ID: 929726326

View in Genome Browser
Species Human (GRCh38)
Location 2:44431826-44431848
Sequence CTAGTTCCCCATTTCCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929726326 Original CRISPR CTAGTTCCCCATTTCCCAAT GGG (reversed) Intronic
901899291 1:12344750-12344772 CTAGTTCCCCATTTCACTTCTGG + Intronic
904387661 1:30155243-30155265 CTAGCCCCCCATCACCCAATAGG + Intergenic
904489057 1:30847075-30847097 CAATTTCCCCATTTCAAAATGGG + Intergenic
907395507 1:54186967-54186989 CTAGATCATCATTTCCCAAATGG - Intronic
907401750 1:54228816-54228838 CTTCTTCCCCAGTTCCCGATGGG - Exonic
913044249 1:115060159-115060181 CTGTTACCCCATTTCACAATGGG + Intronic
915585671 1:156842539-156842561 CTAGTTCCCCTTGACCCATTTGG + Intronic
918589106 1:186221172-186221194 CTCTTTCCCCATTTCCCTATGGG - Intergenic
919077411 1:192830391-192830413 CTAGCTCCCCACTGCCCAACAGG - Intergenic
919301715 1:195777975-195777997 TTAGTTCACCATATCCAAATGGG + Intergenic
919441992 1:197646943-197646965 CAAATTCACCATTTCCCAAAGGG + Intronic
919801843 1:201359089-201359111 CCAGCTCCCCATTTCCAAACAGG + Exonic
920806312 1:209237178-209237200 CTATTTCCACATTTTCCAAATGG + Intergenic
921027813 1:211303788-211303810 TTAGTTTCCCATTTCCCAACGGG - Intronic
1063699616 10:8371744-8371766 CTAGTTCCTCATTTCCCAGGTGG - Intergenic
1065293596 10:24254802-24254824 ATAGTTCCCCAGTATCCAATGGG - Intronic
1066042366 10:31562935-31562957 CTAGTCCCCCATCCCCCAACAGG + Intergenic
1068412454 10:56674852-56674874 CTAGCCCCCCATTGCCCAACAGG + Intergenic
1069159494 10:65075636-65075658 CTGAGTCCCCATTTACCAATGGG + Intergenic
1071807101 10:89135156-89135178 CCATTTCCCCATTTCCCAACTGG - Intergenic
1072157018 10:92733109-92733131 CTTGTGCCCCATTTGCCAAGGGG + Intergenic
1072366240 10:94713008-94713030 CTATTTGCCCATTTCTTAATTGG + Intronic
1074667949 10:115753323-115753345 CTAGTGCCTCATTCCCCAACAGG + Intronic
1075000973 10:118797388-118797410 CTAGCTCCCCACTCCCCAACAGG - Intergenic
1077445108 11:2587181-2587203 CTGGTTGCCCATTTCCGCATTGG + Intronic
1078509616 11:11975734-11975756 ACAGTTCCCCATTCCCCACTGGG + Intronic
1079415272 11:20229152-20229174 CTTGTTCCCCAATCCCCAACAGG + Intergenic
1081152208 11:39647225-39647247 CTAACACCCAATTTCCCAATTGG + Intergenic
1081225672 11:40519083-40519105 CTAGCTCCCCACTCCCCAACAGG - Intronic
1081458555 11:43249591-43249613 CTATTTCCCCACATCCAAATGGG - Intergenic
1081509818 11:43758870-43758892 CTAGTATCCCATTTCCTATTGGG + Intronic
1081650246 11:44818901-44818923 CTATTTCCCCATTTGCCAAATGG + Intronic
1082616491 11:55367597-55367619 CTAGCTCCCCACTCCCCAACAGG + Intergenic
1083243017 11:61403800-61403822 CAATGTCCCCATCTCCCAATGGG + Exonic
