ID: 929734412

View in Genome Browser
Species Human (GRCh38)
Location 2:44531426-44531448
Sequence TTAAGGTTCTTTAAATATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929734408_929734412 13 Left 929734408 2:44531390-44531412 CCCATTTTAAGGACTTCTTTGTA 0: 1
1: 1
2: 4
3: 31
4: 379
Right 929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG 0: 1
1: 0
2: 2
3: 36
4: 491
929734409_929734412 12 Left 929734409 2:44531391-44531413 CCATTTTAAGGACTTCTTTGTAA 0: 1
1: 1
2: 3
3: 81
4: 2328
Right 929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG 0: 1
1: 0
2: 2
3: 36
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929734412 Original CRISPR TTAAGGTTCTTTAAATATCC TGG Intronic
901363303 1:8722812-8722834 TTCAAGTTCTTTAAATAACATGG - Intronic
904428820 1:30448769-30448791 TCAAAGTCCTTTAAAGATCCAGG - Intergenic
904537941 1:31213209-31213231 CAAAAGTTCTTTATATATCCTGG - Intronic
904698157 1:32342124-32342146 TTCAGTTTCTTTACAGATCCTGG + Intergenic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
905001839 1:34678521-34678543 TGAAAGTTCTTTATATATTCTGG + Intergenic
905331418 1:37202534-37202556 TTTAGGTTATTTTAATATCTTGG - Intergenic
905949089 1:41930991-41931013 TGAAAGTTCTTTATATATTCTGG + Intronic
906489666 1:46258550-46258572 GTAAGGTTCTACAAATATCCAGG - Intronic
908462720 1:64361361-64361383 TAAAAGTTATTTAGATATCCTGG - Intergenic
908546496 1:65167218-65167240 TTCAGGATCTTTTAATATGCTGG + Intronic
909104448 1:71391485-71391507 TTAAGGTTCTACAAATCTCTAGG - Intergenic
910327066 1:86021922-86021944 TTAAGGTGCTTTACATTTTCTGG + Intronic
911140094 1:94491312-94491334 TAAAGTTACTTTAAATATTCAGG - Intronic
911279754 1:95909445-95909467 TTTGAGTTCTTTAAATATTCTGG + Intergenic
911305765 1:96230258-96230280 TTAAGGTTCATAATATTTCCAGG + Intergenic
911614102 1:99989643-99989665 TTAAAGTTCTGTATATATTCTGG + Intronic
911727678 1:101259054-101259076 TTATGGTTCTCTGACTATCCAGG + Intergenic
911765817 1:101673288-101673310 TTCAGGTTGTTTACATATCTTGG + Intergenic
913433158 1:118817833-118817855 ATATGGTTTTTTAAATATCTAGG + Intergenic
913525304 1:119686128-119686150 TAAGAGTTCTTTAAATATTCTGG + Intronic
914046045 1:144093227-144093249 TAAATGTTCTTTTAATATTCTGG - Intergenic
914132065 1:144867460-144867482 TAAATGTTCTTTTAATATTCTGG + Intergenic
916237750 1:162607467-162607489 TTAAGGTTTTAAAAATATCATGG - Intergenic
917443986 1:175091331-175091353 TTAAACTTCTTTAAACCTCCAGG + Intronic
918380502 1:183949852-183949874 TGAGAGTTCTTTATATATCCTGG - Intronic
918419409 1:184348785-184348807 GTAAGGTTCTTAAAATATATGGG - Intergenic
918833111 1:189424157-189424179 TTTATGTTTTTTAAATATCTTGG - Intergenic
919507247 1:198414732-198414754 TTAAGGTTCTTCAAATTTCAAGG + Intergenic
922623051 1:227006036-227006058 TTAATATTCTTTATAAATCCTGG + Intronic
924734059 1:246738523-246738545 TAAAAGTTCTTTAAATACTCTGG - Intronic
1063310178 10:4945034-4945056 TGAAGGTCTTTGAAATATCCTGG - Intronic
1063644380 10:7864674-7864696 TGAAAGTTCTTTACCTATCCTGG + Intronic
1065207476 10:23370758-23370780 TAAATGTTTTTTATATATCCTGG - Intergenic
1065263040 10:23945650-23945672 TTAAAGTTCTTTTATTATGCAGG + Intronic
1065275119 10:24078059-24078081 TTAAAGTTCCTTAAAGATGCTGG + Intronic
1065292304 10:24242951-24242973 TTTAAGTTCTTTACATATTCTGG + Intronic
1065905912 10:30251459-30251481 TTGAGGTTTTGTAAATATTCAGG - Intergenic
1067967973 10:50935496-50935518 TTTAAGTTCCTTAAAGATCCTGG + Intergenic
1068883759 10:62077262-62077284 AAAAGTTTCTTGAAATATCCAGG - Intronic
1069161413 10:65097801-65097823 TTAAGGTTTTTAAAATATGTTGG - Intergenic
1069200217 10:65605494-65605516 TTAAGGTGATGCAAATATCCTGG - Intergenic
1069320252 10:67160760-67160782 TTTAGGTTGTTTAAACATCTTGG - Intronic
1069719927 10:70543255-70543277 TTTTGGTTCTTTATATATTCTGG + Intronic
1070534817 10:77368412-77368434 TGAGAGTTCTTTATATATCCTGG + Intronic
1071057988 10:81532963-81532985 TTAATGTTCACAAAATATCCTGG + Intergenic
1071216540 10:83409319-83409341 TTAATTTTCTTTAAATATTTGGG - Intergenic
1072193994 10:93099328-93099350 TGAAAGTTCTTTATATATTCTGG + Intergenic
1072585841 10:96781389-96781411 TAAAAGTTCTTTATATATGCTGG - Intergenic
1073389351 10:103160520-103160542 TAAAAGTTCTTTATATATTCTGG - Intronic
1073627632 10:105116044-105116066 TGGAGGTTCTTTAAATAGCTTGG + Intronic
1074105556 10:110387306-110387328 TTAGAGTTCTTTAGATATCCTGG + Intergenic
1075229630 10:120664400-120664422 TTAAATGTCTTTTAATATCCAGG - Intergenic
1077449078 11:2624290-2624312 TTAAGGTTCTTTATATATTTTGG + Intronic
1077940559 11:6836835-6836857 TTTAGGTTGTTTTAATATCTTGG + Intergenic
1078653085 11:13213953-13213975 GTAAGGTTTTTTAAATTTCACGG - Intergenic
1079421826 11:20299186-20299208 TAAGAGTTCTTTATATATCCTGG + Intergenic
