ID: 929724735

View in Genome Browser
Species Human (GRCh38)
Location 2:44413281-44413303
Sequence TAGGGTCAAATGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929724733_929724735 -8 Left 929724733 2:44413266-44413288 CCTCATCTCAAAATGTAGGGTCA 0: 1
1: 0
2: 0
3: 14
4: 163
Right 929724735 2:44413281-44413303 TAGGGTCAAATGAAAGAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929724735 Original CRISPR TAGGGTCAAATGAAAGAGGC AGG Intronic
900107704 1:991873-991895 GAGTGTCAAAAGTAAGAGGCAGG + Intergenic
901031791 1:6311394-6311416 TAGGCTGAAATGAGAGAGACAGG + Intronic
901458319 1:9376624-9376646 CATGGTCCAATTAAAGAGGCTGG - Intergenic
902908734 1:19579264-19579286 CTGGGCCAAATGAAAGAGGGTGG - Intergenic
903579154 1:24358072-24358094 AAGGGACAAATGAGAAAGGCAGG + Exonic
903810672 1:26033421-26033443 TGGTTTCAAATGCAAGAGGCTGG - Intronic
904636714 1:31887529-31887551 TAATGTTAAATGAAAGAAGCCGG - Intergenic
909382775 1:75018880-75018902 TAGGGACAAGTGACAGAGGAAGG - Intergenic
911861115 1:102950715-102950737 CTGGGTCAAAAAAAAGAGGCTGG - Intronic
912985794 1:114429118-114429140 TAGGGTTAAATGCAACAGACTGG + Intronic
913648355 1:120884400-120884422 TATGGTGAAATGGAAGAGTCTGG - Intergenic
914078338 1:144378894-144378916 TATGGTGAAACGAAAGAGCCTGG + Intergenic
914100841 1:144587608-144587630 TATGGTGAAACGAAAGAGCCTGG - Intergenic
914173245 1:145247424-145247446 TATGGTGAAACGAAAGAGCCTGG + Intergenic
914527899 1:148488562-148488584 TATGGTGAAACGAAAGAGTCTGG + Intergenic
915443367 1:155960659-155960681 AAGGGATAAAGGAAAGAGGCTGG + Intronic
917414959 1:174799343-174799365 TAGGGTAAAATGATAGAGTATGG - Intronic
919212696 1:194509364-194509386 CAGGGTCTAATGAAAGAATCGGG - Intergenic
921225335 1:213014030-213014052 TTGGGGGAAATGAAAGAGGATGG + Intronic
922813039 1:228428714-228428736 TAGGGAGGAATGAATGAGGCTGG - Intergenic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1064471100 10:15636846-15636868 TAGTGAAAAATGAAAGAGGTCGG + Intronic
1064830243 10:19456238-19456260 GAGGGTAAAATAAAAGAAGCTGG + Intronic
1066581544 10:36887415-36887437 TAGGGTCACATGGAAGTGACGGG + Intergenic
1068254061 10:54485246-54485268 TAGGGTAAAATGAAAGTTTCTGG - Intronic
1068776492 10:60873420-60873442 TAGGGTCTAATGAATGAGCATGG + Intronic
1069853077 10:71423152-71423174 TAAGGTCCAGTGAAAGAGACAGG + Intronic
1070511813 10:77168279-77168301 TAGGATTAAATGAGATAGGCCGG + Intronic
1071947829 10:90667582-90667604 CATGGTCAAATGAATGGGGCTGG - Intergenic
1073915494 10:108398350-108398372 TAGATTCATATGAAAGATGCTGG - Intergenic
1074933845 10:118158218-118158240 TTGGGTCAAGGGAAAGAGGTTGG + Intergenic