1085672847 11:78485228-78485250 CTTGTCCCCCATCCCCCAATAGG - Intronic
1086287558 11:85266452-85266474 CTAGTCCCCCATCCCCCAACAGG - Intronic
1092662208 12:10750611-10750633 ATAGTTCCCACTTGCCCAATTGG + Intergenic
1094803283 12:34063630-34063652 CTAAGTCCCAATTTCCTAATAGG + Intergenic
1095970671 12:47900002-47900024 ATAGCTCCCCATTGGCCAATGGG + Intronic
1096386771 12:51199544-51199566 GTAGATCCCCTTTTCCAAATGGG + Intronic
1096471330 12:51878452-51878474 CTATTTGCCCATTTCCTATTGGG + Intergenic
1097638076 12:62146052-62146074 CCAGTTCTCCATTTCCCCACTGG + Intronic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1103063142 12:117875213-117875235 AAAGTTCCCCATTTCACATTAGG - Intronic
1103351765 12:120288589-120288611 CTAATTCCCCTTTTCCCATATGG - Intergenic
1103525018 12:121561797-121561819 CTGCTTCCCCATTTCACAAATGG - Intronic
1104723174 12:131057719-131057741 CAAGGACCCCATTTCCAAATAGG + Intronic
1105820724 13:24078634-24078656 CTAGATCTCCATTTCCCAGTAGG + Intronic
1106018205 13:25889174-25889196 CATTTTCCCCATTTCCTAATAGG + Intronic
1106729423 13:32523938-32523960 CTTGTTCCCCATTACACTATGGG + Intronic
1107509059 13:41062936-41062958 CTCATTGCCCATTTCCCAAAAGG - Intronic
1107549480 13:41461672-41461694 CCAGTTCCTCATTTCCTAAATGG - Intronic
1112691871 13:101905545-101905567 CTAGCTCCCCACCTCCCAACAGG - Intronic
1112887197 13:104188777-104188799 TTATTTCCCTTTTTCCCAATGGG - Intergenic
1112891061 13:104231950-104231972 ATAATTGCCCATTTCTCAATGGG + Intergenic
1113058970 13:106300528-106300550 CTAGATCCACAGTTCCCAATAGG - Intergenic
1113131059 13:107037339-107037361 CTGGTTCCCAACTCCCCAATGGG + Intergenic
1114579653 14:23745818-23745840 CTAGCTCCCCACTCCCCAACAGG - Intergenic
1115121989 14:29948224-29948246 CTGGTTGCCCATTTCCTTATTGG - Intronic
1115939754 14:38595598-38595620 CTAGCCCCCCACTCCCCAATAGG + Intergenic
1116304229 14:43230004-43230026 CTAGCCCACCATTTCCCAACAGG + Intergenic
1117063184 14:51983358-51983380 CTATTACCGGATTTCCCAATGGG - Intergenic
1118077727 14:62319288-62319310 CTAGTTCCCAATAGCACAATAGG - Intergenic
1120616851 14:86717197-86717219 CTAGCTCCCCAGCCCCCAATAGG - Intergenic
1120735291 14:88045833-88045855 CTACTTCCTCATTGCCCACTTGG + Intergenic
1121527617 14:94630268-94630290 TTGTTTCCCCATTTCCCAACTGG - Intergenic
1122384949 14:101338221-101338243 ACAGTTCCACGTTTCCCAATGGG + Intergenic
1125379352 15:39070853-39070875 CTATTTCCCCATCTTCTAATTGG + Intergenic
1126698401 15:51345025-51345047 CCAGATCCCCATTTCCTTATTGG - Intronic
1128326764 15:66729096-66729118 CTTGGTCCCCAGTTCCCAAGTGG + Intronic
1130203242 15:81852528-81852550 CTAGTTTCTCTTCTCCCAATCGG - Intergenic
1130569359 15:85026605-85026627 CTATATCCCCATCTCTCAATGGG + Intronic