1079779320 11:24580033-24580055 TAAAGACTATTTAAATATCCAGG + Intronic
1080240194 11:30118868-30118890 TTAAAGTTCTTTATATATTCTGG - Intergenic
1080506618 11:32920633-32920655 TAAGAGTTCTTTAAATATGCTGG - Intronic
1081500283 11:43659725-43659747 TAAGAGTTCTTTATATATCCTGG - Intronic
1081674517 11:44960775-44960797 TTTTGTTTTTTTAAATATCCAGG + Intergenic
1085275728 11:75298317-75298339 TAATAGTTCTTTATATATCCTGG - Intronic
1085557026 11:77433457-77433479 TAAGAGTTCTTTATATATCCTGG - Intronic
1086114965 11:83239288-83239310 TAAAGGTTCTTTGTATATTCTGG + Intronic
1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG + Intronic
1087928497 11:103948500-103948522 TTAATGTTTTTTAAACTTCCTGG - Intronic
1088264277 11:107974782-107974804 TTAAGGTGCTTTCGATATCAGGG - Intergenic
1088412347 11:109548715-109548737 TTTAGGTTGTTTATAGATCCTGG - Intergenic
1088791419 11:113230580-113230602 TTCAGGTTCTTTGGATATGCTGG - Intronic
1089769303 11:120791479-120791501 TGAAAGTTCTTTACATATTCTGG + Intronic
1090718126 11:129448393-129448415 TAAGTGTTCTTTAAATATTCTGG - Intronic
1091881588 12:3983283-3983305 TTGAGGTTCTTTAAAGTTCTTGG - Intergenic
1092608144 12:10142696-10142718 TTAAGGCCCTATAAATATTCTGG - Intergenic
1093279360 12:17173986-17174008 TTGGGGTTCATTAAATTTCCTGG + Intergenic
1093441384 12:19201119-19201141 TAAAAGTTCTTTAAAAATTCTGG - Intronic
1094137503 12:27144138-27144160 TTAAGATTCATGAAATAGCCAGG - Intergenic
1094780161 12:33782018-33782040 GTAAGGTCATTGAAATATCCAGG + Intergenic
1095361232 12:41342470-41342492 TTTAAGTTCTTTATATATTCTGG - Intronic
1095523808 12:43100900-43100922 TTAAGGTTCTGTAAGTGTTCAGG - Intergenic
1096348737 12:50876023-50876045 TTTAAGTTCTTTATAGATCCTGG - Intronic
1096831060 12:54314889-54314911 TAAAAGTTCTTTATATATTCTGG - Intronic
1096884808 12:54706563-54706585 TTAAGATTCCTTAAAAATACTGG + Intergenic
1097087528 12:56479444-56479466 TTAGGATTTTTTAAATATCAAGG - Exonic
1097303984 12:58048868-58048890 TTTAAGTTCCTTATATATCCTGG - Intergenic
1097752618 12:63373889-63373911 TAAATGTTCTTTATATATTCTGG - Intergenic
1098458959 12:70710674-70710696 TTAAGGTTCCTTATAGATGCTGG - Intronic
1098501038 12:71192101-71192123 TTCTGTTTCTTTAAATATCTTGG + Intronic
1099964416 12:89430298-89430320 AAAAGGTTCTTTAAATACCATGG + Intronic
1100327824 12:93556305-93556327 TCAAAGTTCTTTATATATTCTGG + Intergenic
1100517479 12:95342351-95342373 TTAAGGTCCTTTAATGATGCTGG + Intergenic
1102069570 12:110006521-110006543 TAAAGGTTCTTTGCATATTCTGG + Intronic
1102486532 12:113261722-113261744 TTAAAGCTATTTAAATAGCCAGG - Intronic
1104246350 12:127045849-127045871 TTATGATTTTTTAAATACCCAGG + Intergenic
1104534346 12:129604436-129604458 TAAAGGTGCTATAAACATCCCGG + Intronic
1105675319 13:22665023-22665045 TTAAGTTTCTTTAACTATACGGG - Intergenic
1105832823 13:24179881-24179903 TAAGGGTTTTTTATATATCCTGG + Intronic
1106017296 13:25881869-25881891 TTTAGGTTCTTTGAATTACCTGG - Intronic
1106119449 13:26847408-26847430 TTTCGGCTCTTTAAATCTCCTGG + Intergenic
1106379341 13:29221573-29221595 TTAGACTTCTTTATATATCCTGG + Intronic
1106387020 13:29296817-29296839 TTTAAGTTCTTTTTATATCCTGG + Intronic
1107191371 13:37591157-37591179 TTTAGGGTCTTTTAAAATCCTGG - Intronic
1107241772 13:38243945-38243967 TGAAAGTTCTTTATATATTCTGG - Intergenic
1107354243 13:39549030-39549052 TGAGAGTTCCTTAAATATCCTGG - Intronic
1108293145 13:48982584-48982606 TTCATGTTTTTTAAATATCCTGG - Intronic
1108317008 13:49246749-49246771 ATATGGTTCTTTATATATTCTGG + Intergenic
1108324603 13:49317882-49317904 TAAGAGTTCTTTATATATCCTGG - Intronic
1108538878 13:51417091-51417113 TTACAGTTCTTTATATATTCTGG + Intronic
1108807145 13:54172393-54172415 TTGTGGTTCTTTACATATTCTGG - Intergenic
1109012117 13:56963756-56963778 TTAAGTTTCGTTAAAACTCCGGG - Intergenic
1109471669 13:62814778-62814800 TTAAGGTTGATTCCATATCCTGG + Intergenic
1109650528 13:65319325-65319347 TGAATGTTCTTTAAATATCCTGG - Intergenic
1110433709 13:75456431-75456453 TAGAAGTTCTTTAAATATTCTGG - Intronic
1110846417 13:80195099-80195121 TCTAGGTTACTTAAATATCCGGG - Intergenic
1110926253 13:81156203-81156225 TTAAGGCTTTTTAAAAATCAGGG + Intergenic
1111582833 13:90247602-90247624 TTAATATTCTTTAAATTTCCTGG + Intergenic
1111660888 13:91209502-91209524 TTAAGGTTCTTGTAATTTTCAGG + Intergenic
1111898861 13:94176064-94176086 CAGAGGTTCTTTATATATCCTGG + Intronic
1111955765 13:94756727-94756749 TTTAGGTTCCTTACATATTCTGG + Intergenic
1111972497 13:94931427-94931449 TTAAAGTTCTTTATAGATTCTGG + Intergenic
1113174279 13:107544683-107544705 TTAAGTTTCTTTTCAGATCCAGG + Intronic
1113261440 13:108568555-108568577 TGAAAGTTCTTTATATGTCCTGG + Intergenic
1114390329 14:22301307-22301329 TTTAGGTTCCTTACATATTCTGG - Intergenic
