ID: 929725139 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:44417430-44417452 |
| Sequence | ATGAATACATAAATGAATTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3006 | |||
| Summary | {0: 1, 1: 0, 2: 33, 3: 324, 4: 2648} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 929725139_929725140 | -4 | Left | 929725139 | 2:44417430-44417452 | CCACAATTCATTTATGTATTCAT | 0: 1 1: 0 2: 33 3: 324 4: 2648 |
||
| Right | 929725140 | 2:44417449-44417471 | TCATCTATTGATAGACATTCAGG | 0: 1 1: 8 2: 179 3: 1191 4: 4466 |
||||
| 929725139_929725141 | 6 | Left | 929725139 | 2:44417430-44417452 | CCACAATTCATTTATGTATTCAT | 0: 1 1: 0 2: 33 3: 324 4: 2648 |
||
| Right | 929725141 | 2:44417459-44417481 | ATAGACATTCAGGTTGTTTCCGG | 0: 2 1: 2 2: 15 3: 64 4: 308 |
||||
| 929725139_929725142 | 12 | Left | 929725139 | 2:44417430-44417452 | CCACAATTCATTTATGTATTCAT | 0: 1 1: 0 2: 33 3: 324 4: 2648 |
||
| Right | 929725142 | 2:44417465-44417487 | ATTCAGGTTGTTTCCGGTTTTGG | 0: 1 1: 2 2: 44 3: 286 4: 1033 |
||||
| 929725139_929725143 | 13 | Left | 929725139 | 2:44417430-44417452 | CCACAATTCATTTATGTATTCAT | 0: 1 1: 0 2: 33 3: 324 4: 2648 |
||
| Right | 929725143 | 2:44417466-44417488 | TTCAGGTTGTTTCCGGTTTTGGG | 0: 1 1: 3 2: 40 3: 294 4: 1416 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 929725139 | Original CRISPR | ATGAATACATAAATGAATTG TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||