ID: 929726004

View in Genome Browser
Species Human (GRCh38)
Location 2:44428236-44428258
Sequence CAGGATGGAGAGTTGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 425}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929726004 Original CRISPR CAGGATGGAGAGTTGGAAAT GGG Intronic
902496401 1:16874873-16874895 CAGAATGGAGAGGGGGAAATGGG - Intronic
902957847 1:19938290-19938312 AAGGATGGAGAGTGGGAGAAGGG - Intergenic
903669283 1:25025961-25025983 CAGGGCAGAAAGTTGGAAATGGG - Intergenic
904203959 1:28840537-28840559 CAGGCTGCAGAGTGGCAAATAGG - Intronic
904398123 1:30236651-30236673 CAGGATGGGGAATTGGAAGGGGG + Intergenic
904445476 1:30570273-30570295 CAGGGTGAAGAGTTTTAAATGGG + Intergenic
906781080 1:48573282-48573304 CAGTAGGGAGAGTGGGAAACTGG + Intronic
906999482 1:50835614-50835636 CATAATAGAGATTTGGAAATAGG - Intronic
907349788 1:53818573-53818595 CAGCCTGGAGAGTTGGGAAGGGG - Intronic
907542833 1:55232099-55232121 CATGATGCAGAGTTGAAGATTGG + Intergenic
907616294 1:55930196-55930218 CAGAAAGGAGAGCTGGAGATGGG + Intergenic
908410309 1:63857839-63857861 CAGGATGGGGACTTGGAGGTGGG - Intronic
908516617 1:64898621-64898643 CAGGCTTGTGAGATGGAAATGGG - Intronic
908877696 1:68696894-68696916 CAGGATTTAGAGTTAGAACTTGG - Intergenic
909094503 1:71270828-71270850 TGGGATGGAGAGCTGGAAAGGGG + Intergenic
909917406 1:81337117-81337139 AGGGATGGAGAGCTGGAAAGGGG - Intronic
910149622 1:84126338-84126360 CAGGATGGGGAGCTGGAAAGCGG + Intronic
910169365 1:84361099-84361121 CAGGAAGGAGACTCGAAAATGGG - Intronic
912041468 1:105396687-105396709 CAGAATGGGGAATTGGAAAGGGG + Intergenic
912041737 1:105398692-105398714 CAGGGTGGGGAATTGGAAAGGGG + Intergenic
912649189 1:111423161-111423183 CACGAAGGTGAGTTGGACATGGG + Intronic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
914253620 1:145942671-145942693 AAGGAAGGAGAGTGGGAGATGGG - Intronic
915631711 1:157157863-157157885 CAGGAAGGAGTTTTGGAGATGGG - Intergenic
915872594 1:159576858-159576880 CATGATGGAGGGCTGGAGATGGG - Intergenic
916338815 1:163705079-163705101 CAGGACTGGGAGTTGGAAGTGGG - Intergenic
917589194 1:176459633-176459655 CAGGATGGGGAGCTGGAAAGGGG + Intergenic
917632367 1:176903063-176903085 CAGGATGGAGAGAAGCAAAGGGG + Intronic
919240848 1:194914365-194914387 TAGGAAGGAGAGCTGGAAAGGGG - Intergenic
919253733 1:195095591-195095613 CATGTAGGACAGTTGGAAATAGG + Intergenic
920795569 1:209133089-209133111 TGGGATGGAGAATTGGAAAAGGG + Intergenic
920833158 1:209483280-209483302 CAGGTTGCACAGTTAGAAATTGG - Intergenic
921404102 1:214760155-214760177 GAGGATGGAGAGTGGGACAAGGG - Intergenic
922280765 1:224121847-224121869 CAGGAGGCAGAGGTGGCAATGGG - Intronic
922523251 1:226276379-226276401 CTGGAAGTAGAGGTGGAAATGGG - Intronic
922816108 1:228450593-228450615 CAGGATGGAGGGGTGGAGAGGGG - Intergenic
923236939 1:232043103-232043125 CAGAATGGAGACTTGGGAAATGG + Intergenic
923306597 1:232694247-232694269 CGGGATGGGGAGTTGAAAAGGGG - Intergenic
923645629 1:235817711-235817733 CAGGATGGAGGGTGGGAGAAGGG + Intronic
923701728 1:236306226-236306248 CAGGATTGGGAGTTGGGAGTTGG - Intergenic
924089000 1:240483770-240483792 CAGGAATGTGAGTTGGGAATGGG + Intergenic
1063360805 10:5456213-5456235 CAGGATGGAGATGTGAGAATGGG + Exonic
1065258788 10:23902976-23902998 CAGGGTGTAGCGTTGGAAATGGG + Intronic
1066045753 10:31594375-31594397 CTGGATCGAGGGTTGGAAAAAGG + Intergenic
1066407610 10:35133912-35133934 TAATATGGAGAGCTGGAAATTGG + Intronic
1067021530 10:42803882-42803904 CAAGATGGAGAGTTACAAAGTGG - Intronic
1067796273 10:49324400-49324422 GTGGAAGGAGAGTTGGAGATGGG + Exonic
1067809253 10:49414582-49414604 CAGAATGAAGAGTTTAAAATCGG + Intergenic
1067910559 10:50342676-50342698 CATGAATGAGGGTTGGAAATTGG - Intronic
1068165970 10:53333239-53333261 CTGGATGGGGAGCTGGAAAGTGG - Intergenic
1068330456 10:55559025-55559047 CTGGATAGAGAGTTGGCACTGGG - Intronic
1070016930 10:72542883-72542905 CAGGAAGGCGAGCTGGAAAAGGG + Intronic
1071151223 10:82636904-82636926 CAGGATTAAGGGTAGGAAATGGG + Intronic
1071815877 10:89232430-89232452 CAGGATGGAGAGTCAGAGAGAGG + Intronic
1072198834 10:93140620-93140642 CAGAATGGAGAGTTGGGGCTGGG - Intergenic
1072283062 10:93887690-93887712 AAGGATAGAGAGGAGGAAATAGG - Intergenic
1072902834 10:99424752-99424774 AAGGAAGGGGAGTTGTAAATTGG - Intronic
1073157205 10:101356705-101356727 GAGAATGGAGAGTTTGAGATTGG + Intronic
