ID: 929738220

View in Genome Browser
Species Human (GRCh38)
Location 2:44574441-44574463
Sequence AGTTAGTTACAGGAGATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929738213_929738220 23 Left 929738213 2:44574395-44574417 CCCTAGGCAGATTTAGGCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 89
Right 929738220 2:44574441-44574463 AGTTAGTTACAGGAGATGGTTGG 0: 1
1: 0
2: 1
3: 19
4: 211
929738214_929738220 22 Left 929738214 2:44574396-44574418 CCTAGGCAGATTTAGGCTGGCAG 0: 1
1: 0
2: 3
3: 12
4: 139
Right 929738220 2:44574441-44574463 AGTTAGTTACAGGAGATGGTTGG 0: 1
1: 0
2: 1
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929738220 Original CRISPR AGTTAGTTACAGGAGATGGT TGG Intronic
901716190 1:11156504-11156526 AGATAGGTAAAGGAGAAGGTAGG - Intronic
904305680 1:29587475-29587497 AGTTAGATAAAGGAGGTGGCTGG - Intergenic
905003113 1:34688909-34688931 GGTTTGTTAAAGCAGATGGTTGG - Intergenic
905544590 1:38787417-38787439 AGTTAGATAGAGGAGGTGGTTGG + Intergenic
907054518 1:51352737-51352759 ATTTACTTATAGGAAATGGTAGG - Intergenic
907414448 1:54304518-54304540 AGGGAGTTGCAGGTGATGGTGGG + Intronic
907548732 1:55286154-55286176 AGTTGGTTAAATGAGAGGGTTGG - Intergenic
909850453 1:80455436-80455458 AAATAGTTAAAGGAGAAGGTGGG + Intergenic
912549225 1:110473849-110473871 AGTTTGATAAAGGAGAGGGTTGG + Intergenic
913306551 1:117433845-117433867 AGTTAGAGACAGGAGATGGTGGG - Intronic
914823393 1:151122817-151122839 AGTTTGTTAGAGGAGAGGCTAGG + Exonic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916474150 1:165152680-165152702 AGTTATTTACAGGGCATGGTGGG - Intergenic
918888387 1:190229010-190229032 AGTTGGTTCCATGAGAAGGTGGG - Intronic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921339638 1:214121964-214121986 AGTCAGTTCCAGGAGATAGTGGG + Intergenic
922242479 1:223764882-223764904 AGTTAGTTACAAGATGTGGCCGG - Intronic
923847214 1:237748338-237748360 AGTAAGTGACAGGAGATGTAAGG - Intronic
924745943 1:246833763-246833785 AGTTAGATAGAGGAGGTAGTTGG - Intergenic
1063621267 10:7651269-7651291 AGTTTGATATGGGAGATGGTTGG - Intronic
1064781858 10:18849296-18849318 AGTTAATTACTTGAGGTGGTAGG + Intergenic
1066227508 10:33398117-33398139 AGTTAGATAGTGGTGATGGTTGG - Intergenic
1066486650 10:35852166-35852188 TGTTAGGTACAGGAGGTGCTTGG + Intergenic
1067307643 10:45079778-45079800 TGTTAGATACAGGAGGTAGTTGG + Intergenic
1067680586 10:48435611-48435633 ATTTAGTTACAAGAATTGGTAGG + Exonic
1067773968 10:49148265-49148287 AGTTAGGTAAAGAAGGTGGTTGG - Intergenic
1067941853 10:50663312-50663334 AGTAAGTCACAGTAGGTGGTAGG + Intergenic
1070863101 10:79688266-79688288 AGTAAGTCACAGTAGGTGGTAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071810509 10:89176092-89176114 TTTTGGTTACAGGAGATGGAGGG - Intergenic
1072072818 10:91936386-91936408 AGGTAGATACAGGATAGGGTAGG + Intronic
1072349532 10:94543891-94543913 AGTTAGATTCAGGAGATGTTTGG - Intronic
1072509576 10:96106226-96106248 AGCTATTTACAGAAGATGTTTGG - Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1075011336 10:118872792-118872814 AGTAAGTTATAGGTGGTGGTGGG - Intergenic
1075088964 10:119432211-119432233 AGTTAGTTTCAGGGGAGGCTGGG + Intronic