1114661559 14:24348845-24348867 TGAAAGTTCTTTATATATTCTGG + Intergenic
1114897701 14:27011952-27011974 TTAAGTTGCTTTAACTATTCTGG + Intergenic
1115360618 14:32496777-32496799 TTAATGTTCATTAAATAACTAGG - Intronic
1116284196 14:42950848-42950870 TTTAAGTTCTTTACATATTCTGG + Intergenic
1116307716 14:43279933-43279955 TGGGGGTTCTTTATATATCCTGG + Intergenic
1116487390 14:45467056-45467078 TTAAAGTTTTTTAAACTTCCTGG - Intergenic
1116689763 14:48090466-48090488 TTAATGTTTCTTAAGTATCCTGG + Intergenic
1117285277 14:54280895-54280917 TTTAAGTTCTTTATATATGCTGG + Intergenic
1117499542 14:56338341-56338363 TTAAGCTCCTTTACTTATCCTGG + Intergenic
1117592901 14:57293218-57293240 TTAAAGGTCTTAAAATATACTGG - Exonic
1118927018 14:70200245-70200267 TGAAGGTTCTTCACATATTCTGG + Intergenic
1118946865 14:70396857-70396879 TAAAAGTTCTTTATATATGCTGG + Intronic
1119273768 14:73333601-73333623 TAAAGGTTCTTTATATATTCTGG + Intronic
1120282704 14:82459302-82459324 TTAAACTTCTTAAAATATCCCGG - Intergenic
1121581136 14:95032030-95032052 TAAGAGTTCTTTAAATATTCAGG + Intergenic
1121893889 14:97626506-97626528 TGAAGCTTCTTTAACTTTCCAGG + Intergenic
1123703800 15:22936298-22936320 TTACAGTTCTTTATATATTCTGG - Intronic
1123710662 15:22984996-22985018 TTTGGGTTCTTTACATATTCTGG - Intronic
1125114251 15:36069972-36069994 TTAGAATTCTTTAAATATTCTGG - Intergenic
1125122195 15:36174807-36174829 TTATGGTTATTTTAATATCAGGG - Intergenic
1125141897 15:36418166-36418188 TAAAAGTTGTTTAAATATCAAGG - Intergenic
1125381123 15:39088043-39088065 TCAAAGTACTTTAAATATCTTGG + Intergenic
1125787578 15:42334684-42334706 TAAAAGTTCTTTATATATTCTGG - Intronic
1127280627 15:57488269-57488291 TAATGGTTCTTTATATATTCTGG + Intronic
1128596341 15:68954454-68954476 TTAAGGTTCATTTATGATCCAGG + Intronic
1129013191 15:72441557-72441579 TTTAGGTTCCTTATATATGCTGG + Intergenic
1129553813 15:76483620-76483642 TAAGAGTTCTTTGAATATCCTGG - Intronic
1129575825 15:76744407-76744429 TTTAAGTTCCTTATATATCCTGG - Intronic
1129581401 15:76815340-76815362 TTAAGGTTGTTTCCATATCTTGG - Intronic
1130045210 15:80438618-80438640 TTATGGTTCTGTACATATCTTGG + Intronic
1130172508 15:81530433-81530455 TTCAGGTTCTTTAAACATTCAGG - Intergenic
1130382403 15:83381830-83381852 TTAAGGTTTTTAAAATATGTTGG + Intergenic
1130449075 15:84032787-84032809 CTAAGCTTCAGTAAATATCCTGG + Intronic
1130618986 15:85441365-85441387 TAAGAGTTCTTTATATATCCTGG + Intronic
1131761935 15:95633673-95633695 TTCTGGGCCTTTAAATATCCTGG - Intergenic
1134053485 16:11154452-11154474 TAAAGGAACTTTAAATATCTAGG - Intronic
1135247781 16:20871932-20871954 TTAAGGTTCAGTACAAATCCAGG - Intronic
1135378383 16:21970953-21970975 TAAAGGTTCTTTATATATTTTGG + Intronic
1135792577 16:25410841-25410863 TAAAGGTCCTGTAATTATCCGGG + Intergenic
1135813096 16:25607711-25607733 TTTAGGTTCTTTATAGATTCTGG + Intergenic
1135874315 16:26183706-26183728 TAAAAGTTCTTTATATATTCTGG + Intergenic
1136590010 16:31212805-31212827 TTTAGTTTCTTTATATATTCTGG + Intergenic
1138557206 16:57778552-57778574 TTATAGTTCTTTATATATCCAGG - Intronic
1139235870 16:65338361-65338383 TTAAGCTGCTTTAAAAATACAGG + Intergenic
1139361662 16:66403327-66403349 TCCAGGTTCCTGAAATATCCAGG + Exonic
1139766610 16:69235804-69235826 CTAAGTTTCTTCAAATATCCTGG + Intronic
1139791319 16:69438828-69438850 TTACAGTTCTTTATATATTCTGG + Intronic
1143401028 17:6642325-6642347 GTAAGTATCTTTAAATATGCTGG + Intronic
1144185376 17:12790741-12790763 TTAAGGTTACATAAAAATCCTGG + Intronic
1146555570 17:33820711-33820733 TTAAGATTTTTTAAAGATACAGG + Intronic
1146600217 17:34207872-34207894 TAAGAGTTCTTTAAATATCCTGG + Intergenic
1146781414 17:35676879-35676901 TTAAAGTTCTTTGTATATTCTGG + Intronic
1146832678 17:36083289-36083311 TTAAGTTGCTATAAATATGCTGG - Intergenic
1146847160 17:36189593-36189615 TTAAGTTGCTATAAATATGCTGG - Intronic
1146970723 17:37069730-37069752 TAAGGATTCTTTATATATCCTGG + Intergenic
1147128384 17:38389548-38389570 ATAAAGTTCTTTATATATTCTGG + Intronic
1147171677 17:38623733-38623755 TTAGAGTTCTTTATATATCCTGG - Intergenic
1149160219 17:53684779-53684801 TTTATGTTCTTTATAGATCCTGG - Intergenic
1149259925 17:54868541-54868563 TGAGGGTTCTTTATATATTCTGG - Intergenic
1150202763 17:63374331-63374353 TTAAGGTTTTCAAAATACCCAGG - Intronic
1151888166 17:76935694-76935716 TTAGAGTTCTTTATATATCCTGG + Intronic
1155291089 18:24343104-24343126 TAAATGTTCTTTATATATTCTGG - Intronic
1155379848 18:25208044-25208066 TTAATTTTCTTTAGAAATCCAGG + Intronic
1155717060 18:28956786-28956808 TCAAGATTCCTTAAATATTCTGG - Intergenic
1155726687 18:29094755-29094777 TAAATGTTCTTTATATATTCTGG - Intergenic
1156672982 18:39492823-39492845 TTTAAGTTCCTTAAATATTCTGG - Intergenic