1074093447 10:110285679-110285701 CAGGATGGAGAGGTGGCAGCTGG - Exonic
1074412696 10:113242095-113242117 CAGAATAAAGGGTTGGAAATGGG + Intergenic
1075084546 10:119405691-119405713 AAGGATGCAGAGCTGGAAAGTGG - Intronic
1075741448 10:124698762-124698784 CTGGATGGAGGGTGGGGAATGGG - Intronic
1075973309 10:126673252-126673274 CTGGATGGACAATTGGAGATGGG + Intergenic
1076394425 10:130128783-130128805 TGGGATGGGGAGTTGGAGATGGG - Intergenic
1077160013 11:1108408-1108430 CAGGATGGAGAGGTGGGGACAGG - Intergenic
1077448934 11:2622818-2622840 CTGGTGGGAGAGTTGGTAATGGG - Intronic
1077647786 11:3941370-3941392 GAGGAAAGAGAGTTGGCAATGGG + Intronic
1078157761 11:8813513-8813535 CAGGATGGAGACTGGGCAAGTGG - Intronic
1078477833 11:11647842-11647864 AAGGATGGAAAATTGGAAAGTGG + Intergenic
1078489308 11:11754609-11754631 CATCATGGAGCGTTGGAAAGGGG - Intergenic
1078615692 11:12863582-12863604 GCCGCTGGAGAGTTGGAAATGGG + Intronic
1078725065 11:13922961-13922983 CAGCATGGAGCTTTGAAAATGGG - Intergenic
1079292496 11:19200832-19200854 CAGCACGAAGAGTGGGAAATTGG - Intronic
1079402108 11:20114158-20114180 CTGGATGTGGAGTTGGAAAAAGG - Intronic
1081280253 11:41201131-41201153 CAGGAGGTAGATTTTGAAATAGG - Intronic
1081374212 11:42339862-42339884 CAGGATAGGGAGCTGGAAAGGGG - Intergenic
1081668504 11:44930407-44930429 CAGGAAGGAGAGTGGGCAAGTGG - Exonic
1083201198 11:61122028-61122050 AAGGATGGAGACAGGGAAATTGG + Intronic
1084410178 11:69002342-69002364 CAGAATGGAGAGTGGGGCATGGG - Intergenic
1085417636 11:76329924-76329946 CAGGATGGAGAGTTTGGAGTGGG + Intergenic
1085544536 11:77305125-77305147 CAGCAGAGAAAGTTGGAAATTGG - Intergenic
1086498383 11:87426945-87426967 CAAAATGGAGAGTTGGTAATGGG + Intergenic
1086506464 11:87509699-87509721 CTAGATGAAGAGTTGGAAACTGG - Intergenic
1087236994 11:95731252-95731274 CAGGATGGAGAGAGGTAAAGAGG - Intergenic
1087845241 11:102964808-102964830 TGGGATGGAGAGCTGGAAAGCGG - Intergenic
1088755931 11:112885186-112885208 CTGCTTGGAGAGTTGGAAAGAGG - Intergenic
1088777593 11:113100544-113100566 TGGGATGGAGAGCTGGAAAGGGG + Intronic
1088947718 11:114531612-114531634 CAAGAAGTAGAGTTGAAAATAGG - Intronic
1089869918 11:121663318-121663340 CAGAACAGAGAGTTGGAACTGGG + Intergenic
1090188048 11:124751212-124751234 AAGGCAGGGGAGTTGGAAATAGG + Intronic
1090198653 11:124838855-124838877 CAGGATGGGGAGATGGGAAAAGG - Intergenic
1091315584 11:134611719-134611741 TAGGGTGCAGACTTGGAAATGGG + Intergenic
1091387340 12:103531-103553 CAGGAGGGAGAGGTGGAGTTCGG + Intronic
1091387383 12:103644-103666 CAGGAGGGAGAGGTGGAGTTCGG + Intronic
1091387410 12:103719-103741 CAGGAGGGAGAGGTGGAGTTCGG + Intronic
1091756314 12:3054609-3054631 CAGGTAGGAGAGTTGGAAGCTGG + Intergenic
1091812890 12:3414716-3414738 TGGGATGGGGAGTTGGAAAGGGG + Intronic
1091878337 12:3956261-3956283 CTGGGTGGAGAGTTGAAATTAGG - Intergenic
1092937712 12:13379467-13379489 CGTGCTGGAGAGATGGAAATGGG + Intronic
1093100627 12:15024438-15024460 CAGGGTGGAGGGTTGGAGGTGGG - Intergenic
1093369694 12:18352717-18352739 CAGGATGGAGAGCTAGAAAGGGG + Intronic
1093486645 12:19660144-19660166 CAGGATGGAGAGAGGAAATTTGG + Intronic
1093706430 12:22279614-22279636 CAGAATGCAGAGATGAAAATGGG - Intronic
1093751399 12:22804218-22804240 CAGGATAGGGAGTTGGAAAGGGG + Intergenic
1093769101 12:22998984-22999006 CAGGATGGGGAGCTGGAAAGGGG - Intergenic
1093858924 12:24139411-24139433 CAGGATGGAAAAATGGAAAAAGG + Intergenic
1093937759 12:25019406-25019428 CAGGATGGGGAGCTGGAAAGGGG + Intergenic
1094366558 12:29688998-29689020 CAGGATTGAGGGCTGCAAATAGG - Intronic
1094530584 12:31270853-31270875 AGTGATGGAGGGTTGGAAATGGG - Intergenic
1094583104 12:31752417-31752439 CAGGATGGGGAATTGGAAAGGGG + Intergenic
1095791369 12:46170866-46170888 CAGGATTTGGAGTTGGACATAGG - Intergenic
1096749141 12:53747784-53747806 CAGGAAGGGGAGCAGGAAATAGG - Intergenic
1098185316 12:67890309-67890331 CCACATGGAGAGTTGGAAAAGGG + Intergenic
1098188569 12:67924170-67924192 CAGCATGAAGAGGAGGAAATAGG + Intergenic
1098241074 12:68467828-68467850 CAGGCTGGAGAGAAGGCAATGGG + Intergenic
1099425472 12:82518288-82518310 CAGGATGGGGAGCTGGAAAGTGG + Intergenic
1099791364 12:87338873-87338895 CCAGATGGAGAGTTGAAATTTGG - Intergenic
1100392675 12:94157693-94157715 CAGGGTGGTGGGATGGAAATAGG - Intronic
1101224563 12:102675365-102675387 AATGAAGGAGAGTTGGACATAGG + Intergenic
1101591760 12:106131137-106131159 CAGGGTGGAGAGTGGGAAAGGGG - Intronic