1075227794 10:120645250-120645272 AGTTAGATAAAGGAGCTGGTTGG - Intergenic
1075405336 10:122192062-122192084 AGTTAATTAGAGGAGGTGGATGG - Intronic
1076079988 10:127570595-127570617 CCTGAGTGACAGGAGATGGTGGG + Intergenic
1079275755 11:19035749-19035771 AGCTTCTTAAAGGAGATGGTTGG - Intergenic
1079589645 11:22166861-22166883 ATTTAGTAACAGGAGATTTTGGG - Intergenic
1080107642 11:28527316-28527338 ATTTAGTAACAGGGGAGGGTGGG - Intergenic
1080281600 11:30563538-30563560 AGTAAGTGACAGGAGATAGTAGG + Intronic
1088718732 11:112573376-112573398 AGTTTGATAAAGGAGATGGTTGG - Intergenic
1089925704 11:122255396-122255418 AGTTAGATAAAGGGGGTGGTCGG - Intergenic
1092986062 12:13847598-13847620 AGTGGGTCACAGGAGATGGGGGG + Intronic
1093674952 12:21927817-21927839 ATCTATTTACAGGAGGTGGTAGG - Intronic
1094004652 12:25736774-25736796 AGATAGTTACACTAGATGCTTGG - Intergenic
1095219129 12:39587624-39587646 GGTTAGCTACAGGAGGTGGGAGG + Intronic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096448487 12:51716868-51716890 AGTTAGATAAAGGAGGTAGTTGG - Intronic
1097038863 12:56142425-56142447 GGTGAGTGACAGGAGATGGTGGG + Exonic
1100068721 12:90683708-90683730 GGTTAGATACAGGAGCTGTTGGG + Intergenic
1100781063 12:98027057-98027079 AATAAGCCACAGGAGATGGTGGG + Intergenic
1102952363 12:117039295-117039317 AGTTGGTGGCAGGAGACGGTAGG - Intronic
1107174651 13:37386311-37386333 AATTGGTTAAAGGAGAAGGTAGG - Intergenic
1107320813 13:39185921-39185943 TGTGAGTTACTGAAGATGGTGGG - Intergenic
1108762394 13:53584555-53584577 AGTTAGGTACATAAGTTGGTAGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1111058377 13:82980023-82980045 AGTTAAATAAAGGAGGTGGTTGG - Intergenic
1111835337 13:93381540-93381562 CTTTAGTTACAGGAGCTTGTGGG + Intronic
1115067225 14:29278670-29278692 AGTCAGTGAGAGGAGATGATGGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116414407 14:44663195-44663217 AGTTAGAGACATGAGATGGGTGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1118732645 14:68679186-68679208 GGTTAGTTTAAGGAGATGATAGG - Intronic
1119508846 14:75195757-75195779 AGTTGGTTCAAGGGGATGGTGGG - Intergenic
1120752570 14:88211573-88211595 AGTTACTCCCAGGAGTTGGTAGG - Intronic
1122384371 14:101333921-101333943 AGCAAGTTCCAGGAGAAGGTGGG - Intergenic
1123453922 15:20399145-20399167 AGTTAGTTACAGTAAATTGCAGG + Intergenic
1127918527 15:63475067-63475089 AGTTAGTAACAAGAGCTGCTGGG + Intergenic
1128787211 15:70406675-70406697 AGTTAGTTGCAGGAGAGGGGTGG - Intergenic
1129174087 15:73827409-73827431 CGTGAGATAAAGGAGATGGTGGG - Intergenic
1134273795 16:12757801-12757823 AATTATTTACAGGAGACGGTGGG + Intronic
1137418004 16:48303348-48303370 AGTGAGTGACAGAAGAAGGTTGG + Intronic
1137429642 16:48408306-48408328 AGTTGGATGCAGGAGATGGGAGG + Intronic
1138277084 16:55742965-55742987 AGTCAGATACAGAAGCTGGTGGG - Intergenic
1143755484 17:9064248-9064270 AGTCAGTTAGAGGAGAAGGCTGG - Intronic
1144413187 17:15021202-15021224 AGTTAGAGTCAGGAGATGTTTGG - Intergenic
1147236542 17:39061801-39061823 AGTTAGAGCCAGGAGATGTTTGG + Intergenic
1148002568 17:44398346-44398368 AGGTAGTTATGGGAGATGGTTGG + Exonic
1151067299 17:71165917-71165939 AGCTAGTTACTGGAGAAGCTGGG + Intergenic
