ID: 929738500

View in Genome Browser
Species Human (GRCh38)
Location 2:44577085-44577107
Sequence TAGGAAAGTCACTTTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929738500 Original CRISPR TAGGAAAGTCACTTTGATGC TGG Intronic
900697824 1:4023155-4023177 AAGGAAAGTCACTTTGGAGAGGG + Intergenic
904099579 1:28013113-28013135 GAGGAAAGTCTCTGTGCTGCAGG + Exonic
905768004 1:40619210-40619232 TAGGAAAGTCATTGTGAGGCAGG + Intergenic
906683260 1:47745278-47745300 CAGGCAAGTCACTTAAATGCTGG + Intergenic
906718902 1:47991441-47991463 TAGCAAAGTCACGGTGATGTTGG + Intronic
908343481 1:63207067-63207089 TACGTAAGACACTTTGATACAGG + Intergenic
915906412 1:159881248-159881270 TGGGGAAGTCACTTCAATGCTGG - Intronic
916666788 1:166974480-166974502 TAGACCAGTGACTTTGATGCTGG + Intronic
919726344 1:200887293-200887315 CAGTAAAGACACTTTGGTGCAGG - Intergenic
1063007331 10:1985685-1985707 TCTGAGAGTCACTTTGATGTTGG + Intergenic
1063827308 10:9911978-9912000 CAGGAAAGTCACTTGAATCCAGG - Intergenic
1065077535 10:22096679-22096701 TAATAAAGTCATCTTGATGCAGG - Intergenic
1069047192 10:63755441-63755463 TAAGAAAGTCAGTGTGATCCAGG - Intergenic
1071596364 10:86930162-86930184 TGGGAGAGTCACCTCGATGCTGG + Exonic
1072944364 10:99796589-99796611 CAGGAGAATCACTTTGAAGCCGG + Intronic
1073247178 10:102099347-102099369 TAGGAAACACACTCTGATGCTGG - Intergenic
1074022886 10:109602645-109602667 TTAGAAGGACACTTTGATGCTGG - Intergenic
1074200705 10:111232508-111232530 TAGGAAAGCCAGTTTGGAGCAGG - Intergenic
1078107665 11:8368737-8368759 ATGGGAAGTCACTTTGAAGCAGG - Intergenic
1078578100 11:12517999-12518021 AAGGAAAGTGACTGTGAAGCTGG + Intronic
1084514658 11:69630058-69630080 GAGGAATGTCACATTGATGAGGG - Intergenic
1087385412 11:97463223-97463245 TATGAAAGTCACTTTGGAACTGG + Intergenic
1087622336 11:100556457-100556479 ATGGAAAGCCACTTTAATGCAGG - Intergenic
1089009621 11:115121910-115121932 TAGAAAGGCCACTTTGATGGTGG + Intergenic
1090194295 11:124801138-124801160 TTGGAAAGTAACTTTTCTGCTGG - Intergenic
1090281866 11:125463211-125463233 CAGGAAAGTCACTTGAATCCGGG + Intronic
1092923994 12:13257601-13257623 TAGGAAATTCACTTCCAGGCAGG - Intergenic
1093946913 12:25119953-25119975 GAGGAAAGCCTCTTTGTTGCAGG + Intronic
1098404264 12:70107881-70107903 TAGGATAGGCACTTTCATGGGGG - Intergenic
1099382038 12:81967035-81967057 TAGGTGAGTGACTTTTATGCAGG - Intergenic
1099427234 12:82538440-82538462 TAGTAAAGTCAGGTTGATGTAGG - Intergenic
1100735761 12:97528530-97528552 TATGAAAATGACTTTGATTCAGG - Intergenic
1101180901 12:102217238-102217260 TAGGAAATATGCTTTGATGCAGG + Intergenic
1101326361 12:103719218-103719240 TATGAATGTGACATTGATGCAGG - Intronic
1102328435 12:112009751-112009773 TAGGAAAATCACTTGAACGCAGG + Intronic
1103673849 12:122640502-122640524 TGGGAAAGTCACTTGAATCCAGG - Intergenic
1104511784 12:129386044-129386066 TGGGACAGTCACTTTCCTGCTGG + Intronic
1105470211 13:20686998-20687020 TAAGAAAGTGACTTTTAAGCTGG - Intronic
1106692340 13:32131612-32131634 TAGGAAAGTCCCTGTAATGGGGG - Intronic
1109564154 13:64088872-64088894 TAGGCAAGTCACTTCAATGTTGG + Intergenic
1110870667 13:80449236-80449258 CAGGAAAATCGCTTTAATGCAGG - Intergenic
1111300982 13:86350023-86350045 TGAGGAAGTCACCTTGATGCTGG - Intergenic
1112662226 13:101523198-101523220 TAGGAAATTCAATTTATTGCTGG + Intronic
1112772658 13:102807889-102807911 TAGGAAAGTAACCTTGACGTAGG + Intronic
1116514311 14:45787201-45787223 TGGGAAAGACCCTTTGATGGAGG - Intergenic