1102818314 12:115886921-115886943 CAGGAAGGAGCTATGGAAATAGG + Intergenic
1102910391 12:116709158-116709180 GAAGATGGAGAGATGGAAAGTGG - Intergenic
1103038218 12:117673441-117673463 AAGGATGGACAGATGGAAAGAGG + Intronic
1103503762 12:121426351-121426373 CAGGCTTGATACTTGGAAATTGG + Intronic
1104143131 12:126007149-126007171 CAGGATGGGGAGTTGGAAAGGGG + Intergenic
1104265863 12:127231970-127231992 CAGGAAGGAGAGCTGGAAAGGGG - Intergenic
1104579705 12:130001978-130002000 CAGGATGGCGGGTGGGAAAATGG - Intergenic
1106790538 13:33151393-33151415 CAGGAGGGAGAGATAGAAAAGGG + Intronic
1106942295 13:34792313-34792335 CAGGATGAGGAGCTGGAAAGGGG - Intergenic
1107741890 13:43459578-43459600 AAGGATGTAGAGTAGGAAAAGGG + Intronic
1108159057 13:47618901-47618923 AGGGATGGGGAGTTGGAAAGGGG - Intergenic
1108777660 13:53785636-53785658 CAGGATGGTGTGGAGGAAATAGG + Intergenic
1108798777 13:54067293-54067315 CAGGATGGAGAGCTAGAAAGGGG - Intergenic
1111235819 13:85406185-85406207 CAGGAAGGGGAGCTGGAAAGGGG + Intergenic
1111548048 13:89769830-89769852 CAATATGGAGAGTTGACAATAGG - Intergenic
1111685109 13:91492175-91492197 CAGGAAGTAGAGTTTGGAATTGG - Intronic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112478353 13:99752498-99752520 CAGGCTGGAGAATAGGAAAATGG + Intronic
1115788219 14:36850143-36850165 AAGGATGAAGAGTTGGCCATGGG + Intronic
1115899564 14:38129633-38129655 AGGGATGGAGAGCTGGAAAGGGG - Intergenic
1116903987 14:50387625-50387647 CAAGATGGAGAGGTGGAGACTGG - Intronic
1117029554 14:51653608-51653630 CAGGATGGAGAGTGGGGGAGGGG + Intronic
1118276575 14:64390970-64390992 CAGGATGGAATGTGGGAAGTGGG - Intronic
1118611690 14:67546462-67546484 CAGGATGGGGAGGTTGCAATGGG - Intronic
1119252473 14:73168644-73168666 CAGAATGGGGAGTTGAAAAAGGG - Intronic
1120325220 14:83015384-83015406 GAGGCTGGAGAGATGGAAAAGGG - Intergenic
1120739156 14:88088860-88088882 CAGAAGGGAGAGTTGGGAGTGGG - Intergenic
1120912656 14:89681810-89681832 CAAGAGGGAGAGTGGGAAAAGGG - Intergenic
1122053483 14:99075998-99076020 CAGAAGGGAGAGTGGGAAAAGGG - Intergenic
1124877442 15:33608477-33608499 TAGTATGAAGAGTTTGAAATAGG - Intronic
1125904557 15:43379038-43379060 TAGGAAGGAGAGTGGAAAATAGG + Intronic
1128840242 15:70844384-70844406 CAATATGGAAGGTTGGAAATAGG - Intronic
1129649037 15:77466977-77466999 CAGGATTAAGAGTTGCAATTTGG - Intronic
1130088106 15:80795455-80795477 CAGGATGGTGGATTGGACATAGG + Intronic
1130610926 15:85360292-85360314 GAGGCTGGAGAGTTGGACAGGGG + Intergenic
1132354333 15:101159937-101159959 ATGCATGGAGAGTTGGAACTGGG + Intergenic
1133478307 16:6145178-6145200 TAGGGTGGAGGGTGGGAAATGGG - Intronic
1133808773 16:9145271-9145293 CGGGATGGGGAATTGGAAAGGGG - Intergenic
1133844577 16:9442080-9442102 GAGGATGGAGAGTTGGGACGAGG - Intergenic
1134195218 16:12154550-12154572 GAGGATGAAGAGTTGGAGACGGG - Intronic
1134326819 16:13215084-13215106 GAGGATGGAGAGAAGAAAATGGG + Intronic
1134427188 16:14161301-14161323 CAGAATGGAGAGTGAGAAATAGG + Intronic
1135182265 16:20286082-20286104 GAGGATGGAGAGGTGAAAGTGGG + Intergenic
1135672510 16:24387292-24387314 TGGGATGGGGAGTTGGAAAGGGG + Intergenic
1136176877 16:28523218-28523240 TAGGAAGGAGAGGTGAAAATAGG - Intergenic
1136909328 16:34133574-34133596 CGGGATGGAGAGATAGAAATGGG - Intergenic
1138119389 16:54386943-54386965 CACGAAGGAGGGTTGGAAACAGG - Intergenic
1139226845 16:65240746-65240768 AAGAATAGAGGGTTGGAAATTGG + Intergenic
1139269859 16:65671854-65671876 CATTTTGGAGAGTTGGAAAGAGG - Intergenic
1140324788 16:73991213-73991235 CAAGAAGGGGAGTTGGAAAGGGG + Intergenic
1140461750 16:75145733-75145755 CAGGATGGGGAGCTGGAAAGGGG - Intergenic
1141841751 16:86578135-86578157 CAGGAAGGAGAGGTGGAGATGGG - Intronic
1141908306 16:87041857-87041879 CAGGAAGGAGAAGTGGAATTAGG - Intergenic
1142301755 16:89262714-89262736 CAGGAAGGGGAGCTGGAAAGGGG + Intergenic
1142372436 16:89690618-89690640 AAGGATGGTGAGCAGGAAATTGG + Exonic
1143217394 17:5235069-5235091 CAGGGTGGAGACTTGGCAGTGGG + Intergenic
1143867887 17:9937355-9937377 CAGGCTGGAGAGATGGAAGCCGG + Intronic
1144625674 17:16843344-16843366 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1144880757 17:18429376-18429398 CAGCTTTGAGAGTTTGAAATGGG - Intergenic
1145151478 17:20515011-20515033 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1146162828 17:30569261-30569283 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1146222834 17:31040313-31040335 AAGGAGGGAGAGTAGGAAATTGG - Intergenic