1076451377 10:130559380-130559402 TTGGGTCAAATGAGTCAGGCCGG + Intergenic
1077481253 11:2815689-2815711 GAGGGGCAATTGGAAGAGGCTGG + Intronic
1078703602 11:13716462-13716484 TGTGATCAGATGAAAGAGGCCGG + Intronic
1078988626 11:16622145-16622167 TTGGGTCATATGAATGAGGGTGG - Intronic
1080126112 11:28735852-28735874 TACATTCAAATGAAAGAAGCTGG + Intergenic
1081563713 11:44242738-44242760 TAGGGTCCAATGAAGGGGACTGG - Intronic
1081698180 11:45133345-45133367 TAGGGTTAAATGCAACAGGGAGG - Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1083384019 11:62294263-62294285 GATGGTCAAATGTCAGAGGCAGG + Intergenic
1085336431 11:75700339-75700361 TAGGGTCAAATGCAATGGTCAGG + Intergenic
1086151257 11:83613155-83613177 TAGGGTCAAACTATGGAGGCAGG + Intronic
1086585150 11:88442933-88442955 TAAAGTCATATGAAAGAGCCTGG + Intergenic
1089261692 11:117228104-117228126 TTGGGCCAAATAAAAGAGCCTGG - Intronic
1089454783 11:118619683-118619705 TAGGGTCAAATGCAAAATGAAGG - Intronic
1091348179 11:134869995-134870017 TAGGGGAAAATGAAAGAAACTGG - Intergenic
1093169238 12:15840844-15840866 TAGGAAAAAATGAAAGAGGCTGG - Intronic
1094345659 12:29465694-29465716 TATGGTCAAAAGAAAGGGGCAGG - Intronic
1097746660 12:63310857-63310879 AAGGGGGAAATGAGAGAGGCAGG - Intergenic
1098362916 12:69672607-69672629 TATGCTGAGATGAAAGAGGCTGG + Intronic
1099410604 12:82322032-82322054 TAAGGTCAAATGTAAAAAGCAGG + Intronic
1100666461 12:96758683-96758705 TAGGGTTTAATGAATGAGGAGGG + Intronic
1102573895 12:113844019-113844041 TAGGCTCAGGTGGAAGAGGCTGG - Intronic
1104266957 12:127242757-127242779 TAGGGACAAATTAATGAAGCAGG + Intergenic
1105881112 13:24607216-24607238 TAGGGGCACATGACAGAGCCTGG + Intergenic
1106469057 13:30038680-30038702 TAGTGCCAAATGAAACAGGTAGG - Intergenic
1106976645 13:35225572-35225594 TAGGTTTGAATGGAAGAGGCTGG + Intronic
1107151087 13:37112523-37112545 CGGGGTCACATGACAGAGGCTGG - Intergenic
1108260989 13:48656260-48656282 TATGGTCAAGTGAAAGAAGATGG - Intronic
1108605018 13:52029125-52029147 TAGAGTCAAATCAAAGAAGGTGG + Exonic
1111876941 13:93909651-93909673 ATGGGTCAAATTAAAGGGGCTGG - Intronic
1112714160 13:102164531-102164553 TAGAGAAAAATGAAACAGGCAGG + Intronic
1113152679 13:107282369-107282391 TAGGGTCATAACAAAGAGGATGG + Intronic
1116899498 14:50348316-50348338 TATGGGCAAATGATAGAGGAGGG - Intronic
1117507681 14:56418907-56418929 TGGGGTCAGAAGAAAGAGGGAGG - Intergenic
1117767845 14:59101282-59101304 GAGGGGGCAATGAAAGAGGCAGG - Intergenic
1120252756 14:82079137-82079159 GAGGGGCCAATGAAAGAGGAGGG - Intergenic
1120735306 14:88045960-88045982 TAGTGTCAAATGCAACAGGAAGG - Intergenic
1121338525 14:93091650-93091672 GAGGGTGGAATGAATGAGGCTGG + Intronic