1151653433 17:75484246-75484268 TGGTAGTTATAGAAGATGGTGGG + Intronic
1153008429 18:516236-516258 AGTTAGAGTCAGGATATGGTTGG + Intergenic
1153093513 18:1374678-1374700 AATTAGATAAAGGAGGTGGTTGG + Intergenic
1153393661 18:4592345-4592367 TGTTAGTGACAGGGGAAGGTAGG - Intergenic
1153936346 18:9927881-9927903 ACTTAGTGGCAGGAAATGGTAGG + Intronic
1154030146 18:10746420-10746442 AGTTAGTCAGAGGAGAAGGCAGG - Intronic
1155059295 18:22214423-22214445 AGATAGTTAATGGAGAGGGTGGG - Intergenic
1155342380 18:24825896-24825918 AGTTAGAGTCAGGAGATGTTTGG + Intergenic
1155425419 18:25701816-25701838 AATTAGATACAAGAGATGGGTGG - Intergenic
1157300697 18:46477041-46477063 AGTTCTTTATAGGATATGGTTGG + Exonic
1160591638 18:79948033-79948055 AGTGTGTTCCAGAAGATGGTGGG - Intronic
1161712929 19:5860006-5860028 TGTGATTTACAGGAGAGGGTGGG - Intergenic
1162380797 19:10330551-10330573 AGGGAGTTACTGGAGATGGAAGG + Intronic
1162992159 19:14310568-14310590 AGTTTGATAAAGGAGATAGTTGG - Intergenic
1164436392 19:28233719-28233741 AGTTAGAATCAGGAGATGTTTGG - Intergenic
1164698358 19:30263430-30263452 AGTTAATAAAAGGAGCTGGTCGG - Intronic
1165529893 19:36389874-36389896 AGTTTGGTAAAGGAGATAGTTGG - Intronic
1167210814 19:48133113-48133135 AGTGAGTTAGAGGAGAGGGAAGG + Intronic
926173102 2:10566105-10566127 AGAGAGTGACAGGAGATGGCTGG + Intergenic
926481361 2:13400080-13400102 AGTTAGTTACAGTAAATTGCAGG - Intergenic
927816397 2:26221349-26221371 AGTTATTCACAGAGGATGGTAGG - Intronic
928369298 2:30729123-30729145 AGATAGTTACAGAGGAAGGTGGG + Intronic
929738220 2:44574441-44574463 AGTTAGTTACAGGAGATGGTTGG + Intronic
932206175 2:69885035-69885057 AGTTTGTTAAAGGAGGTAGTTGG - Intergenic
932334945 2:70925183-70925205 AGAAAGTGACAGGAGATGATTGG + Intronic
933068747 2:77832601-77832623 ACTTTGTTGCAGGAGATAGTGGG - Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
936835841 2:116708352-116708374 AGTTAGTCACATGTGGTGGTGGG + Intergenic
939693728 2:145297732-145297754 AGTTGGTTATAGAAGATGATTGG - Intergenic
941286024 2:163613145-163613167 AGTTAGTTACAGAAGAGGACTGG + Intronic
942369591 2:175268717-175268739 AGTTTGTTACTGGCCATGGTTGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943693335 2:190893082-190893104 AATTATTTACAGCAAATGGTTGG - Intronic
945986427 2:216357865-216357887 ATTTAGCTACAGGCAATGGTTGG + Intronic
946890036 2:224265689-224265711 AGTGGGTTGGAGGAGATGGTAGG + Intergenic
947679671 2:232018950-232018972 AGGTTGTTATAGGAGATGTTGGG + Intronic
1169433684 20:5564356-5564378 AGTTAGAGAAAGGTGATGGTGGG - Intronic
1169959402 20:11142324-11142346 AGTTAATGAAAGGAGATGCTGGG + Intergenic
1169999696 20:11601405-11601427 AGTTTGATAAAGGAGATGGTTGG + Intergenic
1171231294 20:23488680-23488702 AGTTAGCTACAGGATAGGGGTGG - Intergenic
1180132972 21:45838971-45838993 AGCTACTTACAGGAGAAGGAAGG - Intronic
1180938154 22:19639537-19639559 AGTTAGATAGAGGGGGTGGTTGG - Intergenic
1181336021 22:22129591-22129613 ATTTAGATTCAGAAGATGGTGGG + Intergenic
1181725046 22:24805934-24805956 AGGAAGTCACAGGAAATGGTGGG - Intergenic
1181888254 22:26038730-26038752 AGCTGGTTACAGTAGTTGGTTGG - Intergenic
1182698848 22:32215858-32215880 AGTTAGTGACAGTAGATGAGAGG + Intergenic