1146342165 17:32029698-32029720 AAGGAGGGAGAGTAGGAAATTGG + Intronic
1146350641 17:32089894-32089916 AAGGAGGGAGAGTAGGAAATTGG - Intergenic
1146508711 17:33427545-33427567 GAGGATGGAGAGTTGGAGGATGG - Intronic
1146785860 17:35720776-35720798 CAGGATGAAGAATAGGAAAGAGG - Intronic
1147233815 17:39041410-39041432 AAGGAGGGAGAGTAGGAAATTGG + Intergenic
1147350266 17:39836758-39836780 AAGGTTGGAGGGTAGGAAATGGG - Intronic
1147579833 17:41622039-41622061 CAGCTTTGAGAGTTTGAAATGGG + Intronic
1148537769 17:48455166-48455188 CAGGATGGGGAGCTGGAAGGGGG - Intergenic
1148962471 17:51405079-51405101 CAGGAAGGAAAGTTGGTCATTGG - Intergenic
1149036699 17:52142157-52142179 CAGAATCCTGAGTTGGAAATTGG + Intronic
1150750818 17:67861090-67861112 CTGGATGAAGAGTAGGTAATGGG - Intronic
1151006151 17:70438287-70438309 GAGGAAGGAGAGTTGGTAAGAGG + Intergenic
1151519396 17:74617481-74617503 CTGGATGGAGACTTGGGACTCGG - Intronic
1151560605 17:74867622-74867644 CGGGAAAGAGAGGTGGAAATGGG + Intronic
1152265809 17:79293923-79293945 CAGGATGGAGAGATGAAACAGGG + Intronic
1152843056 17:82582308-82582330 CAGGGTGGAGAGCTGGCAACAGG - Intronic
1153125100 18:1782061-1782083 CAGGATGGGTTGTTGGAAAAGGG - Intergenic
1153864544 18:9251858-9251880 CAGGAAGGAAAGTGAGAAATAGG - Intronic
1153909411 18:9693749-9693771 CAGAATCCAGAGTTGGAAAGGGG + Intergenic
1153912869 18:9719642-9719664 CAGGATGGTGAGGTTGACATTGG - Intronic
1154939084 18:21092973-21092995 CATGAAGGAGGGGTGGAAATTGG - Intronic
1155121670 18:22826984-22827006 AAGCATGGAGATGTGGAAATAGG - Intronic
1155683706 18:28520918-28520940 TAGGATGGGGAGCTGGAAAGAGG - Intergenic
1155726306 18:29088577-29088599 CAGGTAGGGGAGTTGGAAACAGG - Intergenic
1155787184 18:29915393-29915415 CAGGATGGGGAGCTGGAAACGGG - Intergenic
1156131927 18:33987035-33987057 CAGAATGGAAAGTGGGAATTTGG + Intronic
1156219444 18:35036999-35037021 CAGAATGGAAACTTGGAAGTAGG - Intronic
1156400643 18:36736504-36736526 CAAGAAGGAGAGCTGGAAAGGGG + Intronic
1156901887 18:42309765-42309787 TGGGATGGAGAGTTGTGAATAGG + Intergenic
1157351435 18:46890646-46890668 CAGGATGGACAGGAGGAATTGGG + Exonic
1157875130 18:51265828-51265850 CAGGATGGAGGACAGGAAATAGG + Intergenic
1158968543 18:62644675-62644697 CAGGAAGGGGAGCTGGAAAGAGG - Intergenic
1160127469 18:76189601-76189623 CAGGATGGGGAGATGGAAAGTGG - Intergenic
1161152460 19:2716909-2716931 CAGGATGGGGAGCTGGCAAGAGG - Exonic
1161249866 19:3274812-3274834 CAGGGTGGAGAGTGTGAAAGGGG - Intronic
1161920880 19:7264867-7264889 CATGTTGGATGGTTGGAAATCGG - Intronic
1162736673 19:12750727-12750749 CGGGAGGGAGCGTTGGAAAGGGG + Intergenic
1163176872 19:15570232-15570254 AGGGATGGAGAGTTGGACTTGGG + Intergenic
1163182789 19:15615845-15615867 CAGGGTGGAAGGGTGGAAATGGG + Intronic
1165886890 19:39084736-39084758 CAGGATGGAAAGCTGGGGATGGG + Intronic
1166762843 19:45235476-45235498 CAGGGTGGTGACTTGGAGATGGG + Intronic
1167053477 19:47094585-47094607 GAAGATGGAGAGTTGGAAGAAGG - Exonic
1167233824 19:48301985-48302007 CTGGATGGAGAGATAGATATAGG + Intronic
1167233872 19:48302239-48302261 CTGGATGGAGAGATAGATATAGG + Intronic
1167272259 19:48511990-48512012 CAGGAGGGAGGGGAGGAAATGGG + Intronic
1167444302 19:49528353-49528375 CAGGACAGGGAGTTGGAAGTTGG - Intronic
1168277495 19:55285605-55285627 CAGGATGGAGGGTGGGAAGGTGG + Intronic
1168309770 19:55454583-55454605 GGAGATGGAGAGTTGGAGATGGG + Intronic
1202706663 1_KI270713v1_random:29396-29418 CAGAATGGAGAGGGGGAAATGGG + Intergenic
926473815 2:13296446-13296468 CAGGATGCAGAGTAGGTTATGGG - Intergenic
926881009 2:17543318-17543340 CAGCAGGGAAAGATGGAAATGGG - Intronic
927143982 2:20148895-20148917 AAGGAAGCAGAGTTGTAAATCGG + Intergenic
928206690 2:29289685-29289707 CAGGCTCCAAAGTTGGAAATGGG - Intronic
928494025 2:31813452-31813474 CAGGATGGGGAGCTAGAAAGTGG + Intergenic
928664491 2:33537115-33537137 CAGGATGGGGAGCTGGAAAGGGG + Intronic
928869661 2:35961498-35961520 TAGGATGGGGAGCTGGAAAGGGG + Intergenic
928984020 2:37163421-37163443 CAGGAGGCAGAGTTTGCAATGGG - Intergenic
929196690 2:39192098-39192120 CATAATGGAAATTTGGAAATTGG + Intronic
929726004 2:44428236-44428258 CAGGATGGAGAGTTGGAAATGGG + Intronic
930095090 2:47560830-47560852 CATGATGGAGAGTTTGGAAAGGG + Intronic
931401200 2:61933060-61933082 TGGGATGGGGAGTTGGAAAGGGG + Intronic
932827268 2:74953021-74953043 CAGAATGGGGAGTTGGAAAGGGG + Intergenic