1157339595 18:46767615-46767637 TTAAGAATCTGAAAATATCCAGG - Intergenic
1157463595 18:47924812-47924834 TTAAGGTCTTGTAAATATCAAGG - Intronic
1158939249 18:62391947-62391969 TGAAAGTTCTTTATATATTCTGG + Intergenic
1161762109 19:6181434-6181456 TAAGGGTTCTTTATATATTCTGG + Intronic
1162695860 19:12474436-12474458 TTTAGGTTGTTTACATATCTTGG + Intronic
1164096726 19:22017011-22017033 TTTATGTTCTTTGTATATCCTGG - Intergenic
1164097374 19:22023576-22023598 ATAAGGTTCTTCAAAGATTCAGG + Intergenic
1164112615 19:22183634-22183656 TTAAAATTTTTTAAATAACCTGG - Intronic
1164117560 19:22237025-22237047 ACAAGGTTCTTTAAAGATTCAGG + Intergenic
1164197481 19:22983130-22983152 TTTAAGTTCTTTATAGATCCTGG - Intronic
1165578533 19:36842243-36842265 TGAAGGTTCTCTATATATTCTGG - Intronic
1202685601 1_KI270712v1_random:46640-46662 TAAATGTTCTTTTAATATTCTGG - Intergenic
925084645 2:1098704-1098726 TTAAGGTATTTTAAAAATCGAGG + Intronic
925272760 2:2625394-2625416 TAAAAGTTATTTAAATATTCTGG + Intergenic
925453553 2:3992680-3992702 TAAAAGTTCTTTATATATTCTGG + Intergenic
926791725 2:16578908-16578930 TTATGGTTCTCTAAGTTTCCTGG - Intronic
926966407 2:18418479-18418501 TTTAGCTTCCTTATATATCCTGG + Intergenic
928388210 2:30887591-30887613 TAAAAGTTCTTTATATATTCTGG + Intergenic
928608434 2:32966203-32966225 TTAAGGTTCTTTGCATATTTTGG + Intronic
928961051 2:36926225-36926247 TCAATGTTCTTTTAATATTCTGG - Intronic
929295410 2:40240938-40240960 TTTAAGTTCTTTAAAAATCACGG - Intronic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG + Intronic
930050627 2:47213208-47213230 TAAGAGTTCTTTATATATCCTGG - Intergenic
930202686 2:48560166-48560188 TTATAGTTCTTTAAACTTCCAGG + Intronic
930212548 2:48656566-48656588 TTGTAGTTCTTTATATATCCTGG + Intronic
930694431 2:54396893-54396915 TTGAGTTTCTTTAAATAAACTGG - Intergenic
930778075 2:55195419-55195441 TTAATATTGTTAAAATATCCAGG + Intronic
935451082 2:103210234-103210256 AAAAGTTTCATTAAATATCCTGG - Intergenic
935936236 2:108186470-108186492 TTAGGGATCTTGAAATATCAAGG - Intergenic
936506659 2:113113151-113113173 TTTAGGTTCTTTCCATATCTTGG - Intronic
937550276 2:123080121-123080143 TTTAAGTTCTTTATAGATCCTGG + Intergenic
939235197 2:139482742-139482764 TAAAAGTTCTTTGAATATCCTGG + Intergenic
939240863 2:139558547-139558569 TTTAGGTTCTTTAGATGTCTGGG + Intergenic
939682311 2:145153277-145153299 TTAAGTTTGTTTGAATTTCCTGG + Intergenic
941118293 2:161497604-161497626 TAAGAGTTCTTTAAATATTCTGG + Intronic
942844090 2:180402123-180402145 TTAAAGATCCTTAAATGTCCAGG - Intergenic
943045579 2:182857784-182857806 TGAGGGTTCTTTACATATTCTGG - Intronic
944319295 2:198318872-198318894 TTAAGCATATTTAAATAGCCAGG + Intronic
944379853 2:199095809-199095831 TTAAGGTTTTTCAAACATACAGG - Intergenic
944866035 2:203863149-203863171 TTAAGATTCTTTAAGAATCTAGG + Intergenic
944921505 2:204418665-204418687 TAAGAGTTCTTTATATATCCTGG - Intergenic
945100779 2:206260592-206260614 TTAAGGGACTTAAAATATGCAGG - Intergenic
946826245 2:223681160-223681182 TAAAAGTTCTTTATATATTCTGG - Intergenic
947281097 2:228455817-228455839 TTTAAGTTCTTTAAAGATTCTGG + Intergenic
947303159 2:228712384-228712406 TTAATGTTCTATAAATACCAAGG + Intergenic
948201784 2:236134509-236134531 TTAAAGATATTTTAATATCCAGG + Intergenic
948587889 2:239031327-239031349 TGAAAGTTCTTTATATGTCCTGG + Intergenic
1169136197 20:3199289-3199311 TTAATGTACCTTAAATATCCTGG - Intronic
1169136724 20:3202292-3202314 CTAATGTACCTTAAATATCCTGG + Intronic
1169676482 20:8160059-8160081 TCAAAGTTCTCTAAATCTCCAGG + Intronic
1170490537 20:16869100-16869122 TTAGGGCTCCTTAAATATTCTGG - Intergenic
1171506977 20:25644861-25644883 TAGAAGTTCTTTAAATATTCTGG + Intergenic
1172131012 20:32655444-32655466 TAAGGGTTCTTTATATATGCTGG - Intergenic
1172868462 20:38119349-38119371 TAAGGGTTCTTTATATATTCTGG + Intronic
1173429989 20:42979258-42979280 TTAGTGTTCTTTATATATCAAGG + Intronic
1174187141 20:48714385-48714407 TAAGGGTTCTTTACATATTCTGG - Intronic
1176360603 21:5993894-5993916 TTAAGGACCTTTAAACTTCCTGG + Intergenic
1177027501 21:15937752-15937774 TAAATGTTCTTTATATATTCTGG + Intergenic
1177213166 21:18095385-18095407 TTTAGTTTTTTTAAATATACTGG - Intronic
1177756418 21:25354013-25354035 TTTAAGTTCCTTATATATCCTGG - Intergenic
1177770493 21:25509344-25509366 ATAAGGTTCTTAAACTAACCTGG + Intergenic
1178105890 21:29318759-29318781 TAAAGGTTCTTTGAATCTCAAGG - Intronic
1178928812 21:36798898-36798920 GTAAGGTTCTTTATATATTCTGG + Intronic
1179762915 21:43544656-43544678 TTAAGGACCTTTAAACTTCCTGG - Intronic
1179806051 21:43837886-43837908 TAAAGCTGCTATAAATATCCAGG - Intergenic
1182166115 22:28175381-28175403 TTTAAGTTCCTTAAATATTCTGG - Intronic
1182196646 22:28525607-28525629 ATAAGTTTGTTTAAATAGCCTGG + Intronic