949230724 3:1746888-1746910 AGGTAGTGACAGGAGAGTGTAGG + Intergenic
949790488 3:7786850-7786872 TGTTAGTTGGAGGTGATGGTGGG - Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
955567385 3:60261991-60262013 AGTTTGATAAAGTAGATGGTAGG - Intronic
955913049 3:63878089-63878111 GGCTAGTAATAGGAGATGGTTGG + Intronic
956244541 3:67167306-67167328 CTTTAGTTACATGAGGTGGTAGG + Intergenic
960187201 3:114658473-114658495 AGGTAGTTAGAGGGAATGGTTGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962820023 3:139039360-139039382 CGTTAGCTACAGGAGATGAAAGG + Intronic
963483897 3:145912059-145912081 AATTTGATAAAGGAGATGGTTGG - Intergenic
963569287 3:146971484-146971506 ATTTAATTACAGGACATGGTTGG - Intergenic
964894348 3:161577310-161577332 AGTGAGAAAGAGGAGATGGTAGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
966786157 3:183624788-183624810 AGTTAGGTACAGGAGTGGGATGG + Intergenic
967114295 3:186322773-186322795 AGGGAGTCACAGTAGATGGTTGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
969215253 4:5716652-5716674 AGTTAGAGTCAGGAGATGTTTGG - Intronic
970229245 4:13891772-13891794 AGTTAGGGCCAGGACATGGTGGG + Intergenic
970426227 4:15948613-15948635 AGTTAGATAAAGGGAATGGTTGG + Intergenic
970936313 4:21574508-21574530 ATATACTTACAGGAGATGTTCGG + Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
975231674 4:71942178-71942200 TTTTAGTTCCAGGAGATTGTCGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977943491 4:102883206-102883228 GGTTAGATAAAGGAGGTGGTTGG - Intronic
978331430 4:107617237-107617259 GGTCAGGTACAGGAGATGCTTGG - Intronic
978475764 4:109128132-109128154 AGTTAGAGTCAGGAGATGTTTGG + Intronic
978967130 4:114754057-114754079 AATTAGGTACAGGATATTGTGGG + Intergenic
986295512 5:6434529-6434551 AGCTAGATATAGGGGATGGTAGG - Intergenic
989259713 5:39405384-39405406 AGTGAGTTAAAGGAGAAAGTTGG - Intronic
990938438 5:61175289-61175311 TGTTAGTTACAGTAGATGTGAGG - Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
994025147 5:95073431-95073453 AGTAAGGTTGAGGAGATGGTGGG - Intronic
994769474 5:103963842-103963864 GGTTATTTACAGGGGGTGGTGGG - Intergenic
994984391 5:106915514-106915536 AGTAAGTTACATGAGAAAGTGGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996576236 5:124979070-124979092 GGTTAGTTACAGGAGAGTGTCGG + Intergenic
997593646 5:135091761-135091783 CATTTGTTAAAGGAGATGGTTGG - Intronic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998653049 5:144142706-144142728 ACTTTGTTACAGGAGATGTTGGG + Intergenic
1000017635 5:157292062-157292084 AGTGACTTCCAGGAGGTGGTGGG - Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000682731 5:164206185-164206207 AGTTAATTACTGAAGATAGTTGG + Intergenic
1001183896 5:169548427-169548449 AGAGAGTTACAGGAGATAGCCGG - Intergenic
1001440713 5:171740648-171740670 TTTTTGTTACAGGAGATGGAAGG + Intergenic
1001718093 5:173833728-173833750 AATTAGTTTAAGGAGAGGGTGGG - Intergenic
1003019408 6:2496810-2496832 AGAAAATAACAGGAGATGGTGGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005844324 6:29765765-29765787 AGTTAGGTAGGGGACATGGTGGG - Intergenic
1006789139 6:36687136-36687158 AGTATGTTACAGGAGCTGGAAGG - Exonic