932941791 2:76175293-76175315 CATGATGGAGTGATGGAAATAGG - Intergenic
933208787 2:79540903-79540925 TGGTATGGAGAGTTGGAAATGGG + Intronic
933413352 2:81952285-81952307 CTGGATGGAGAGTTCTTAATGGG - Intergenic
933462903 2:82612153-82612175 CAGGATAGGGAGGTGGAAAGGGG - Intergenic
934731442 2:96661226-96661248 CAGGAGGGGAAGGTGGAAATAGG - Intergenic
934843290 2:97645387-97645409 CAGGAAGGGGAGTTGATAATAGG - Intergenic
934913337 2:98278540-98278562 CAGGATGGAGAGCTAGAAAGGGG + Intronic
934969364 2:98750593-98750615 CGGGATAGGGAGTTGGAAAGAGG - Intergenic
935175904 2:100648528-100648550 CAGGAAGGGGAGCTGGAAAGGGG - Intergenic
936647545 2:114389057-114389079 TGGGATGGGGAGCTGGAAATGGG - Intergenic
936657622 2:114506341-114506363 CAGGAAGGGGAGCTGGAAAGGGG - Intronic
937037163 2:118791746-118791768 TAGGAGGAAGAGTTGGTAATAGG + Intergenic
937201982 2:120209748-120209770 CAGGCTGCAGAGTGGGAGATGGG + Intergenic
937458916 2:122068613-122068635 CAGGTTAGAGAGTTGGAAGATGG - Intergenic
938787770 2:134648137-134648159 CAGGAAGGAGAGCTGAAAAAGGG + Intronic
939582628 2:143968481-143968503 CAATATGGAGGGTTGAAAATAGG - Intronic
939590844 2:144061958-144061980 CAGGATGGAAAGCTGGAGAGGGG - Intronic
939700667 2:145386847-145386869 CAGGATGGGGAGCTGGAAAGAGG - Intergenic
939962229 2:148575521-148575543 GAGGATGGGAAGTTGGAATTAGG - Intergenic
941127844 2:161608224-161608246 GAGGTTGGAGAGTGGGAAAGAGG - Intronic
941717530 2:168779717-168779739 TGGGATGGGGAGTTGGAAAGGGG - Intergenic
941975403 2:171399079-171399101 TAGGATGGTGAGCTGAAAATGGG - Intronic
942490603 2:176485923-176485945 CAGGATGGAGAGAGGAAGATAGG + Intergenic
942921287 2:181376508-181376530 CAGGATGGAGAGTATCAAACTGG + Intergenic
946100432 2:217315818-217315840 CAGGATGGGGAGCTGGAAAGGGG - Intronic
946215952 2:218183786-218183808 CAGGATGGGGAGTTGAAAAGGGG + Intergenic
946609398 2:221441444-221441466 CGGGATGGGGAGCTGGAAAGGGG - Intronic
946851135 2:223908422-223908444 CAGGAGGGAGAGGATGAAATTGG - Intronic
948122322 2:235540053-235540075 CAGGATGGACAGATGGACAGTGG + Intronic
1171904795 20:30892344-30892366 CGGGATGGAGAGATAGATATGGG - Intergenic
1171993430 20:31714228-31714250 CAAGATGGAGGGTTTGAAGTAGG - Intronic
1172396203 20:34607515-34607537 TGGGATGGAGAGCTGGAAAGGGG - Intronic
1173065637 20:39708047-39708069 CAGGATGGAGAGGTGTGACTGGG - Intergenic
1173378628 20:42514861-42514883 CAGGATGAAAAGTCAGAAATAGG - Intronic
1173536878 20:43821916-43821938 GCGGATGGAGAGTTGCTAATGGG - Intergenic
1173729194 20:45316931-45316953 CTGGATGAAGAGGTGGAAGTTGG - Exonic
1174507968 20:51029120-51029142 CAGGAGGTGGACTTGGAAATGGG - Intergenic
1175127850 20:56765607-56765629 CAGCATGGAGAGCTGAAACTCGG + Intergenic
1175670287 20:60896761-60896783 AAGGCTGGAGGGTTGGAAATGGG - Intergenic
1176980494 21:15375901-15375923 ATGGATGGGGAGCTGGAAATGGG - Intergenic
1177067700 21:16461619-16461641 AATGATGGAGACTTGCAAATAGG - Intergenic
1177626393 21:23666032-23666054 CTTGTTGCAGAGTTGGAAATTGG - Intergenic
1178471222 21:32894574-32894596 TAGGATGGAAAATTGGAAAGTGG + Intergenic
1179963152 21:44782981-44783003 CAAAATGGAGAGTTGCAGATTGG + Intronic
1180317104 22:11284985-11285007 CGGGATGGAGAGATACAAATGGG + Intergenic
1180338222 22:11598479-11598501 CGGGATGGAGAGATAGAAATGGG - Intergenic
1180791149 22:18576497-18576519 CAGGATGGAGGGATGGAGCTGGG - Intergenic
1181230589 22:21418817-21418839 CAGGATGGAGGGATGGAGCTGGG + Intronic
1181248061 22:21516052-21516074 CAGGATGGAGGGATGGAGCTGGG - Intergenic
1182432882 22:30310950-30310972 CAGGATGGAGAGGAGGCAGTTGG + Intronic
1182460307 22:30478874-30478896 CAGGATGGGGAGCTGGAACAGGG - Intergenic
1182580820 22:31309727-31309749 GGGAATGGAGAGTTGGAAATTGG - Intergenic
1183307294 22:37089534-37089556 CAGGAGGGAGGGCTGGAAAAGGG - Intronic
1184172219 22:42766500-42766522 CAGGATGCAGAGTTTGCAGTGGG + Intergenic
1184205348 22:42998956-42998978 CAGGATGGGGAGCTGGAGATGGG - Intronic
1185277718 22:49956962-49956984 CAGGAGGGAGGTTTGGGAATGGG + Intergenic
949891578 3:8737408-8737430 AAGGATGAAGAGTAGGAGATAGG + Intronic
950780930 3:15390975-15390997 CGGGATGGGGAGTTGAAAAGGGG + Intronic
951657610 3:25027235-25027257 AAGGATGGAGAGTTTGGAAGGGG + Intergenic
951723811 3:25732696-25732718 GCTCATGGAGAGTTGGAAATAGG - Intronic
953008727 3:39003171-39003193 GAGGATGGAGGGTGGGAAGTGGG - Intergenic
953187113 3:40648343-40648365 TATGATGGAGACTTGGAACTTGG + Intergenic
