ID: 929725139

View in Genome Browser
Species Human (GRCh38)
Location 2:44417430-44417452
Sequence ATGAATACATAAATGAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3006
Summary {0: 1, 1: 0, 2: 33, 3: 324, 4: 2648}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929725139_929725140 -4 Left 929725139 2:44417430-44417452 CCACAATTCATTTATGTATTCAT 0: 1
1: 0
2: 33
3: 324
4: 2648
Right 929725140 2:44417449-44417471 TCATCTATTGATAGACATTCAGG 0: 1
1: 8
2: 179
3: 1191
4: 4466
929725139_929725141 6 Left 929725139 2:44417430-44417452 CCACAATTCATTTATGTATTCAT 0: 1
1: 0
2: 33
3: 324
4: 2648
Right 929725141 2:44417459-44417481 ATAGACATTCAGGTTGTTTCCGG 0: 2
1: 2
2: 15
3: 64
4: 308
929725139_929725142 12 Left 929725139 2:44417430-44417452 CCACAATTCATTTATGTATTCAT 0: 1
1: 0
2: 33
3: 324
4: 2648
Right 929725142 2:44417465-44417487 ATTCAGGTTGTTTCCGGTTTTGG 0: 1
1: 2
2: 44
3: 286
4: 1033
929725139_929725143 13 Left 929725139 2:44417430-44417452 CCACAATTCATTTATGTATTCAT 0: 1
1: 0
2: 33
3: 324
4: 2648
Right 929725143 2:44417466-44417488 TTCAGGTTGTTTCCGGTTTTGGG 0: 1
1: 3
2: 40
3: 294
4: 1416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929725139 Original CRISPR ATGAATACATAAATGAATTG TGG (reversed) Intronic
Too many off-targets to display for this crispr