1125312514 15:38395973-38395995 TAAAGTAAAATGAAAGAGGATGG - Intergenic
1125625039 15:41101462-41101484 TAAGGTGAAATAAAAGAGGATGG - Intronic
1126859803 15:52872737-52872759 AAGGGTCAAGTGAATGAGGAAGG - Intergenic
1128559192 15:68653434-68653456 TATGGCCAAATCACAGAGGCAGG + Intronic
1128695643 15:69760332-69760354 TGGGGCCAAAAGAAAGAAGCTGG - Intergenic
1130608263 15:85337069-85337091 TAGGGTCATGTGGAAGTGGCAGG + Intergenic
1133674022 16:8052719-8052741 TAGAGTCTAATGAGAGAGACAGG + Intergenic
1134120568 16:11581295-11581317 TAAGGTGAAATGGAATAGGCAGG + Intronic
1135207479 16:20495090-20495112 AGGGGTCAAAGGAAAGAGGGTGG + Intergenic
1135211406 16:20528542-20528564 AGGGGTCAAAGGAAAGAGGGTGG - Intergenic
1140706757 16:77637856-77637878 TAGGGACAAACAAAAAAGGCAGG - Intergenic
1143018240 17:3903280-3903302 CAGGGTCTTGTGAAAGAGGCAGG + Exonic
1143184773 17:5003588-5003610 TGGGGTCAGAGGAAACAGGCAGG - Intronic
1143687971 17:8534497-8534519 TGGGGCCAAAGGAAAGAGACAGG - Intronic
1144806092 17:17968813-17968835 TAGGGACAGCTGAATGAGGCAGG - Intronic
1144835231 17:18153380-18153402 TAGGATGAAATGGGAGAGGCAGG - Intronic
1149791281 17:59479755-59479777 TATTGTTAAATGAAAAAGGCAGG + Intergenic
1155155615 18:23154978-23155000 CAGGGTCAAATAAAAAAGTCTGG - Intronic
1155796348 18:30042721-30042743 AAGAGTCTAATGAAAGAAGCAGG - Intergenic
1157285151 18:46372607-46372629 TGGGTTCCAATGAGAGAGGCTGG + Intronic
1158251155 18:55489034-55489056 TGGGGACACATGACAGAGGCTGG + Intronic
1160843840 19:1158071-1158093 CAGGCTCAGAAGAAAGAGGCGGG - Intronic
1166439520 19:42799812-42799834 TCCTGCCAAATGAAAGAGGCAGG + Intronic
927448185 2:23184250-23184272 TTGGGTGGAAAGAAAGAGGCCGG - Intergenic
927673089 2:25085289-25085311 AAAGGTCAAATGACAGAAGCAGG + Intronic
928830364 2:35475439-35475461 GAGGGTAAAATGAGAGAAGCAGG + Intergenic
929049330 2:37821992-37822014 TACTGTTAAATGAAAAAGGCAGG - Intergenic
929724735 2:44413281-44413303 TAGGGTCAAATGAAAGAGGCAGG + Intronic
929942384 2:46344459-46344481 GAGGGTCAGGTGAAAGATGCTGG - Intronic
930756572 2:54979741-54979763 TAGAGGCAAATGAATAAGGCAGG - Intronic
931565792 2:63614517-63614539 TACTTTGAAATGAAAGAGGCTGG + Intronic
931879670 2:66555305-66555327 TGGAGCCAAATGAAAGAGGGAGG - Intronic
932131985 2:69195965-69195987 GAGGGTTATAGGAAAGAGGCTGG + Intronic
933061656 2:77744880-77744902 TGGGGACAAGTGAAAGAGGGTGG - Intergenic
934866097 2:97813153-97813175 TGAGGGCACATGAAAGAGGCAGG + Intronic
935334322 2:102001059-102001081 CAGGGTCTAATGCAGGAGGCAGG + Intronic
935712410 2:105910907-105910929 TTGGGTCTAATGATAGAGGCAGG + Intergenic