953242235 3:41159857-41159879 AAGGAGGCAGAGTTGGAAGTGGG + Intergenic
955045783 3:55358277-55358299 CAGGAAGGAGAGGAGGAAAAGGG + Intergenic
955898431 3:63725929-63725951 CAGGATGGAGATATGGGAGTCGG + Intergenic
956471180 3:69568456-69568478 TAGCATGGAGAATTGGAATTTGG + Intergenic
956679225 3:71762350-71762372 GAGGAGGGAGAGATGGAAACTGG - Intergenic
956754811 3:72373970-72373992 CAGGATGTTGAGTTGAAAATGGG - Exonic
957244707 3:77702382-77702404 CGGGGTGGAGAGCTGGAAAGGGG - Intergenic
957824494 3:85423065-85423087 CAGGATGGGGAATTGGAGAGGGG + Intronic
958023954 3:88028439-88028461 CAGGATGGAGAACTGGAAAGGGG - Intergenic
958254726 3:91312400-91312422 CAGGAGGGCCAGTTGGAGATTGG - Intergenic
959155700 3:102664023-102664045 TGGGATGGAGAGCTGGAAAGGGG - Intergenic
959486448 3:106932614-106932636 CAGGTTGCAGAAATGGAAATGGG - Intergenic
959694187 3:109231877-109231899 CAGGATGGGGAGCTGGAAAGTGG - Intergenic
960015718 3:112885477-112885499 CAGGCTGGAGTGTTGGGAACAGG + Intergenic
960042224 3:113162299-113162321 CTTGATGTAGAGTTAGAAATGGG + Intergenic
960358179 3:116678775-116678797 CAGGATGGAGAGCTGGAATGGGG - Intronic
964622947 3:158733694-158733716 CAGGATGGAGAAATGGATGTTGG - Intronic
965348689 3:167585980-167586002 CTGGATGGATAGATGGAAGTCGG + Intronic
966095524 3:176196552-176196574 CAGGATGGGGAGCTGGAAAGGGG + Intergenic
968041989 3:195596372-195596394 CAGGCTTTAGATTTGGAAATCGG + Intergenic
971229899 4:24793063-24793085 CAGGTTGGAGAGGTAGAAAATGG - Intronic
971530480 4:27682062-27682084 AAGGAAGGAGTGTTGGAGATAGG - Intergenic
971603282 4:28623725-28623747 CAGGAATGAGAGATGGAAAAGGG - Intergenic
972971774 4:44585094-44585116 AAGGATGTAGAATGGGAAATTGG + Intergenic
975246988 4:72130957-72130979 CAGGATAGAGAGCTGGAACGGGG + Intronic
975707064 4:77121883-77121905 CAGGATGGGGAATTGGAAAGGGG + Intergenic
976042030 4:80898260-80898282 CAGGATGGGGAGTTGAAAAGGGG + Intronic
977668024 4:99663534-99663556 GAAGATGGAGAGTAGGGAATGGG - Intergenic
978398844 4:108310419-108310441 CAGGATGGGGAGCTGGGAAGGGG - Intergenic
978897609 4:113907937-113907959 CAGGATGGAGGGTGGGAGAAGGG + Intronic
979502927 4:121460849-121460871 GGGGAAGGAGAGGTGGAAATTGG + Intergenic
979727603 4:123982838-123982860 CAGGGTGGGGAGCTGGAAAAGGG + Intergenic
980603551 4:135059048-135059070 CGAGATGGAGAGCTGGAAAGGGG - Intergenic
981373503 4:143987353-143987375 ATGGATGGAGAGCTGGAAAGGGG - Intergenic
981382604 4:144090624-144090646 ATGGATGGAGAGTTGGAAAGGGG - Intergenic
981592248 4:146376606-146376628 CAGGATGGGGAGCTGGAAAGGGG - Intronic
982273491 4:153615861-153615883 CTGGGAGGAGAGTTTGAAATAGG - Intronic
983070093 4:163257397-163257419 CCGAATGGGGAGTTGGAAAGGGG + Intergenic
984047051 4:174814303-174814325 CAGGATGCGGAGCTGGAAAGGGG + Intronic
984129542 4:175856690-175856712 CAGGATGGGGACCTGGAAAGGGG + Intronic
984245316 4:177268488-177268510 CAGAATAGAGAGTTGGAAAGGGG - Intergenic
984445826 4:179834313-179834335 CAGGAGGCAGTGGTGGAAATTGG - Intergenic
984754594 4:183313600-183313622 CAGGATGGAGATTAAAAAATGGG + Intronic
985888837 5:2700271-2700293 CAGGATGGAAAGTTGACAAGCGG - Intergenic
986999741 5:13648157-13648179 TAGGATGGACATTTGGAAAATGG - Intergenic
987179469 5:15352060-15352082 TAGGATGAAGAGTTGGATAAAGG + Intergenic
987251134 5:16102620-16102642 TGGGATGGGGAGCTGGAAATGGG - Intronic
987843217 5:23247283-23247305 CAGGAAGGAGAACTGGAAACAGG - Intergenic
987926596 5:24350205-24350227 CAGGATGGGGAACTGGAAAAGGG + Intergenic
988461748 5:31445126-31445148 TAAGATGGGGAGTTGGAAAGTGG - Intronic
989146122 5:38251768-38251790 GAGGATGAAGAGCTGGAAACTGG - Intergenic
989414144 5:41153818-41153840 CAGGTGAGAGAGTTTGAAATGGG + Exonic
990128406 5:52548326-52548348 CAGGATGGGGAGCTGGAAAGGGG - Intergenic
990508548 5:56468947-56468969 CTGGAGTGAGAGTTGGGAATGGG - Intronic
990623053 5:57581040-57581062 GAGGCAGGAGAGTTAGAAATGGG - Intergenic
991207451 5:64065896-64065918 CAGGATGGGGAGCTGGAAAGGGG - Intergenic
991269366 5:64761283-64761305 CATGATGGAGAGTTGCTAAGAGG + Intronic
991653494 5:68880501-68880523 CAGGGTGGAGATTTGGAAACAGG - Intergenic
992015260 5:72568652-72568674 CAGGAAGCAGAGTTAGAAAAGGG - Intergenic
992272079 5:75075305-75075327 CAGGAAGGAGAGGTGGAACAAGG - Intronic
992380256 5:76229354-76229376 CAGGCTGGACAATTAGAAATGGG + Intronic
993036248 5:82760793-82760815 CAGGAAGGGGAGCTGGAAAGGGG - Intergenic