1132138232 15:99366032-99366054 CAAGTTCCATATTTCCCAGTAGG + Intronic
1133434294 16:5766010-5766032 CTAGTCCCCACTGTCCCAATGGG - Intergenic
1134629514 16:15746732-15746754 CTAGATCCCCGTGTCCCAGTGGG - Intronic
1134792646 16:17003990-17004012 CCAGTTCCCCACACCCCAATAGG + Intergenic
1141153926 16:81583715-81583737 CTAGATACCCCTTTCCCAAGTGG + Intronic
1142651248 17:1353815-1353837 CTGGTTTCCCATTTCCCTCTGGG - Intronic
1143911914 17:10257532-10257554 CTAGCTCCCCATCCCTCAATAGG - Intergenic
1146387058 17:32386455-32386477 CGAGTTCCCCACTCCCCAATTGG - Intergenic
1146829516 17:36056276-36056298 CTGTTTCCCCATCTGCCAATTGG + Intergenic
1147247343 17:39131126-39131148 CTAGCTTCACATTTCCCAAATGG - Intronic
1148054123 17:44783514-44783536 CCAGTTCACCTTTTCCCAACTGG + Intergenic
1148340766 17:46872260-46872282 CTATTTTCCTATTTCCCTATTGG - Intronic
1150191939 17:63251652-63251674 ATAGTTCCCCATTTACTGATTGG + Intronic
1150416410 17:64992370-64992392 CTAGTTCCCTATTTCCAAATTGG + Intergenic
1150892982 17:69176191-69176213 CCAGTTCCCTATTTCCAAGTTGG + Intronic
1153951346 18:10060261-10060283 CCATTTCCTCATTTCCAAATGGG + Intergenic
1158027470 18:52917816-52917838 CTAGTTTAGCATTTCCCTATTGG - Intronic
1163229363 19:15989840-15989862 CAACTTCCCCACTTCCCACTTGG + Intergenic
1163380952 19:16968263-16968285 CTAGTTTCCCAACTCCTAATCGG - Intronic
1168453362 19:56483895-56483917 GAAGTTCCACATTTCCCAACAGG + Intergenic
1168653480 19:58109536-58109558 CAAGTTTTCCATTTCCCAGTTGG - Intronic
928101345 2:28439374-28439396 CAAATTCCCCATCTCCAAATTGG + Intergenic
928501435 2:31900524-31900546 CTAGTCCCCCACTCCCCAACAGG - Intronic
929527466 2:42718807-42718829 CTGGTTCCCAATTTCTAAATGGG - Intronic
929726326 2:44431826-44431848 CTAGTTCCCCATTTCCCAATGGG - Intronic
931261761 2:60625984-60626006 CTGGTTGACCTTTTCCCAATGGG - Intergenic
933412611 2:81945026-81945048 CTAATCCCCCATCCCCCAATAGG + Intergenic
934576923 2:95408230-95408252 CAATTGCCCCAATTCCCAATCGG + Intronic
936737333 2:115462442-115462464 CTAATTTCCCATTTCCTAAAAGG + Intronic
938758859 2:134405594-134405616 CCAGTTCCCCATTTCCAATGTGG - Intronic
940734267 2:157431260-157431282 TGAGTTTCTCATTTCCCAATGGG + Intronic
942613828 2:177769207-177769229 CTAGTCCTCCAGCTCCCAATGGG + Intronic
943397799 2:187363318-187363340 CATGTTCCCCCTTTCCCATTAGG + Intronic
943547569 2:189299907-189299929 CTAGTTCCACTTTGCACAATAGG - Intergenic
944977774 2:205076675-205076697 CTAGATCCACAGTTCACAATAGG - Intronic
945679252 2:212893451-212893473 ATCGTTCCCCATCTCCCACTGGG - Intergenic
1170184392 20:13571911-13571933 CTCTTTCCCTATTTCCCAAATGG + Intronic