940368112 2:152871281-152871303 TAGAGACAAATGAAAGAGCATGG + Intergenic
941018669 2:160385434-160385456 TAGGTTCAAAAGTAACAGGCAGG + Intronic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943815656 2:192250805-192250827 GAGGGCCCAATGAAAGAGACTGG - Intergenic
944756877 2:202772430-202772452 GAGGGTCAAAAGAAAGGAGCTGG + Intergenic
944863981 2:203842770-203842792 TAGGGTGAAAGGAGAGAAGCAGG + Intergenic
946982295 2:225230604-225230626 TAGTTTCAAATGACAGAGGCTGG + Intergenic
947061376 2:226170351-226170373 AAGGGTAAAATAAAAGAAGCAGG - Intergenic
948718716 2:239882813-239882835 TGGGGTCAATTGGAAGAGGGTGG + Intergenic
1168772511 20:424440-424462 TAGGGGCATAGGAGAGAGGCAGG - Intronic
1168794897 20:604856-604878 TAGGGACAAAAGCAAGGGGCAGG + Intronic
1171404240 20:24899133-24899155 AGGGGTGAAATGATAGAGGCAGG - Intergenic
1173908100 20:46643336-46643358 TAGGGTCTAAAGATAGGGGCAGG + Intronic
1173944429 20:46939292-46939314 TAGGGTCAGATTAAAGACACTGG + Intronic
1175591781 20:60199258-60199280 TAGGCTCAAAATAAAGAGACGGG - Intergenic
1177094477 21:16815556-16815578 AAAGATCAAATGTAAGAGGCAGG - Intergenic
1177567400 21:22843234-22843256 GAGGGGCAAATGATAGAGGCAGG - Intergenic
1181821310 22:25477824-25477846 TAGGGTCAATAGAATGAGGCAGG - Intergenic
1183490650 22:38113811-38113833 TGGGGTCACGTGCAAGAGGCTGG - Intronic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
949869970 3:8580147-8580169 ATGGTTCAAATCAAAGAGGCAGG + Intergenic
952173477 3:30835568-30835590 TAGGGTGAAGTGAATGAGTCAGG + Intronic
952827354 3:37535538-37535560 TGGGGTAAAGTGGAAGAGGCTGG + Intronic
953466547 3:43126651-43126673 TATGGGTAAATGAAAAAGGCAGG - Intergenic
957285167 3:78208359-78208381 TAGGGGCAAATGACACAGTCAGG + Intergenic
957961807 3:87264734-87264756 TAGGGTTAAAGGAAAGAAGCAGG + Intronic
959156390 3:102671475-102671497 AAGGGTCAAATGAGAGAGCATGG - Intergenic
959229414 3:103629522-103629544 CAGAGACAAATGAGAGAGGCAGG - Intergenic
962351067 3:134656128-134656150 TAGGATGAAATGAAAGAGTAAGG + Intronic
962422980 3:135244233-135244255 TGGGATCTAATTAAAGAGGCAGG - Intronic
964940313 3:162152615-162152637 TAGGCTCAAAGAAAAGAGGAGGG - Intergenic
965491213 3:169338770-169338792 TATAGTCTAATGAAGGAGGCAGG - Intronic
966207341 3:177418677-177418699 TATTGTTAAATGAAAGATGCAGG - Intergenic
966277615 3:178194456-178194478 TAGGATCAAATTTAAGAGACAGG + Intergenic
968093453 3:195911733-195911755 TAGGTTCAAAGGAAAGAGTGAGG + Intronic
968865270 4:3206189-3206211 AAGGGTCAAAGGACAAAGGCAGG - Intronic
970353682 4:15231644-15231666 TAGGGTAAAATGAATTAGGCTGG - Intergenic
971520448 4:27543435-27543457 TTGGGTCAAATTAAATAGGTAGG - Intergenic