993132275 5:83913711-83913733 CAGGATGGTGTGTAGGAAATGGG - Intergenic
993184509 5:84600428-84600450 CTGAATGAAGAGCTGGAAATGGG + Intergenic
994407212 5:99359841-99359863 CAGAAAGGAGAGCTGGAAAGGGG + Intergenic
994684443 5:102931994-102932016 CATAAAGGAGAGTTGAAAATAGG - Intronic
995060962 5:107811450-107811472 CCTGATGGCAAGTTGGAAATGGG + Intergenic
995121132 5:108536206-108536228 TGGGATGGAGAGCTGGAAAGAGG - Intergenic
995259382 5:110084038-110084060 CAGGATGGAGAATGGTAAAGAGG - Intergenic
995540915 5:113185242-113185264 GAGGAAGGAGAGTTGTAAATGGG + Intronic
996576730 5:124983971-124983993 TAGGATGGGGAGCTGGAAAGGGG - Intergenic
997161027 5:131609392-131609414 CAGGATGGAGACATGGGAATGGG + Intronic
997318145 5:132955043-132955065 CAGGATGGGGAGCTGGAAAAGGG + Intronic
998535236 5:142924216-142924238 AGGGAAGGAGAGTTGGAAAGAGG - Intronic
998791163 5:145767327-145767349 CGGGATGGGGAGCTGGAAAGGGG - Intronic
998848633 5:146334379-146334401 CACATTGGAGAGTTGGAAAAGGG - Intronic
1000233458 5:159336262-159336284 CAGGAAGGGGAGGTGGAAAGGGG - Intergenic
1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG + Intergenic
1000742512 5:164987234-164987256 CAAGATGGGGAGCTGGAAAGGGG - Intergenic
1000852881 5:166362121-166362143 CAGGGTGGGGAGCTGGAAAGGGG + Intergenic
1001656701 5:173356235-173356257 CAGGAGGTGGAGTTGGAGATGGG + Intergenic
1001690341 5:173628321-173628343 AAAGCTGGAGAGTTGGAATTTGG + Intergenic
1002189316 5:177470509-177470531 CAGGCTGGAGGGTTTGAACTGGG - Intronic
1003194014 6:3899007-3899029 CAGAATGGGGAATTGGAAAGGGG + Intergenic
1003303822 6:4908677-4908699 CAGGATGGAGGGGAGAAAATGGG - Intronic
1004397268 6:15256371-15256393 CTGGATGGTGAATTGGAAAGAGG + Intronic
1004676434 6:17847267-17847289 CAGGATGGGGAGGCAGAAATGGG - Intronic
1005415459 6:25595393-25595415 CAGGATGGTGAGGTGGCAGTGGG + Intronic
1008664787 6:53705488-53705510 CAGGAGGGAGGCTTGGAAAGTGG + Intergenic
1009000631 6:57708677-57708699 CAGGAGGGCCAGTTGGAGATTGG + Intergenic
1009189094 6:60608104-60608126 CAGGAGGGCCAGTTGGAGATTGG + Intergenic
1009349906 6:62661372-62661394 ATGGATGGAGAGCTGGAAGTGGG + Intergenic
1009444334 6:63722746-63722768 CAGGAGGGAGGTGTGGAAATAGG - Intronic
1009822279 6:68818417-68818439 CTGGATGGAGGGTTGGGAAGGGG - Intronic
1011233815 6:85193036-85193058 CAGGAAGGGGAGCTGGAAAGGGG - Intergenic
1011997731 6:93614397-93614419 CAGAATGGAGGATGGGAAATAGG - Intergenic
1011998456 6:93622797-93622819 AAGGATGGAGACTGGGAGATGGG + Intergenic
1012643803 6:101654845-101654867 CAAGATGAAGAGTGGGAATTGGG - Intronic
1013026996 6:106285103-106285125 GAGAATAGAGAGATGGAAATTGG - Intronic
1013159869 6:107532728-107532750 CTGGATGGAGGGATGGTAATGGG - Intronic
1013285487 6:108677616-108677638 CAGGATGGGGACTTGGGGATGGG + Intronic
1013826062 6:114213091-114213113 CGGGATGGAGAGCTAGAAAGGGG + Intronic
1014252208 6:119126844-119126866 CAGGAAGGGGAGCTGGAAAAGGG + Intronic
1014635627 6:123843313-123843335 TAGGATGGGGAGCTGGAAAGGGG + Intronic
1016306231 6:142686807-142686829 AGGGATTGAGAGTTGGTAATAGG + Intergenic
1016456070 6:144232027-144232049 CAGAATGGAAATTTGGAACTTGG + Intergenic
1017782360 6:157725798-157725820 CAGAATGGGGAGTTGGAAAGGGG - Intronic
1020454010 7:8351394-8351416 AAGGATGGAGAGCTAGAAAGTGG - Intergenic
1022481023 7:30743259-30743281 CAGGAGGGAGAATGGGGAATGGG - Intronic
1022835553 7:34110362-34110384 CAGGAGGGAGAGTAGGAAAGTGG + Intronic
1022873959 7:34508746-34508768 AAGGCTGGAGAGTAGGCAATTGG + Intergenic
1023281306 7:38573206-38573228 CATGATGGAGAGTGTGACATGGG - Intronic
1023959263 7:44913032-44913054 CAGGAAGGAAAGCAGGAAATGGG + Intergenic
1025107703 7:56185962-56185984 CAGGCTGGAGAGAGGAAAATTGG + Intergenic
1026310545 7:69180127-69180149 CAGGCTGGAGAGGGGAAAATTGG - Intergenic
1027243162 7:76346630-76346652 CAGGTTGGAGAGGCAGAAATGGG - Intronic
1027452085 7:78343777-78343799 CAGGATGGAAAAATGGAAACAGG - Exonic
1028720688 7:94027509-94027531 AAGGATGGTGATTTGGAGATGGG - Intergenic
1029142957 7:98424630-98424652 CAGGATGGAAGGATGGAAGTTGG + Intergenic
1029582036 7:101443169-101443191 CAGGATGGGGGGTTGGAAAGAGG - Intronic
1030061000 7:105621243-105621265 CAGGAGAGAGAGGGGGAAATTGG - Intronic
1030645930 7:112061525-112061547 AAGGATGGAGTGTTAGAAAGCGG - Intronic
1030952099 7:115803682-115803704 CAGTTTGGAGTGTTAGAAATGGG - Intergenic
1030970899 7:116053517-116053539 CAGTATTGAGAGGTGGAAAACGG + Intronic