1183766825 22:39885121-39885143 TAAAAGTTCTTTATATATTCTGG - Intronic
1184237838 22:43194386-43194408 TAAGAGTTCTTTACATATCCTGG + Intergenic
1184540291 22:45118424-45118446 TAAAAGTTCTTTATATATCCTGG - Intergenic
949738796 3:7205866-7205888 TTAAGTTTATTTAAACAACCTGG + Intronic
950292571 3:11797764-11797786 TTTAGGTTCTTTATAGATGCTGG - Intronic
950519583 3:13489122-13489144 GTAGGGTTCTTTATATATTCTGG + Intronic
950603811 3:14059700-14059722 TAAAAGTTCTTTATATATTCTGG + Intronic
951253858 3:20426562-20426584 TTTAAGTTCTTTAAAGATGCTGG + Intergenic
951644241 3:24870077-24870099 TAAAAGTTCTTTGTATATCCTGG + Intergenic
951938350 3:28049402-28049424 TGAGAGTTCTTTATATATCCTGG - Intergenic
952162941 3:30713837-30713859 TAAATGTTCTTTATATATTCTGG - Intergenic
952288596 3:31993121-31993143 TGAGGGTTCTTTGAATATGCGGG - Intronic
952393459 3:32900887-32900909 TTGTAGTTCTTTAAATATTCTGG - Intergenic
952696721 3:36273380-36273402 TTTAAGTTATTTAAATATCATGG - Intergenic
953246182 3:41195907-41195929 TTTATGTTCTTTGAATATCATGG + Intronic
955917112 3:63917433-63917455 TTAAGGGTCTCTAAATATTCAGG - Intronic
956235570 3:67067239-67067261 TGAAAGTTCTTTATATATTCTGG - Intergenic
957473438 3:80692009-80692031 TTAAGCTCCTTTAAATGTTCTGG + Intergenic
958679769 3:97313301-97313323 TTTAGGTTCCTTCCATATCCTGG + Intronic
958776783 3:98494199-98494221 TTAAACTTCTTTAAATAACGTGG + Intergenic
960750617 3:120948324-120948346 TAAGGGTTCTTTATATATTCTGG + Intronic
960751144 3:120955081-120955103 TTACATTTCTTTAAATATTCAGG + Intronic
960813670 3:121651226-121651248 TGAAAGTTCTTTATATATTCTGG - Intronic
961845042 3:129755519-129755541 TTAGAGTTCTTTACATATTCTGG - Intronic
962050627 3:131810764-131810786 TTTAGGTTGTTTACATATCTTGG - Intronic
962453901 3:135547576-135547598 TCAAAGTTCTTTACATATCAGGG + Intergenic
962486476 3:135847635-135847657 TTAAGGTCCTTTTATTATTCAGG - Intergenic
962514135 3:136133271-136133293 TTAGAGTTCTTTACATATTCTGG - Intronic
963257144 3:143156762-143156784 TTGGAGTTCTTTAAATATCCTGG - Intergenic
963527650 3:146434569-146434591 TTAAGGATCTATAAATTTTCAGG - Intronic
963747990 3:149144533-149144555 TTAAGGCTCTTTTAATATCTAGG + Intronic
964288007 3:155142078-155142100 TTAAGTTTGGTTAAATATTCTGG - Exonic
964363096 3:155918793-155918815 TAAATGTTCTTTATATATTCTGG + Intronic
964583069 3:158261482-158261504 TTAGAGTTCTTTATATATTCTGG + Intronic
965169661 3:165246318-165246340 TTAATGTAATTTTAATATCCAGG + Intergenic
965542458 3:169883643-169883665 TAAAGGTTTTTTTCATATCCAGG - Intergenic
965611797 3:170551758-170551780 ATAAGATTCTTTATATATTCTGG + Intronic
965892464 3:173531268-173531290 TTAAAGTTCTTGAAAAATCAAGG - Intronic
966155116 3:176907871-176907893 TTAAAGTTCTTTATAGATGCTGG + Intergenic
966257031 3:177928808-177928830 TTATTGTTTTTTAAATATACAGG + Intergenic
966729469 3:183138527-183138549 TAAAGGTTATTTAACTTTCCAGG + Intronic
967056981 3:185837892-185837914 TTATGGTTATTTAAATATTATGG + Intergenic
968184022 3:196619014-196619036 TAAAAGTTCTTTATATATTCTGG + Intergenic
968840914 4:3005142-3005164 TTCAGTTTCTTTACATATGCGGG + Intronic
970105908 4:12584043-12584065 TAAAGGTTCTTTAAATATTCTGG - Intergenic
970504369 4:16712183-16712205 TTAGAGTTCTTTATATATTCTGG - Intronic
970577490 4:17442160-17442182 TTTAAGTTCTTTACAGATCCTGG - Intergenic
970703124 4:18766709-18766731 TTTAGGTTCTTTATAGATTCTGG + Intergenic
971458632 4:26869885-26869907 TTAAGGTTGTTTCCATATCTTGG - Intronic
972409377 4:38777572-38777594 TTAATGTTCTTTATAGATTCTGG - Intronic
973184922 4:47315158-47315180 TTTAAGTTCTTTATATATTCTGG - Intronic
973222263 4:47741203-47741225 GTCAGGTTCTTTATATATTCTGG - Intronic
973312316 4:48723050-48723072 TTGAGGTCCTTTAGATGTCCAGG - Intronic
973666947 4:53169902-53169924 TTTCGGTTCCTTAAATATTCTGG + Intronic
973967220 4:56175659-56175681 TTAGAGTTCTTTATATATTCTGG + Intronic
974541465 4:63244179-63244201 TAAAAGTTATTTAAATATTCTGG - Intergenic
974735109 4:65920686-65920708 TCAATGTTCTTTACATATTCTGG + Intergenic
974841337 4:67302938-67302960 TAAAGGTGATTTACATATCCAGG - Intergenic
975699995 4:77055404-77055426 TTAACTTTATTTAAATATCTGGG + Intronic
975754121 4:77555750-77555772 TAAATGTTCTTTATATATTCTGG - Intronic
975817868 4:78237947-78237969 TTAAGTTGCTTAAAATCTCCAGG - Intronic
976508463 4:85879319-85879341 TTAAGCATCTTTATATATCCTGG + Intronic
976581102 4:86738583-86738605 TACATGTTCTTTAAATATTCTGG + Intronic
977101020 4:92815135-92815157 TTGAGATTTTTTAAAAATCCTGG - Intronic
977377543 4:96225592-96225614 TAAAAGTTCTTTACATATTCTGG - Intergenic
977511764 4:97970930-97970952 TTTAGGTTCTTTATAGATTCTGG - Intronic
977821954 4:101482521-101482543 TTGAAGTTCTTTATATATTCTGG + Intronic
977867596 4:102048486-102048508 TGAATATTCTTCAAATATCCTGG + Intronic
