCACTCTACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929723714 Original CRISPR GGCACTCACCACTCTACCCA TGG Intronic
900995476 1:6121202-6121224 CTCACTCTCCACTCTATCCAAGG + Exonic
901511225 1:9718979-9719001 GCCACTCACCACTCTCCTCCCGG + Intronic
903275932 1:22221862-22221884 GGCACACCCAGCTCTACCCATGG + Intergenic
907232337 1:53011664-53011686 GGGACTCAGCCCTCAACCCATGG + Intronic
910297987 1:85671230-85671252 GCCACTCACCACTAAACACAAGG - Intronic
911833154 1:102580282-102580304 GACAGTCAACACTCTACTCAAGG + Intergenic
912262050 1:108120341-108120363 AGCTCTCACCACTCTCCCCAGGG + Intergenic
915897201 1:159821376-159821398 GGCACTGGCCACACTAGCCACGG + Intergenic
917005916 1:170417260-170417282 GGCCCTGACCACTCTATCAAGGG - Intergenic
917125522 1:171684168-171684190 GGGACTCACCATTCTGGCCAGGG - Intergenic
918031706 1:180819873-180819895 GGCACACACCACCACACCCAGGG - Intronic
918595817 1:186291517-186291539 GGAACTGCCAACTCTACCCAAGG - Intergenic
920445408 1:206012499-206012521 GGCACTCACTTCTCCATCCACGG + Exonic
921741320 1:218688140-218688162 GGCAATAACCACTCCTCCCATGG - Intergenic
1063483131 10:6394338-6394360 GGCACACAGCACTCCACCGATGG + Intergenic
1064726201 10:18282233-18282255 GGGACTCTCCACTCTGCCCCAGG - Intronic
1064815652 10:19258977-19258999 TGCCCTCACCACTTTCCCCATGG + Intronic
1066098447 10:32095238-32095260 AGCACTCACCACTGCAGCCAGGG - Intergenic
1067415782 10:46101295-46101317 GGCACTCACCACACTGCACCTGG + Intergenic
1068925285 10:62529444-62529466 GTCACTCACCCGTCTACACAGGG - Intronic
1072277992 10:93841536-93841558 CCTACTCACCACTCTCCCCATGG - Intergenic
1072993350 10:100219967-100219989 GGCACACACAACTCAACACAAGG + Intronic
1074401968 10:113149101-113149123 GCCACCCACCACTTCACCCAAGG + Intronic
1076786925 10:132754515-132754537 GGCCCTCACCCCTCCACCCCTGG + Intronic
1077101084 11:822693-822715 GGCTCCCACCACCCTACCCTGGG - Intronic
1078183767 11:9033883-9033905 GGCACTGACCACACCACCCACGG + Intronic
1079695990 11:23483518-23483540 GGCACCCACCACCACACCCAGGG - Intergenic
1079896271 11:26122415-26122437 GGTACTCACCACTCTCCTCTGGG - Intergenic
1081889514 11:46529126-46529148 GGAACCCACCACTCTGTCCAAGG + Intronic
1081960115 11:47129736-47129758 GGATCTCAACATTCTACCCAGGG - Intronic
1083807599 11:65084282-65084304 GGCAGGGACCACTCTCCCCAGGG - Exonic
1085351962 11:75803333-75803355 TGCCCTCACCACTACACCCAGGG - Intergenic
1088471810 11:110195133-110195155 GGCACACACCACCATGCCCAGGG + Intronic
1088890547 11:114040936-114040958 GGACCTCCCCAATCTACCCAGGG - Intergenic
1091458678 12:627797-627819 GGCATGCACCACTGTGCCCAGGG - Intronic
1091585137 12:1811608-1811630 GGGACTCACCACGCTCCCCTGGG - Intronic
1094266457 12:28565624-28565646 GGCATGCACCACTACACCCAGGG - Intronic
1096145787 12:49277665-49277687 GGCACTGACCACTCTGGCCCTGG - Intergenic
1096706216 12:53424060-53424082 CCCACTCACCACTCTTCCAAAGG - Intronic