1119078327 14:71667312-71667334 TAGGAAAGGCACTTTAGTCCTGG - Intronic
1119208991 14:72815792-72815814 AAGGAAACTGACCTTGATGCTGG - Intronic
1124847370 15:33304635-33304657 TAGGTAAATGACTTTTATGCTGG - Intergenic
1127679988 15:61284859-61284881 TAGGGAGGTCACCTTGATCCAGG - Intergenic
1127844368 15:62856709-62856731 TAGGAAAGTCAAAATGATGAGGG - Intergenic
1129409788 15:75343639-75343661 TTAGAAAATCACTTTGAGGCTGG + Intergenic
1130238538 15:82162956-82162978 TAGCAAAGTCACAGTGATTCAGG + Intronic
1130819261 15:87476893-87476915 TAGGCAACTCATTTTGATGTTGG - Intergenic
1133241891 16:4419293-4419315 TAGGAAAATCACTTTAATCCAGG - Intronic
1133508523 16:6435391-6435413 CAGGAGAATCACTTTAATGCGGG - Intronic
1133608330 16:7410132-7410154 TAGGAAAGTGACATTTATGTAGG - Intronic
1133622928 16:7543477-7543499 TGGGAAAGTCACCTTTATCCAGG - Intronic
1135251862 16:20907259-20907281 TTGGAAAGGCACTTTGTTTCTGG - Intronic
1135472149 16:22740691-22740713 TTGGGAAGTCACTTTTCTGCAGG + Intergenic
1135681769 16:24463387-24463409 TAGGAAAGTGACTTAGAGCCTGG + Intergenic
1137508554 16:49078210-49078232 TAGAAAAGTCACTTTTTTGTGGG - Intergenic
1139020425 16:62742351-62742373 TAGAAAAGTCAGTTTCAGGCCGG + Intergenic
1139873162 16:70123960-70123982 TAGGAAAATCACTTGAATCCAGG + Intronic
1140536637 16:75715787-75715809 TAGGAAAATCACTTGAATCCAGG - Intronic
1140768964 16:78185960-78185982 TGTTAAAGTCACTTTGAGGCCGG - Intronic
1144114738 17:12077004-12077026 TAGGAAAGTCATTCTGAGGCAGG + Intronic
1145971336 17:28958177-28958199 GGGGACAGTCACTTTGGTGCTGG - Intronic
1147697102 17:42363746-42363768 TATGAAAGTCACCTGGAGGCTGG - Intronic
1149797174 17:59531250-59531272 AAGGAAAGTGACTTTGAAGATGG - Intergenic
1150218570 17:63483497-63483519 AACGAAACCCACTTTGATGCTGG + Intergenic
1150432346 17:65128467-65128489 TAGGAGAATCACTTGGATCCAGG - Intergenic
1155773262 18:29726460-29726482 TACGAAAGTAACTTTGAAACTGG + Intergenic
1158872230 18:61699236-61699258 GAGGAAACTCACATTGATGAGGG - Intergenic
1162807010 19:13142874-13142896 CAGGAAAATCACTTGAATGCGGG + Intergenic
1164079009 19:21846626-21846648 GAGTAACATCACTTTGATGCTGG + Intronic
929738500 2:44577085-44577107 TAGGAAAGTCACTTTGATGCTGG + Intronic
931794041 2:65692514-65692536 AAGGAAAGTCTCTTTAATGGTGG + Intergenic
933068749 2:77832611-77832633 CAGGACAATCACTTTGTTGCAGG - Intergenic
935216589 2:100979854-100979876 TTGGAAAGTCAGTATTATGCAGG - Intronic
940284336 2:152018708-152018730 TAGGAGAATCACTTTGAGCCCGG + Intronic
943607189 2:189989705-189989727 TGGAAAAGTCTCTTTGATTCAGG + Intronic
943965338 2:194325920-194325942 TAAGAAACTCACCTTAATGCAGG + Intergenic
944373600 2:199013637-199013659 TAGGAAAGCCATTTTGAATCTGG - Intergenic
946617876 2:221529254-221529276 AAGGAAAGGGACTTTGCTGCAGG + Intronic
947095978 2:226567405-226567427 AATGAAAGTCACTGAGATGCAGG + Intergenic
947153827 2:227140679-227140701 TAGGAAGGACAGTTTGATGAGGG - Intronic
947371850 2:229455183-229455205 TAGGAAGGTCACTTAGAGGGTGG - Intronic
948441276 2:237991693-237991715 CAGGAAAGTCACTTGAATCCAGG - Intronic
948730644 2:239961681-239961703 TAGGAAAGTGAGTTTCATCCAGG + Intronic
948895601 2:240925511-240925533 TGGGAGAGCCACCTTGATGCTGG + Intronic
1169287788 20:4324098-4324120 CAGAAATGTCACTTTGGTGCAGG - Intergenic
1169742068 20:8905646-8905668 CAGGAAAGTCTCCTTAATGCTGG + Intronic
1170771233 20:19334561-19334583 TAAGACAGTCACATTGATGTTGG - Intronic
1175788213 20:61725017-61725039 CAGGAGAGTCACTTGGATGCAGG + Intronic