978829134 4:113061697-113061719 TGAAGATACTTCAAATATCCAGG - Intronic
979758068 4:124366501-124366523 TTAAAGTTCTTTATAGATTCTGG - Intergenic
981094694 4:140766364-140766386 TTAAGGTTTTTCAAATATTTGGG - Intergenic
981769309 4:148289003-148289025 ATAAGTTTCTTTTAATATACTGG - Intronic
981797837 4:148617805-148617827 ATAAGGATATTAAAATATCCAGG - Intergenic
981838257 4:149080556-149080578 TCAAGGTTCTTTGGATATCAAGG + Intergenic
981860763 4:149353514-149353536 TTAAGGTTGTTTCCATATCTTGG - Intergenic
981951171 4:150409458-150409480 TGAGGTTTCTTTACATATCCTGG + Intronic
982764393 4:159327330-159327352 TTAAGTTTCTGTAAATCTCATGG - Intronic
982973528 4:162022402-162022424 TTAAGTTTCTTTAAAACTCTTGG - Intronic
983726413 4:170933316-170933338 TTAATTTTCTTTAAAAATCAAGG + Intergenic
984049085 4:174841614-174841636 TGAAGGTTCAGCAAATATCCTGG - Intronic
985579152 5:687834-687856 TAGAGGTTCTTTATATATTCTGG - Intronic
985585550 5:731587-731609 TCATGGTTCTTTAAATATTCTGG + Intronic
985593995 5:779897-779919 TAGAGGTTCTTTATATATTCTGG - Intergenic
985599076 5:816110-816132 TGAAAATTCTTTAAATATTCTGG + Intronic
985599988 5:823014-823036 TCATGGTTCTTTAAATATTCTGG + Intronic
986211177 5:5674309-5674331 TGAGGGTTCTTTATATATTCTGG - Intergenic
987903228 5:24040781-24040803 TTTAGGTTGTTTCAATATCTTGG + Intronic
987908384 5:24108643-24108665 TAAAGGCTCTTTAAATATGTGGG + Intronic
988135577 5:27166303-27166325 TTAAGGTTCTTTGTAGATTCTGG + Intergenic
988643280 5:33065603-33065625 TTATGATTCTTTAAAAATCTGGG + Intergenic
988669900 5:33370362-33370384 GGAAGGTTCCTTAAAGATCCAGG + Intergenic
989079301 5:37600217-37600239 TAGATGTTCTTTAAATATTCTGG - Intronic
989428306 5:41322199-41322221 TTCAAGTTCCTTATATATCCTGG - Intronic
990066509 5:51721961-51721983 TGAAGCTTATTTAAATATTCAGG + Intergenic
990135207 5:52636457-52636479 TTAAAGTTCTTTATACATTCTGG - Intergenic
990163658 5:52971538-52971560 TTTAAGTTCTTTATAGATCCTGG + Intergenic
990355590 5:54963025-54963047 TTAAGGTAGTTTAAACATCAGGG - Intergenic
990554929 5:56923277-56923299 TGAAGTTTCTGTAAATAACCTGG - Exonic
991486976 5:67147346-67147368 TTAATGTTCTCTAAATGTCAAGG - Intronic
992516482 5:77499039-77499061 TCAGGGTTCTTTATATATTCTGG - Intronic
992660511 5:78955665-78955687 TAAGGGTTCTTTATATATTCTGG - Intronic
993166960 5:84368744-84368766 TTAAAGTTCTCTATATATTCTGG - Intronic
993217235 5:85041786-85041808 TGAACGTTTTTTAAATATGCTGG + Intergenic
993691470 5:91006125-91006147 TTAATTTTATTTAAATATCTAGG + Intronic
993860072 5:93125357-93125379 TTAGGGTTTTGCAAATATCCTGG - Intergenic
993935383 5:93994245-93994267 TTTAGGTTATTTACATATCTTGG - Intronic
994629399 5:102265189-102265211 TTAAAGTTCTTTATATATTCTGG + Intronic
995447058 5:112256106-112256128 TTAAGCTTATTTCAAAATCCAGG - Intronic
996244484 5:121244315-121244337 TTAAGGTTGTTTCCATATCTTGG - Intergenic
996431732 5:123387579-123387601 TTAAGGCACTTTAAAAATGCTGG - Intronic
996782661 5:127205045-127205067 TTTAGGTTGTTTACATATCTTGG - Intergenic
997183581 5:131858703-131858725 TTTAAGTTCCTTATATATCCTGG - Intronic
997321915 5:132984667-132984689 TTAGTGTTCTTTTAATATCTGGG + Intergenic
998065946 5:139158802-139158824 TTAAGCTTCTTAAGATATTCTGG + Intronic
998600071 5:143576229-143576251 TTAATATCCTGTAAATATCCTGG - Intergenic
1000113669 5:158133718-158133740 TTAAGCTTCTTTAAAAATTGAGG - Intergenic
1000518341 5:162268573-162268595 CTAAGTTTCTTCAAATATCTAGG + Intergenic
1001272380 5:170324086-170324108 TTGAGCTTATTTATATATCCTGG - Intergenic
1001856601 5:175016466-175016488 TTACGGTTCTTCATATATTCAGG + Intergenic
1003025646 6:2553030-2553052 TTAAAGTTTCTTAAATTTCCTGG + Intergenic
1003138339 6:3450960-3450982 TGAAAGTTGCTTAAATATCCTGG - Intronic
1003485584 6:6574749-6574771 TTGAGGTTCTTTGAATCTCCTGG - Intergenic
1004207269 6:13603364-13603386 TAAGAGTTCTTTATATATCCTGG - Intronic
1004440773 6:15650735-15650757 TAAAAGTTCTTTATATATTCTGG + Intronic
1004735588 6:18403118-18403140 TTTGGGTTATTTAAATATACAGG - Intronic
1005383173 6:25258561-25258583 TTATGCTTATTTAAATAACCAGG + Intergenic
1005721854 6:28610167-28610189 TTAAGGTTATTTTAAAAACCTGG - Intronic
1006819233 6:36877897-36877919 GTAAAGTTCCTTATATATCCTGG + Intronic
1008083567 6:47220255-47220277 TTTAGGTTGTTTCTATATCCTGG - Intergenic
1008306487 6:49907935-49907957 TTAAGATTCCTTAAATTTCAAGG - Intergenic
1008902355 6:56635297-56635319 TTTAAGTTCTTAATATATCCTGG - Intronic
1009805403 6:68595809-68595831 TTAAGGTTCTTTGTAGATTCTGG + Intergenic
1010304305 6:74300550-74300572 TTTAGGTTCTTTCCATATCTTGG - Intergenic
1010319901 6:74494800-74494822 TAAAAGTTCTTTAGATATTCTGG + Intergenic
1010857652 6:80861670-80861692 AAAAGTTTCTTTAAATATGCTGG + Intergenic
1011756250 6:90501125-90501147 TTAAGAATCAGTAAATATCCTGG - Intergenic