972213989 4:36874062-36874084 TAAGGCCAGATGAAAGAGGATGG - Intergenic
973213476 4:47642267-47642289 TAGACTCTAATGAAAGAGACAGG + Intronic
977611193 4:99033641-99033663 AAGGGGTAAAGGAAAGAGGCAGG - Intronic
979514831 4:121595781-121595803 GAGGACCAAATGAAACAGGCTGG + Intergenic
980393574 4:132178004-132178026 TAGGGTCAAAAGAAAGATACCGG + Intergenic
980562145 4:134491178-134491200 TAGGCTGAAATTAAAGAGGTGGG + Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
982271342 4:153592528-153592550 TAGGGTACAAGGAGAGAGGCAGG - Exonic
982771898 4:159404143-159404165 GAAGGTCTAAGGAAAGAGGCGGG - Intergenic
983170580 4:164531383-164531405 ATGGGTTAAATGAAAGTGGCTGG - Intergenic
985001017 4:185483052-185483074 TAGGGTCAAATGAAACAACATGG - Intergenic
986153380 5:5148807-5148829 TATTGTCTAATGAGAGAGGCAGG + Intronic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
989979618 5:50627939-50627961 TATGGTGAAATGAAAGAAGCTGG - Intergenic
990283950 5:54280949-54280971 TTGGGTCAACTGACACAGGCTGG + Intronic
991651418 5:68858813-68858835 TAGGGTAAGATGGAAGAGGATGG + Intergenic
992339104 5:75804275-75804297 TTGGTTCTAATGAATGAGGCTGG + Intergenic
995035655 5:107531373-107531395 TACTGACAAATGAAAGGGGCAGG + Intronic
999581004 5:153037792-153037814 TAGGGTCAAATGGAAAAATCAGG + Intergenic
1001283222 5:170403112-170403134 AAGGGACAAATGAGAGAGGGAGG - Intronic
1003885400 6:10517173-10517195 TAGTGTTAAATGAAAGTAGCAGG - Intronic
1005156473 6:22812595-22812617 AAAGATGAAATGAAAGAGGCTGG + Intergenic
1005997000 6:30937491-30937513 TTGGGGCCACTGAAAGAGGCGGG + Intergenic
1006756427 6:36419680-36419702 TAGGGTTGTATGAAAAAGGCTGG + Intronic
1006918258 6:37610161-37610183 TAGGCTGCAATGAAAGAAGCAGG - Intergenic
1007275511 6:40670599-40670621 TAGGATCAAATAAAAGGGACTGG - Intergenic
1008658707 6:53643745-53643767 TAGGGAAAAATGGAAAAGGCCGG + Intergenic
1009804773 6:68589576-68589598 TATGGTAAAAGGAAAGAGCCTGG + Intergenic
1012340201 6:98111766-98111788 TGGAGTCAAATGAAAGTGGGAGG + Intergenic
1013141402 6:107339517-107339539 TATGGTCTAATGGAAGAGACTGG + Intronic
1014243737 6:119045180-119045202 TATGGTCATATCAAAGAAGCTGG + Intronic
1014937359 6:127400034-127400056 TGGGGTAAAATGGAAGAGGAGGG + Intergenic
1014959370 6:127663675-127663697 TAGGCTTAAAGGAAACAGGCAGG + Intergenic
1015951045 6:138552724-138552746 TAAGGGCAACCGAAAGAGGCTGG - Intronic
1016205820 6:141467132-141467154 GAGGGGGAAATGATAGAGGCAGG - Intergenic
1017445612 6:154504707-154504729 AAGGATGAAATCAAAGAGGCTGG + Intronic
1020139832 7:5606175-5606197 TAGGGTGAAAGGAAAGAGACAGG - Exonic
1021212771 7:17875772-17875794 TAAGGTCAAAAGAAATAGACTGG - Exonic
1023116849 7:36871233-36871255 TAAGATCAGGTGAAAGAGGCTGG + Intronic