1170583349 20:17715514-17715536 CTTGTTCCCCATTGCAGAATCGG + Intronic
1170747406 20:19112831-19112853 ATAGATCCCCATCTCTCAATGGG - Intergenic
1172269465 20:33645904-33645926 CTAGCTTCCCATTTTCAAATGGG + Exonic
1172903422 20:38351124-38351146 CTACTTCCTCATCTCCCAAAGGG + Intronic
1175036172 20:56003772-56003794 ATGATTCCCCATTTCCCAATCGG + Intronic
1176838869 21:13821094-13821116 CTGGTGCCTCATTTCCCAGTTGG - Intergenic
1177804445 21:25860269-25860291 CTTGTTCTCCATTTCTCAGTGGG - Intergenic
1180995777 22:19964516-19964538 CTGGCTCCCCAGTTCCCAACAGG - Intronic
1181323796 22:22029549-22029571 CAAGTTCCCCATTCCCTGATTGG + Intergenic
949580068 3:5378788-5378810 CTAGTTCTCCATCCCCCAACAGG + Intergenic
949612797 3:5720014-5720036 CTAGCCCCCCATCTCCCAACAGG - Intergenic
950188429 3:10959807-10959829 CCAGTCCCCCATTTCTCAAGGGG - Intergenic
950783122 3:15409524-15409546 CTGCTTCCTCATTTCCCAATAGG + Intronic
951152808 3:19312389-19312411 CAAGTTTCCCATTTCCAAGTTGG - Intronic
952143276 3:30502824-30502846 CTAGTTCCTCATGACTCAATAGG + Intergenic
952208948 3:31209852-31209874 CTAGCCCCCCATTCCCCAACAGG + Intergenic
954635137 3:52067112-52067134 CTTTGTCCCCATTTCCCTATGGG - Intergenic
955615260 3:60800668-60800690 CTACTCCCTCATTTCCCCATAGG - Intronic
959425579 3:106183608-106183630 CTAGTGCACCATTTATCAATCGG + Intergenic
964137780 3:153364786-153364808 CTAGCGACCCAATTCCCAATGGG - Intergenic
964857617 3:161164007-161164029 ATAGTTCCCAATTTCTAAATGGG + Intronic
965103125 3:164328479-164328501 CTAGTCCCCCATATCCCGACAGG - Intergenic
966057504 3:175713878-175713900 CTAGCCCCCCACTCCCCAATAGG + Intronic
970487306 4:16537522-16537544 CTAGTTCCCAATGCCCCACTGGG - Intronic
972000424 4:34025103-34025125 CTAGCTCCCCACTGCCCAATAGG + Intergenic
972571242 4:40312312-40312334 CCAGTGCCCCATTTCCTAGTTGG - Intergenic
972586303 4:40439741-40439763 CTATTTCCCCATGACCAAATTGG - Intronic
974339097 4:60590708-60590730 GTACTTCCCCTTTTCCCATTTGG - Intergenic
975803198 4:78084471-78084493 CTAGTTCCCCCTTACCCATAGGG - Intronic
976333731 4:83861977-83861999 CTAGTCCCCCACTCCCCGATAGG + Intergenic
976541093 4:86277307-86277329 CTACTTCCCTATTACCCACTGGG + Intronic
976819257 4:89186522-89186544 CTTGCCCCCCATTCCCCAATGGG + Intergenic
976995404 4:91426036-91426058 CTAGCCCCCCACATCCCAATAGG + Intronic
977413443 4:96697911-96697933 AGAGTTTTCCATTTCCCAATGGG - Intergenic
979323208 4:119348398-119348420 CATATTCCCCATTTCCTAATAGG - Intergenic
980955278 4:139421958-139421980 CTAGTACCCCATCCCCCAACAGG + Intergenic
981179047 4:141716933-141716955 CTATTTCCCCATTTTAGAATGGG + Intronic
981630267 4:146810247-146810269 CTAGTCCCCCAGTCCCCAACAGG - Intronic
982133424 4:152250119-152250141 CTAGTTTCCCATTTTTCACTTGG - Intergenic