1012062602 6:94508037-94508059 TAAAGTTTCTTTATATATTCAGG - Intergenic
1012524855 6:100165188-100165210 ATCAGTTTCTTTAAATCTCCAGG + Intergenic
1012954975 6:105560071-105560093 TAAAGGCTCATTAAATATCCAGG - Intergenic
1013248392 6:108310482-108310504 TAAAAGTTCTTTATATATTCTGG + Intronic
1013362311 6:109405371-109405393 TTAAGCTTCTTTTAATCTGCAGG + Intronic
1013563475 6:111330525-111330547 ATAAGATTTTTTAAATATTCAGG - Intronic
1013764432 6:113558319-113558341 TTAAGGGGCGTTAAACATCCTGG + Intergenic
1013859667 6:114619939-114619961 TTGAGTTTCTTTTAATAACCAGG + Intergenic
1013947699 6:115742152-115742174 TAAAGCTTCTATAAACATCCTGG - Intergenic
1014657295 6:124123496-124123518 TTAAGGTTCATAAACTATCTAGG - Intronic
1014898343 6:126931562-126931584 TAAAGGCTCTTTAAAAATCTTGG - Intergenic
1015107378 6:129552697-129552719 TTACTGTTCTGTGAATATCCAGG + Intergenic
1016118797 6:140322295-140322317 TTAAAATTCTGTAATTATCCTGG - Intergenic
1016229197 6:141781833-141781855 TTACAGTTCTTTACATATTCAGG - Intergenic
1016238169 6:141893249-141893271 TTCAGTTTCTTTAAATGTACAGG - Intergenic
1017682090 6:156874369-156874391 TTTAGTTTGTTTTAATATCCTGG + Intronic
1017691910 6:156975356-156975378 TAAGGGTTCTTTATATATCATGG + Intronic
1017921138 6:158873001-158873023 TGAGAGTTCTTTAAATATTCTGG + Intronic
1018259136 6:161952003-161952025 TTAATGTTTTTTAAAAATCCTGG - Intronic
1018271947 6:162089167-162089189 TAAATGTTCTTTATATATTCTGG - Intronic
1018764115 6:166917401-166917423 TTAATATTCATTAAATATCTGGG + Intronic
1018874551 6:167809162-167809184 TAAAAGTTCTGTAAATATTCAGG + Intergenic
1021023805 7:15639349-15639371 TTTAAGTTCTTTATATATTCTGG + Intronic
1021045134 7:15913409-15913431 TTTAAGTTCTTTAAATATAGGGG + Intergenic
1021351314 7:19597347-19597369 TTAAAGTTCTTTATAGATTCTGG + Intergenic
1021736961 7:23648765-23648787 TTAAGGTTTTTTAGAAATACTGG - Intergenic
1022144033 7:27519360-27519382 TTAAGGTTTTTTTTATAGCCAGG - Intergenic
1022346591 7:29521582-29521604 TTAGGGTTCCTTATATATTCTGG + Intergenic
1023234809 7:38073706-38073728 TTTAGGTTCCTTAAAAATGCTGG + Intergenic
1023376523 7:39561566-39561588 TAAAGGTTCTTTGTATATTCTGG - Intergenic
1024012613 7:45282837-45282859 TTAATGTTCTTTTATTGTCCAGG + Intergenic
1024153419 7:46596162-46596184 TTTAGGTTCTTTGTATATTCTGG - Intergenic
1024350873 7:48361800-48361822 TAAAGCTTCTTTTAATTTCCAGG + Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026712717 7:72756761-72756783 TAAAAGTTCTTTATATATTCTGG - Intronic
1027366960 7:77468615-77468637 TTAAGGCTTTTGAAATATACTGG - Intergenic
1027392216 7:77715963-77715985 TGAAAGTTCTTTACATATTCTGG + Intronic
1028388625 7:90289496-90289518 TTAGAGTTCTTTATATGTCCTGG + Intronic
1029003243 7:97178719-97178741 TTGTGGTTCTTTATATATTCTGG + Intronic
1029589895 7:101500396-101500418 TTATGGTTTTTTCAACATCCAGG + Intronic
1030410426 7:109171426-109171448 TAAGAGTTCTTTATATATCCTGG - Intergenic
1030691047 7:112533990-112534012 TAAGTGTTCTTTAAATATTCTGG + Intergenic
1030718870 7:112845360-112845382 TTTAGGTTCTTTATAGATGCTGG - Intronic
1030787356 7:113678730-113678752 ATAGAGTTATTTAAATATCCTGG + Intergenic
1032208808 7:129893055-129893077 TAATGGGTCTTTAAATATTCAGG - Intronic
1032729742 7:134628056-134628078 TAAAAGTTCTTTATATATTCTGG + Intergenic
1032848950 7:135775883-135775905 TCAGTGTTCTTTAAGTATCCAGG + Intergenic
1034394666 7:150812827-150812849 TTTAAGTTCTTTAAAGATTCTGG - Intergenic
1035046049 7:155966803-155966825 TAAATGTTCTTTATATATTCTGG - Intergenic
1035089718 7:156298016-156298038 TTAAGATTCTTTATGTATTCTGG - Intergenic
1036064727 8:5367118-5367140 TTAAAGTTCTTTATATATTTTGG - Intergenic
1036290935 8:7489589-7489611 TTGAACTTCTTTGAATATCCAGG - Exonic
1036330555 8:7821948-7821970 TTGAACTTCTTTGAATATCCAGG + Exonic
1036601706 8:10267175-10267197 TTATGGTACTTTAGATTTCCTGG + Intronic
1037150615 8:15631042-15631064 TTAAGTTTCCTTAAATTTCTTGG + Intronic
1037366438 8:18127360-18127382 TTAATTTTCTTTAAAGATACAGG - Intergenic
1037680959 8:21097085-21097107 TTACGGTTCCTTAAATTCCCAGG - Intergenic
1037706357 8:21318733-21318755 TTATAGTTCTTTATATATTCTGG + Intergenic
1037874387 8:22533437-22533459 TTATAGTTCTTTATATATTCTGG - Intronic
1037933099 8:22895538-22895560 TTAAGGTTCTCTGAGTATCTTGG + Intronic
1038657254 8:29465041-29465063 TTAGAGTTCTTTATATATTCTGG + Intergenic
1039047786 8:33466048-33466070 TTGAGATTCTTTAAATATAAGGG - Intronic
1039160212 8:34610463-34610485 TAAAGGTTCTTTATATCTTCTGG - Intergenic
1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG + Intronic
1040682521 8:49830518-49830540 TTTATGTTCATTAAATATCTGGG + Intergenic
1040710286 8:50180010-50180032 TTAGGGTTGTTTTAATATCTTGG - Intronic