1031285753 7:119865797-119865819 CAGAATCCAGAGTTGGAAGTGGG - Intergenic
1031930114 7:127676590-127676612 GAGGATAGAGATTTGGACATAGG + Intronic
1032453497 7:132054297-132054319 CAGGCAGGAGAGGTGGGAATAGG + Intergenic
1032455670 7:132071573-132071595 CAGAAAGGAGAGTTTGTAATAGG - Intergenic
1032625862 7:133590716-133590738 AGGGATGGAGAGCTGGAAAGAGG - Intronic
1034085343 7:148317279-148317301 CAGGAGGCAGAGTTTGCAATGGG + Intronic
1034889010 7:154822775-154822797 CAGGATGAAGAGCAGGAAATAGG - Intronic
1035824396 8:2629079-2629101 CAGGATGGGGAGCTGGAAAGGGG + Intergenic
1036007272 8:4680508-4680530 GAGGAAGGAGAAATGGAAATTGG + Intronic
1038424085 8:27453366-27453388 GGGGATGGAGAGTGGGAGATTGG - Intronic
1038606850 8:29015322-29015344 CAGGATGGAGGGTGGGCAATAGG - Intronic
1039668387 8:39564460-39564482 GAGGATGGAGGGTTGGAGAAGGG - Intergenic
1039727491 8:40234622-40234644 CAGGATGCTGAATTGGAATTAGG + Intergenic
1040013828 8:42684079-42684101 CAGGTTGGAGAATGGGAAACAGG + Intergenic
1040595336 8:48832698-48832720 CTGGGTGTAGAGTTGAAAATAGG - Intergenic
1041340126 8:56836352-56836374 CAGGATGGAGGGTTGGCAGAGGG + Intergenic
1041787504 8:61650741-61650763 GAGGATGGAGAGGAGGAAAGTGG - Intronic
1042621811 8:70715013-70715035 CAGGTAGGAAAGTGGGAAATTGG + Intronic
1043220455 8:77655818-77655840 CAGGTTGGGGAGCTGGAAAGGGG - Intergenic
1043420005 8:80088316-80088338 GAGGCTGGAGAGTAGGAATTTGG + Intronic
1044595611 8:93955661-93955683 CAGGTTGGGGAGCTGGACATGGG - Intergenic
1045348228 8:101314245-101314267 CATGAGGGAGGGATGGAAATGGG + Intergenic
1045886143 8:107100004-107100026 AAGGATGGAGAAATGGAACTTGG + Intergenic
1046969098 8:120201373-120201395 CAGGATGCAGACTTGGGAAAAGG - Intronic
1047729700 8:127716989-127717011 CAGGATGGAGATTTTGAAACTGG - Intergenic
1048533954 8:135275282-135275304 CAGGATGGAGTGATGGAGTTGGG + Intergenic
1048901338 8:139040594-139040616 TACTATGGAGACTTGGAAATTGG + Intergenic
1050496483 9:6247624-6247646 CAGGATAGAGACATGGAAAGTGG + Intronic
1051211211 9:14746594-14746616 CAAGATGGAGAATTGGGATTAGG - Intronic
1051750918 9:20340240-20340262 CAGGATGGAAAGTTTTAACTTGG - Intergenic
1053056212 9:34994406-34994428 CAGCATGGAGAATAGGAAAAGGG - Intronic
1053583890 9:39436194-39436216 CAGGAAGGGGAGCTGGAAAGGGG + Intergenic
1054105471 9:60994938-60994960 CAGGAAGGGGAGCTGGAAAGGGG + Intergenic
1054709012 9:68492311-68492333 CAGTTTTGAGAGTTGGAATTTGG + Intronic
1055375465 9:75645151-75645173 CAGGAAGGGGAGTTGAAAAGAGG + Intergenic
1056892164 9:90504662-90504684 CAAAATACAGAGTTGGAAATAGG + Intergenic
1057466756 9:95321205-95321227 CAGGCTGGTGACTTGAAAATAGG + Intergenic
1057601840 9:96464828-96464850 TAGGAGGGAGATTTGGAAAGGGG + Intronic
1058321433 9:103636364-103636386 TAGGATGGGGAGCTGGAAAAGGG - Intergenic
1058759993 9:108121368-108121390 AAGGATGGAGTGTTGGAGACTGG + Intergenic
1058785156 9:108379622-108379644 CAGGATAAACAGTTAGAAATAGG - Intergenic
1058923987 9:109643730-109643752 CAGAAAACAGAGTTGGAAATTGG - Intronic
1059725771 9:117006778-117006800 CAGGATGGGGAGTGAGAAAGAGG - Intronic
1060378298 9:123139141-123139163 CAAGATGTAGAGGAGGAAATTGG - Intronic
1061272137 9:129549767-129549789 CAGAATGTAGAGGTGGTAATAGG + Intergenic
1203365343 Un_KI270442v1:250697-250719 CGGGATGGAGAGATACAAATGGG + Intergenic
1185683406 X:1907438-1907460 CAGGATGGGGAGCTGAAAAGGGG + Intergenic
1185796715 X:2971847-2971869 CAGAATGGGGAGTTGGAAAGGGG + Intergenic
1187904758 X:24055149-24055171 CAGGAGGGAGACCTGGAACTGGG + Intronic
1188807102 X:34605070-34605092 AAGGATGGGGAGCTGGAAGTGGG - Intergenic
1189635589 X:43004987-43005009 CATGATGCAGAATTAGAAATGGG + Intergenic
1192089724 X:68140924-68140946 CAGGATGGGGAATTGGAAAGGGG - Intronic
1192143661 X:68665914-68665936 AAGGAAGGAGACTTGGAATTTGG + Intronic
1192210652 X:69125736-69125758 CATAATGGAGAGGTGGATATTGG - Intergenic
1194941677 X:100017564-100017586 CAGGTTGGAGGGCTGGGAATGGG - Intergenic
1195721289 X:107871660-107871682 CAGGAAGGGGAGCTGGAAAGGGG + Intronic
1196869027 X:120095829-120095851 GAGGTGGGAGAGTTGGGAATAGG - Intergenic
1197949597 X:131880049-131880071 CATGATTGAGAGTGAGAAATTGG - Intergenic
1201073342 Y:10169509-10169531 CGGGATGGAGAGATAGAAATGGG - Intergenic
1201254416 Y:12092727-12092749 AAGGAAGGAGAGTAGGAAAAAGG + Intergenic
1201531687 Y:14996752-14996774 GAGGCTGGAGAGTAGGTAATGGG - Intergenic
1201683662 Y:16677836-16677858 CAGGGTGTGGAGTGGGAAATCGG + Intergenic