1098795902 12:74888013-74888035 GCCTCCCACCACTCTAGCCATGG - Intergenic
1099717306 12:86311864-86311886 GGCACTCTCCACTCCAGCAAGGG + Intronic
1101492663 12:105223547-105223569 GCCTCTCTCCACTCTGCCCATGG - Intronic
1103614539 12:122143634-122143656 TGCACTCACGACCCTCCCCAGGG - Exonic
1104989158 12:132615494-132615516 GACACTCCCCACTCTCCCCTGGG + Intergenic
1106237991 13:27881545-27881567 GGCAATCAGCATTCTCCCCAGGG + Intergenic
1107974918 13:45679812-45679834 GGCTCTCCCCACACTCCCCATGG + Intergenic
1109559253 13:64025369-64025391 TGGACCCACCACACTACCCAAGG + Intergenic
1113459703 13:110473137-110473159 GGCACTCACCTCTGAATCCAGGG - Exonic
1114341532 14:21750515-21750537 GGGACTCACCATTCTGGCCAGGG + Intergenic
1116256031 14:42557305-42557327 TTTGCTCACCACTCTACCCATGG - Intergenic
1119327288 14:73768122-73768144 CGCACTCAGCACTCTAGCCTGGG + Intronic
1128084374 15:64875675-64875697 GGCCCTCACCACTCCTCCCCTGG - Intronic
1128109391 15:65067282-65067304 GGCACTGATCCCCCTACCCAAGG - Intronic
1128124833 15:65184918-65184940 GGCACCCACCACTTTCCCCGTGG - Intronic
1128157557 15:65401463-65401485 GATATTCACCACTCCACCCAGGG - Intronic
1128294108 15:66503071-66503093 GGGACTCACCGCTCTGGCCAGGG - Exonic
1128891547 15:71336235-71336257 GGCCCTCACCACTCAGACCAAGG - Intronic
1130867341 15:87944080-87944102 AGCACTCACCACCCTACCCAGGG - Intronic
1131266752 15:90920016-90920038 GGCACTGCCCACTCTGACCAAGG - Exonic
1131287326 15:91071471-91071493 AGCACTTACCTCTCCACCCATGG + Intergenic
1133156950 16:3881779-3881801 GCCACGCGCCCCTCTACCCACGG + Intergenic
1134514983 16:14879825-14879847 GGCAATCACAACTCTAACAACGG - Intronic
1134702660 16:16278472-16278494 GGCAATCACAACTCTAACAACGG - Intronic
1134964883 16:18433643-18433665 GGCAATCACAACTCTAACAACGG + Intronic
1134969170 16:18516178-18516200 GGCAATCACAACTCTAACAACGG + Intronic
1136557495 16:31016306-31016328 GGCACTCAGCATTCTTCCCAGGG + Intergenic
1138464794 16:57181577-57181599 GGGACTCACCCCTCAACCTATGG - Intronic
1138540589 16:57685113-57685135 GGCACCCACCACTGGGCCCATGG + Intronic
1144828278 17:18118645-18118667 GGCCCTCCCCACGCCACCCAGGG + Exonic
1146003860 17:29148843-29148865 GCCACTCAGCACCCTACGCACGG + Intronic
1151553513 17:74835337-74835359 GGCACTCACCTGTCTGCCCAGGG + Intronic
1152769337 17:82157739-82157761 GGCACCCACCTCTCTCCCAAGGG + Exonic
1156482963 18:37447667-37447689 GACACCCACCCCTCAACCCAGGG - Intronic
1158378749 18:56904582-56904604 GCCACTCTCCACTCTGCACAGGG - Intronic
1158772291 18:60533845-60533867 GACACACACCTCTCTAGCCAAGG + Intergenic
1161656412 19:5518224-5518246 GGCATGCACCACTGTGCCCAGGG - Intergenic
1163364004 19:16866125-16866147 GGCACCCAGCACTCTCCGCATGG - Intronic
1167472750 19:49684620-49684642 GGCACTCACCCCTCGCCCCCTGG - Intronic
929723714 2:44400435-44400457 GGCACTCACCACTCTACCCATGG + Intronic
935568025 2:104629953-104629975 GGAACTCCCTCCTCTACCCAAGG - Intergenic