1041200015 8:55444489-55444511 TAAAAGTTCTTTACATATTCTGG - Intronic
1041400343 8:57436551-57436573 TAAAGGTTATTTATATATTCTGG + Intergenic
1041762827 8:61385169-61385191 TTAAGGGTCTTCAAATAGCTGGG + Intronic
1042653733 8:71071550-71071572 TTAAGGTTGTTTCCATATTCTGG + Intergenic
1043016118 8:74942164-74942186 TAAATGTTCTTTATATATTCTGG - Intergenic
1043416059 8:80051295-80051317 TTAAGGTTGTTGAAAAATTCTGG - Intronic
1043619169 8:82166510-82166532 TTGAGGTTCTTTAAAGTTCTTGG + Intergenic
1043797611 8:84564452-84564474 TTAAGCTTCTCTAAAGATGCAGG - Intronic
1044197902 8:89400779-89400801 TCAAGATTTTTTAAAGATCCAGG + Intergenic
1044259666 8:90103209-90103231 TTTAGGTTGTTTCCATATCCTGG + Intergenic
1045204869 8:100027870-100027892 TTAAGGTTCTATCAATTACCTGG - Intronic
1047602948 8:126445275-126445297 TAATGGTTCTTTATATATTCTGG - Intergenic
1047896070 8:129367789-129367811 TTCAGGGATTTTAAATATCCCGG + Intergenic
1048652461 8:136494067-136494089 ATAATGTTCTTGAAATATTCTGG - Intergenic
1050343727 9:4665853-4665875 TTCAACTTCTTTAAATAACCAGG - Intronic
1051307682 9:15732064-15732086 TAAGAGTTCTTTACATATCCTGG + Intronic
1051709478 9:19915804-19915826 GTGAGGTTCTTTATATATTCTGG + Intergenic
1051758293 9:20430862-20430884 TTAGAGGTCTTTTAATATCCTGG - Intronic
1052046677 9:23802068-23802090 TTAAGATTCTATACACATCCTGG + Intronic
1052079152 9:24181147-24181169 TCAAAGTTCTATAAATATCTAGG + Intergenic
1052423141 9:28270075-28270097 TTAAGGTTCTGAAGATACCCTGG + Intronic
1052710326 9:32047578-32047600 TTAAGGTTTTTTAAACATTAAGG - Intergenic
1053034418 9:34811913-34811935 GTAGGGTTCTTTATATATACTGG - Intergenic
1054972643 9:71106412-71106434 ATCTGGTTGTTTAAATATCCTGG + Intronic
1055228696 9:74033355-74033377 TAAAGTTTCTTTAAACATCTTGG + Intergenic
1055464173 9:76547522-76547544 TGAAAGTTCTTTATATATTCTGG + Intergenic
1057402108 9:94733047-94733069 TTCAGGTTCTGGAAATATCATGG + Intronic
1057456520 9:95217816-95217838 TTAAATTTTTTTAAATAGCCAGG - Intronic
1059041228 9:110817563-110817585 TTCAGATTTTTTAAATATTCAGG + Intergenic
1059292097 9:113235108-113235130 CAAAGGTTCTTTACATATTCTGG - Intronic
1059611694 9:115904288-115904310 TTAAGGTTCTTCATATATTATGG + Intergenic
1059977397 9:119732016-119732038 TTAAGGATCATTAAATGTACAGG + Intergenic
1186392352 X:9173669-9173691 TTTAGGTTCTTTAAAGATTCTGG - Intergenic
1186589106 X:10909958-10909980 TTTGGGTTTTTTAAATATCTAGG - Intergenic
1186824166 X:13321562-13321584 TTCAGGTTCTGCCAATATCCAGG + Intergenic
1187352941 X:18538304-18538326 TTTAAGTTCTTTATATATTCTGG + Intronic
1187829571 X:23367145-23367167 TTAATGTTCTTTATCTCTCCAGG + Intronic
1188152476 X:26695140-26695162 TTGAGGATCTTGAGATATCCTGG + Intergenic
1188162183 X:26818139-26818161 TTGAGGTTCTTTGAACTTCCTGG + Intergenic
1189079569 X:37956699-37956721 TTTAGGTTGTTTACATATCATGG + Intronic
1189673167 X:43433812-43433834 TTTAGGTTGTTTACATATCTTGG - Intergenic
1190787894 X:53670691-53670713 TTACATTTCTTTAAATATCTTGG - Intronic
1192011936 X:67283119-67283141 TTAAAGTTCCTTATAGATCCTGG - Intergenic
1192912101 X:75616040-75616062 TGAGAGTTCTTTAAATATTCTGG - Intergenic
1193008086 X:76643719-76643741 TGAAGGTTCCTGAAATACCCTGG - Intergenic
1193102966 X:77636689-77636711 TAAATGTTGTTGAAATATCCAGG - Intronic
1193563503 X:83048779-83048801 TTAATTTTCTTTAAATTTTCAGG - Intergenic
1194872839 X:99154064-99154086 GTAAGATTCTTTAATTATCCTGG - Intergenic
1194899276 X:99488369-99488391 TTAAGATTCTTTTATTATACAGG - Intergenic
1195788354 X:108553357-108553379 TTAGAGTTCTTTATATATTCTGG - Intronic
1195822419 X:108960492-108960514 TAGAAGTTCTTTAAATATTCTGG - Intergenic
1196221836 X:113120354-113120376 TTTAGGTTCTTAAAATAGCTTGG - Intergenic
1196280140 X:113814507-113814529 TAAGAGTTCTTTAAATATTCTGG - Intergenic
1196368471 X:114948661-114948683 TGAGGGTTCTTTATATATTCTGG - Intergenic
1196507606 X:116465998-116466020 TAAAAGTTCTTTATATATTCTGG + Intergenic
1197496367 X:127186908-127186930 TAAAGGCTGTTTATATATCCTGG + Intergenic
1197791008 X:130254028-130254050 TTTAAGTTCTTTATATATGCTGG - Intronic
1197841173 X:130748569-130748591 TTAAGGCTCTTTCAATACCAAGG - Intronic
1199337421 X:146635610-146635632 TTATAGTTCTTTATATATTCTGG - Intergenic
1199427781 X:147723062-147723084 ATGATGTTCTTTAAATATACTGG - Intergenic
1199662051 X:150061447-150061469 TTAAGTTTCTTTTAATCTACAGG + Intergenic
1200032272 X:153306489-153306511 TTAAGGCTGTTGAAAGATCCAGG - Intergenic
1200306972 X:155036384-155036406 TGAGAGTTCTTTAAATATTCTGG + Intronic
1200354122 X:155530151-155530173 TTTAGGTTCTTTCCATATCTTGG - Intronic
1200760661 Y:7036021-7036043 TTAAGGTGCTGAAAATATACAGG + Intronic
1200795509 Y:7337819-7337841 CTAAGGTTGTATAAGTATCCAGG - Intergenic
1202588043 Y:26452946-26452968 TAAATGTTCTTTTAATATTCTGG + Intergenic