983241040 4:165233036-165233058 CATATTCCCCATTTCCTAATAGG - Intronic
983394129 4:167171421-167171443 CATGTAACCCATTTCCCAATGGG + Intronic
984184090 4:176521171-176521193 CCTGTTCCCCAGTTTCCAATAGG - Intergenic
985136575 4:186792008-186792030 CTAGTTCCCCACTCTCCAACTGG + Intergenic
987223225 5:15812331-15812353 CTTGTCCCCCATTTCCCCACAGG - Intronic
988231531 5:28485448-28485470 CTAGTCCCCCATCCCCCAACAGG - Intergenic
988824909 5:34926473-34926495 CTAGTGCCCCCTTACACAATAGG - Intergenic
991548660 5:67812171-67812193 CTAATTCCCCATCTCCAGATGGG + Intergenic
993130556 5:83892964-83892986 CTAGTTTCACATTTCCCTGTGGG + Intergenic
993656459 5:90584073-90584095 CAGGTTCCTCATTTCACAATGGG + Intronic
997807054 5:136928406-136928428 CTAGCCCCCCATCTCCCAACAGG + Intergenic
997843047 5:137259482-137259504 CTAGTTCCCCATCCCCCAACAGG - Intronic
997906738 5:137824623-137824645 CCATTTCCCCATTTACCATTAGG - Intergenic
998563000 5:143188951-143188973 GTAGTTCCCCGTTTCCAAAATGG + Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999501813 5:152154455-152154477 CTTGTTCCCCATTCCCCGACAGG + Intergenic
999518498 5:152324915-152324937 ATAGTACCCAATTACCCAATAGG + Intergenic
999547078 5:152641594-152641616 ATAATGCCCCATTTACCAATGGG + Intergenic
1005443989 6:25902266-25902288 CTAGTTCCTCATTTCTCTCTTGG + Intergenic
1005467637 6:26130892-26130914 CTATTTCTCCATTTTCTAATGGG - Intronic
1005911651 6:30315432-30315454 CGAGTTTCTCATTTCCTAATTGG - Intergenic
1005939134 6:30547596-30547618 TTAGTTCCCCTTTTACCTATAGG - Intronic
1006282522 6:33066342-33066364 ATAGTTCACCTTTTCCCCATAGG - Intronic
1008190901 6:48455512-48455534 CTTGTTGCCCATTTCCTAAGTGG - Intergenic
1010046046 6:71445221-71445243 CTAGATCTCTATTTCTCAATAGG - Intergenic
1010294262 6:74177692-74177714 CTGTTTCCCCATCTCCAAATGGG + Intergenic
1011234425 6:85200570-85200592 CTAGCTCCCCACCCCCCAATAGG + Intergenic
1014134544 6:117873367-117873389 CTAGCTCCCCACCTCCCAACAGG + Intergenic
1014409609 6:121098039-121098061 CTAGGCCCCCACTCCCCAATAGG - Intronic
1015421300 6:133012491-133012513 CAATTTCCCCATTCCTCAATAGG - Intergenic
1016116161 6:140289069-140289091 CTATTTCCCCCTATCACAATAGG - Intergenic
1016120743 6:140339065-140339087 CTAGCTCCCCATCCCCCAACAGG + Intergenic
1018267347 6:162039517-162039539 CTTGTTTCCCCTTTCCCCATGGG + Intronic
1027556950 7:79676684-79676706 CTAGTCCCCCATCCCCCAACAGG + Intergenic
1027859978 7:83565386-83565408 CTTGTTCCCCATCCCTCAATAGG - Intronic
1028309551 7:89314000-89314022 CTATTTCCCTATTTCCCTCTAGG + Intronic
1029863672 7:103602674-103602696 CTAGTCCCCCATCCCCCAACAGG - Intronic