1023454557 7:40324072-40324094 TAGGTTCAAATGCAAGAGTTTGG - Intronic
1023499777 7:40835217-40835239 TAAGGTGAAATGGAAGAGGAAGG - Intronic
1024214931 7:47240563-47240585 TAAAGTCAAATGAAGGAGCCTGG - Intergenic
1024276390 7:47680352-47680374 TAGTGTCAAAAAAAAGAGGCCGG + Intergenic
1027418623 7:77998363-77998385 GAGGGACAAATGAATGACGCAGG + Intergenic
1027618483 7:80453203-80453225 TAGAGTCAAATGAAAGAAAAAGG - Intronic
1031085353 7:117297032-117297054 CAGGATCACATGAAAGATGCTGG + Intronic
1031348052 7:120693580-120693602 GAGGGAAAAAGGAAAGAGGCAGG + Intronic
1032282500 7:130515745-130515767 AAGGGATAAATGAATGAGGCTGG + Intronic
1037836241 8:22216302-22216324 CAGGTTAAAATGAAAGATGCTGG + Intergenic
1038998752 8:32955909-32955931 TTGGGTCAAATGAAAGAAAGTGG - Intergenic
1040589817 8:48780761-48780783 TACGGACAAATGCCAGAGGCGGG - Intergenic
1043441266 8:80278987-80279009 AAGGGACAAATGCAAGAGCCTGG + Intergenic
1044749114 8:95399434-95399456 TATGGGCAAAGGACAGAGGCTGG + Intergenic
1044999162 8:97865430-97865452 TAGGGCCAAAAGAAAGACACAGG - Intergenic
1046241930 8:111507719-111507741 TTAGGTTAAGTGAAAGAGGCAGG + Intergenic
1047711007 8:127552340-127552362 TGAGGTTAAGTGAAAGAGGCTGG + Intergenic
1049921751 9:371016-371038 TAGAAGCAAATGAATGAGGCAGG - Intronic
1052724271 9:32211121-32211143 TAGGGTAGAATGAAAGAAGGGGG - Intergenic
1056891008 9:90492516-90492538 TAGGGGAAAATGAAAGTGGTTGG + Intergenic
1057944308 9:99311682-99311704 TAGGGTCCCATGAAAGAGGGAGG - Intergenic
1059530924 9:115035013-115035035 CTGGTTAAAATGAAAGAGGCTGG + Intronic
1060183802 9:121551787-121551809 CACCGTCCAATGAAAGAGGCAGG - Intergenic
1185992226 X:4904026-4904048 TAGAACCAAATGCAAGAGGCAGG + Intergenic
1186102995 X:6176470-6176492 GAGATTCAAATGAAAGAGGCAGG + Intronic
1186612552 X:11152488-11152510 TGGGGTCACAATAAAGAGGCTGG - Intronic
1187288565 X:17930267-17930289 TCGTGGCAAAGGAAAGAGGCTGG + Intergenic
1189166466 X:38865857-38865879 TCTGGACTAATGAAAGAGGCAGG - Intergenic
1191966053 X:66759670-66759692 TAGGATCAAATTAAAGAGTAAGG - Intergenic
1193377008 X:80773349-80773371 TAGGTTGAAATGACAGAGGTGGG - Intronic
1194346862 X:92775694-92775716 TAGGTTCAAAACAAAGAGGTGGG + Intergenic
1194809704 X:98375229-98375251 GAGGGGCAAATGATAGAGACAGG - Intergenic
1196871845 X:120120154-120120176 TATTGTCAAATAAAAGAGGCAGG - Intergenic
1197644642 X:129004405-129004427 TACTCTCAAATGAAAGGGGCAGG + Intergenic
1199066385 X:143423586-143423608 TATGATCAAGTGAAAGATGCAGG - Intergenic
1200655194 Y:5892338-5892360 TAGGTTCAAAACAAAGAGGTGGG + Intergenic
1200765389 Y:7076607-7076629 TATGATAAAATGATAGAGGCTGG + Intronic