1006799188 6:36748772-36748794 AGTTAGTTACAGGAAATACAAGG + Intronic
1011520141 6:88195935-88195957 AGATAATTACAGGCTATGGTAGG + Intergenic
1012334829 6:98042395-98042417 ATTTACTTATAGGATATGGTGGG + Intergenic
1013632734 6:112000919-112000941 AGTGAGTTAGAGGTGCTGGTGGG + Intergenic
1015195459 6:130520811-130520833 AGTTAGATAAAGGAGACCGTGGG - Intergenic
1018686008 6:166305562-166305584 AGTTAAGAACAGGAGATGCTGGG + Exonic
1018692312 6:166356920-166356942 TGTTAGGTACAGGAGGTGGGAGG - Intergenic
1021170967 7:17397614-17397636 ACATAGTCGCAGGAGATGGTGGG + Intergenic
1023933991 7:44726096-44726118 TGTTTGATAAAGGAGATGGTTGG - Intergenic
1026467021 7:70662789-70662811 AGTTAGGCACAGGGCATGGTGGG + Intronic
1027969683 7:85062798-85062820 ACTTAGTTACAGGAAAAGGTTGG + Intronic
1031236853 7:119188238-119188260 AGTAAGTTACATGAGAAAGTAGG + Intergenic
1034166803 7:149031140-149031162 AGTGAGTTTCAGTAGTTGGTGGG + Intergenic
1035737421 8:1898647-1898669 AGGCAGTTACAGGAGGTGGAGGG + Intronic
1036530173 8:9577896-9577918 AGTTAGTTACAAGATACAGTGGG + Intronic
1037766569 8:21775834-21775856 AGTGAATAACAGGAGATGGATGG + Intronic
1041441691 8:57903941-57903963 AGTGAGTTAGAGGACATGGGTGG + Intergenic
1042041614 8:64597635-64597657 AGTTTGTTACAGGAAATCATGGG + Intronic
1042454094 8:68979470-68979492 AGTCAATTACAGGTGATGGATGG + Intergenic
1043619519 8:82171572-82171594 AATTAGATTCAAGAGATGGTAGG - Intergenic
1043803902 8:84646768-84646790 AGTTATTGACAGTAGATGGAAGG - Intronic
1044056196 8:87572043-87572065 AGGCAGATATAGGAGATGGTAGG - Intronic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1046436484 8:114196103-114196125 AGTCAATGACAGGAGATGCTAGG + Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047262137 8:123273456-123273478 AGTTAATTAAAGAGGATGGTAGG - Intronic
1047457764 8:125031676-125031698 AGTTATTTCCATGAGATGCTGGG - Intronic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1052342189 9:27374929-27374951 ATTTGATTACAGCAGATGGTGGG + Intronic
1053458298 9:38248727-38248749 AGTGAGTAATAAGAGATGGTAGG + Intergenic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1054556832 9:66665514-66665536 AGTTATTCACAGGAGATGGCAGG + Intergenic
1055316508 9:75039618-75039640 AGTTCGATAAAGGAGGTGGTTGG - Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1185620266 X:1449783-1449805 AGATAGTTACTGGTGATGGGGGG - Intronic
1185620292 X:1449911-1449933 GGTTAGTTACTGGTGATGGTGGG - Intronic
1187415182 X:19087021-19087043 AGTTATATGCAGGAGAAGGTTGG + Intronic
1188244518 X:27823865-27823887 AGGTAGTTACAGCAGTTGCTTGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190218537 X:48496015-48496037 AGTTCTTGACAGGAAATGGTGGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1196314755 X:114209882-114209904 AGTTAGAGACATGAGATGTTTGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1201964347 Y:19715593-19715615 AGTGAGTGACAGGAAATGGAAGG - Exonic
1202160311 Y:21927557-21927579 TGTCATCTACAGGAGATGGTGGG - Intergenic
1202231045 Y:22658821-22658843 TGTCATCTACAGGAGATGGTGGG + Intergenic
1202312113 Y:23537344-23537366 TGTCATCTACAGGAGATGGTGGG - Intergenic
1202558690 Y:26133250-26133272 TGTCATCTACAGGAGATGGTGGG + Intergenic