937085320 2:119167863-119167885 AGCCCCCACCACTCTACCAAAGG + Intergenic
938300621 2:130208906-130208928 TGCAGTCACCACTTTAGCCAAGG + Intergenic
938456104 2:131465565-131465587 TGCAGTCACCACTTTAGCCAAGG - Intronic
939951972 2:148486281-148486303 AGCTCTCACCACTCTTCCCCTGG + Intronic
947433298 2:230049810-230049832 GGCACTCAACACCCAGCCCAGGG + Exonic
948976389 2:241466261-241466283 GGGACTCACCACTCCACACCGGG - Intronic
949077152 2:242067678-242067700 GGCACTCAGCACACAGCCCAGGG - Intergenic
1169899887 20:10542227-10542249 TGCACTGGCCACTCAACCCAGGG - Intronic
1170579064 20:17684286-17684308 GGCACTCACCATTCTGCCAAGGG - Intergenic
1171508368 20:25658312-25658334 GGCAGTCACGATGCTACCCATGG + Intergenic
1174289312 20:49496456-49496478 GGCACTCACCTTTCCTCCCAGGG - Intergenic
1176229341 20:64023827-64023849 GGCACTGCCCACTGTGCCCAGGG - Intronic
1178864519 21:36316914-36316936 GGAACTCCCTCCTCTACCCAAGG - Intergenic
1179493363 21:41755997-41756019 GCCACTCCGCACTCTACGCAGGG + Intronic
1180074656 21:45456406-45456428 CGCAGTCACCACTTTAACCAGGG + Intronic
1181364237 22:22362768-22362790 AGCACTCCCCTCTCTAACCAGGG - Intergenic
1183714878 22:39527799-39527821 GTCACTCTGCACTCTACACAGGG + Intergenic
1185288793 22:50014020-50014042 GGCACTAGCCACTCTCTCCAGGG - Intergenic
1185374216 22:50474729-50474751 GGCCCTCAGCACTCGACCCTCGG + Intronic
950675847 3:14554016-14554038 TGCACACACCACTGTCCCCAGGG - Intergenic
954341639 3:49958827-49958849 GGCACTCAGCACTCCAGCCAGGG - Intronic
956528884 3:70194878-70194900 AGCACCCACCCCTCTACCCGTGG - Intergenic
958428590 3:94009617-94009639 GGGACTCACCACTCTATCTAAGG - Intronic
960698329 3:120416963-120416985 CTCATTCACCACTCAACCCAGGG + Intronic
967009459 3:185418510-185418532 GGGACTCACCGCTCTGGCCAGGG - Intronic
967051949 3:185792990-185793012 GGCACTCAACACTTTGCTCATGG + Intronic
967948522 3:194822924-194822946 GGCACTCCTCAGTCTTCCCACGG + Intergenic
968322162 3:197779677-197779699 GGCACACACCACCACACCCAGGG + Intronic
971403404 4:26297258-26297280 AGCACTCAGCACTCTAGCCGGGG + Intronic
978108199 4:104930462-104930484 GGAACTCCCTCCTCTACCCAAGG + Intergenic
979291900 4:118987518-118987540 GGCACTCACCACCACACCCAGGG - Intronic
979725505 4:123956021-123956043 GACCATCACCACTCTACCAACGG - Intergenic
980499034 4:133625007-133625029 GGCTCTCTCCACTTGACCCATGG + Intergenic
981309418 4:143282293-143282315 GGCTCTGACCCCTCTTCCCATGG + Intergenic
981584780 4:146289157-146289179 GGCACTGAACAAGCTACCCAGGG + Intronic
983848351 4:172547020-172547042 GGCAGCCACCATTCTACCCTCGG + Intronic
985146239 4:186896986-186897008 CTTATTCACCACTCTACCCATGG + Intergenic
985849524 5:2378580-2378602 GGCACTCACCACTGAGCCCAGGG - Intergenic
986187704 5:5460159-5460181 GTCACACCCCACTCTACACAGGG - Intronic
988128496 5:27073680-27073702 GGAACTGACCATGCTACCCATGG + Intronic
988911976 5:35852310-35852332 CACTCTCACCACTCTTCCCAGGG + Intergenic
990344760 5:54861167-54861189 GGCACCCACCACCATGCCCAGGG + Intergenic