1031152491 7:118070434-118070456 CTAGTCCCCCATCCCCCAACAGG - Intergenic
1032879984 7:136078424-136078446 CCAGTTCCCCAGTTCCCAAGGGG + Intergenic
1032887194 7:136153376-136153398 GTACTTCTCCATTTCCCAGTAGG + Intergenic
1034499066 7:151438532-151438554 CTAGGTGCCCATTTCAAAATGGG + Intronic
1036970223 8:13347162-13347184 TTAGTCCCCCATTTTCCAAAGGG - Intronic
1039679510 8:39714282-39714304 CCAGTCCCCCATCTCCCAACAGG - Intronic
1047146295 8:122203046-122203068 CTAGCCCCCCATCTCCCAACAGG - Intergenic
1048891535 8:138952993-138953015 CTATTTCCCCATTTTGCAAAGGG - Intergenic
1049069245 8:140344356-140344378 CTTGTGCCCCTTTTCCAAATGGG + Intronic
1049919664 9:351484-351506 CTAGTACCTGATTTGCCAATGGG - Intronic
1051130216 9:13851980-13852002 CAAATGCCCCATTTTCCAATAGG + Intergenic
1051464580 9:17362886-17362908 CTAGTCCCCCATACCCCAACAGG + Intronic
1051816462 9:21112569-21112591 TTAGTTCCCCATCCCCCAAGAGG - Intergenic
1053207648 9:36200471-36200493 CTAGTTCAACAGTTCCCAAGAGG - Intronic
1055184631 9:73436112-73436134 TTAGTTTCCCATTTACCCATTGG + Intergenic
1056190593 9:84180675-84180697 CTAGTTCCACATCTCTCAAATGG - Intergenic
1056330692 9:85518891-85518913 CGAGTTCCACCTTTCCCAAAAGG + Intergenic
1058266204 9:102901788-102901810 CTAGCCCCCCATTCCCCAACAGG - Intergenic
1058591620 9:106571435-106571457 CTTGTTCCCCATCCCCCAACAGG - Intergenic
1059971073 9:119668790-119668812 CTAGCTCCCCACTCCCCAACAGG + Intergenic
1061530032 9:131203778-131203800 CTAGGTCCCCATTTTCCTTTTGG - Intronic
1187277264 X:17827131-17827153 CAAGTTCTCCATATCCCAGTGGG - Intronic
1188722069 X:33534466-33534488 CTAGTTTCCCTTTTCTCAAGAGG - Intergenic
1189244042 X:39549562-39549584 CTAGCTCCCCACTTCCCGACAGG - Intergenic
1191156490 X:57279445-57279467 CTAGTCCCCCAGTCCCCAACAGG - Intergenic
1192238364 X:69310616-69310638 CCAGTTCCCCATTTCACAGATGG - Intergenic
1192365179 X:70466311-70466333 CCCTTTCCCCATTTCCCTATTGG + Intronic
1192381608 X:70622403-70622425 CCCTTACCCCATTTCCCAATTGG + Intronic
1194797827 X:98235011-98235033 CTAGTCCCCCATCCCCCAACAGG + Intergenic
1194911224 X:99647161-99647183 CAAGCTCCCCATTCCCCAACAGG + Intergenic
1196041444 X:111209025-111209047 TTTGTTCCCCATTTCCAAACAGG + Intronic
1196091186 X:111744981-111745003 TTGGTTCCCCATTCCCCAATAGG - Intronic
1196221888 X:113120974-113120996 CTAGCTCCCCACTCCCCAACAGG - Intergenic
1196596242 X:117548886-117548908 CAAGTTCACCAGTTCCCCATGGG - Intergenic
1198730940 X:139727934-139727956 CTCCTTCCCCCTTTCCAAATTGG + Exonic
1198995614 X:142570613-142570635 CTAGTTCCACATTCTACAATTGG + Intergenic
1199713168 X:150486643-150486665 CTATTTACCCCTTTCCCAAAGGG + Intronic
1201889886 Y:18930854-18930876 CTAGCTCCCCACCTCCCAACAGG - Intergenic