990803440 5:59631649-59631671 GGAACTCCCTCCTCTACCCAAGG + Intronic
995501162 5:112808577-112808599 GGCACTCACCACCATGCCCTAGG + Intronic
998675294 5:144401116-144401138 GGCACTCACCACTCTGTTCAAGG - Intronic
999775326 5:154808279-154808301 AGCACTAACCACTCTGCCCCAGG - Intronic
1001445794 5:171781783-171781805 GGAAGTCCCCACTCGACCCAGGG - Intergenic
1002162109 5:177320492-177320514 GGCACTGAACACTCTAGCCTGGG - Intergenic
1002180679 5:177429485-177429507 GACACCCACCCCTCAACCCAGGG - Intronic
1007865943 6:44971012-44971034 GGCTCTCACCATCCTCCCCAAGG + Intronic
1011611832 6:89159506-89159528 GGGTCTCACTTCTCTACCCAGGG + Intronic
1014130769 6:117829720-117829742 GGTACTCATCACGCTTCCCATGG - Intergenic
1017180442 6:151546805-151546827 GGAACCCACCACACTACACAGGG - Intronic
1027721531 7:81747786-81747808 GGCACGCACCACCAGACCCAAGG - Intronic
1029044375 7:97612533-97612555 GGAACTCACCTCTCTGCACAGGG + Intergenic
1029713762 7:102314545-102314567 GGCTGTCACCACTGCACCCACGG - Exonic
1031582795 7:123498029-123498051 GACACTCACCACTCTTGCCTAGG - Intronic
1034971414 7:155422070-155422092 TGCACTCACAGCTCTGCCCAGGG - Intergenic
1035535704 8:389563-389585 GGCACTCAGCACACAGCCCAGGG - Intergenic
1037987511 8:23299181-23299203 AACACACACCCCTCTACCCAGGG + Intronic
1038001762 8:23397814-23397836 GGCATGCACCACTATGCCCACGG - Intronic
1038119824 8:24600705-24600727 GCCACTCACCACTCCAACCTAGG + Intergenic
1039879916 8:41618799-41618821 GGCACTCACCTCTCTAGTCATGG - Exonic
1041360412 8:57047044-57047066 GGCACTCTCCAATCTTCCCATGG + Intergenic
1042944767 8:74144122-74144144 AGCCCTCCCCACTCTCCCCATGG - Intergenic
1043355329 8:79404917-79404939 GGCATTCACCACTGTCCCCTGGG + Intergenic
1045810580 8:106215835-106215857 GGCACTCAACACCCAGCCCAGGG - Intergenic
1048258528 8:132924785-132924807 GGCACTCAACACTCTTACAACGG - Intronic
1048969582 8:139637869-139637891 GGCACTCCCCACACTTCCCTGGG + Intronic
1051065186 9:13093992-13094014 GGCACTCAGTCCTCTCCCCAAGG + Intergenic
1051845974 9:21451635-21451657 AGCACTCACAACTCAACCAATGG + Intergenic
1053643362 9:40107831-40107853 GTCACTGTCCACTCTGCCCAGGG - Intergenic
1053762790 9:41357659-41357681 GTCACTGTCCACTCTGCCCAGGG + Intergenic
1054541392 9:66268772-66268794 GTCACTGTCCACTCTGCCCAGGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1062247199 9:135575262-135575284 GGCACCCCCTTCTCTACCCAGGG - Intergenic
1187463672 X:19509909-19509931 GGCAATCACCACTGATCCCATGG + Intronic
1190203334 X:48382187-48382209 GGCATGCACCACCCTGCCCACGG - Intergenic
1190207202 X:48413217-48413239 GGCATGCACCACCCTGCCCACGG + Intergenic
1190862974 X:54360984-54361006 AACAGTCACAACTCTACCCATGG - Intergenic
1193356062 X:80521408-80521430 GGAACTCTCTACCCTACCCAAGG - Intergenic
1195167902 X:102238649-102238671 GGCACTGACCAATTCACCCATGG - Intergenic
1195190955 X:102448438-102448460 GGCACTGACCAATTCACCCATGG + Intronic