1177282277 21:18996772-18996794 TAGGAAAATCACTTTGTCTCTGG - Intergenic
1178174756 21:30083669-30083691 CAGAAAAGTCACTGTGATGCAGG - Intergenic
1178902670 21:36609827-36609849 TAGGAATGTGACTTTGAGGCTGG + Intergenic
1178970104 21:37166969-37166991 CAGGTAAGGCACTGTGATGCAGG - Intronic
1184031325 22:41896653-41896675 TAGGAAAGTGACTTTGGGGCCGG - Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950034519 3:9875853-9875875 TAACAAGGACACTTTGATGCAGG + Intronic
952488840 3:33845590-33845612 TAAGAAGGACACTTTGATGTAGG + Intronic
952549566 3:34461014-34461036 TTGGAAAGGCACTTTTATGTGGG + Intergenic
955249271 3:57262483-57262505 CAGGAAAATCACTTTAATCCAGG - Intronic
956004326 3:64762395-64762417 AAGGAAAGTCACTTTGAAAAAGG - Intergenic
957769162 3:84666448-84666470 TAGGTAAGTCATTTAGATGTAGG + Intergenic
959308615 3:104701094-104701116 AAGGATAGACAATTTGATGCAGG - Intergenic
959707306 3:109350033-109350055 TAGGAAACTTACTTTGATCAGGG + Intergenic
960083319 3:113564505-113564527 AAGGAGGGTCACTGTGATGCAGG + Intronic
960545269 3:118906925-118906947 TAGGAAATTCAATTGGATGAAGG + Intronic
961968061 3:130926660-130926682 TAGGAATGTCACATGTATGCAGG + Intronic
962697365 3:137963378-137963400 AAGGAAAGCCACAGTGATGCAGG + Intergenic
963430479 3:145195721-145195743 AAGGAAAGTGAATTTGATGCAGG + Intergenic
963882462 3:150544337-150544359 TAGGAAAGTCATTCTGAGGCAGG + Exonic
964093048 3:152898405-152898427 TAGGTCAGTCACTTCCATGCTGG - Intergenic
967720361 3:192809508-192809530 TAGGAAAGCCCATTTAATGCAGG - Intronic
969047951 4:4351802-4351824 TATGAAAAGCACATTGATGCAGG - Intronic
970420656 4:15903103-15903125 CAGGAAAATCACTTGAATGCAGG - Intergenic
970552191 4:17193455-17193477 GAGGAAAGTCTCTTTCATGCTGG - Intergenic
972889414 4:43537848-43537870 TAGGAAATTCTCTTTGAGGTAGG + Intergenic
973317077 4:48772999-48773021 AATGTAAGACACTTTGATGCTGG - Intronic
974539244 4:63211983-63212005 TTGGAAAGTCTCTTTGATCCAGG - Intergenic
977037728 4:91976237-91976259 CAGGAAAGTCACTTTAAAGGAGG - Intergenic
978921960 4:114194636-114194658 TAAGTGAGACACTTTGATGCAGG + Intergenic
978974172 4:114848442-114848464 TAAGGAAATCACTTTGATACTGG - Intronic
980730184 4:136813105-136813127 TAAGAAAATCACTTTTAGGCCGG + Intergenic
980839628 4:138241925-138241947 GAGGAAAGTCACTTTACTGAGGG - Exonic
983652726 4:170049640-170049662 CAGGAAAGTTACTTTGTTGTTGG + Intergenic
985289676 4:188375076-188375098 TGTGAAAGTCACTTTGGTGGAGG + Intergenic
987817210 5:22917990-22918012 TAGGACAATCACTTGGATACAGG - Intergenic
987959639 5:24789364-24789386 AAGGAAAGTCACTGTGAGTCAGG + Intergenic
990144950 5:52749525-52749547 TAGGCAAATAACTATGATGCAGG - Intergenic
990569175 5:57060591-57060613 TAGAAAGGTCATTTTGAGGCAGG - Intergenic
990658667 5:57987305-57987327 TTGCAAAATCAATTTGATGCAGG - Intergenic
993330475 5:86594051-86594073 TAATAAATTCACTTTCATGCAGG + Intergenic
993572255 5:89555689-89555711 TAAGAAAGTCAGATTGAAGCTGG - Intergenic
995354983 5:111226776-111226798 TAGGATACTCTCTCTGATGCTGG - Intronic
995940484 5:117576539-117576561 TAGGAAACTCACGTTCATGCAGG - Intergenic
996792555 5:127308216-127308238 TAACAAAGTCACTTTGATTTTGG - Intronic
998072531 5:139209382-139209404 TAGGAAAATCACTTGGACCCAGG + Intronic
998396973 5:141824992-141825014 TTGGAGGGTCACTTTGATGGAGG - Intergenic
1000303836 5:159977989-159978011 TAGGGAAGTCACTTTTAACCTGG - Intergenic
1010748237 6:79588458-79588480 CAGGAAAGGCACTTTTATTCTGG + Intergenic
1012858576 6:104531761-104531783 TCGGAAAGTTACTTTTATACTGG + Intergenic
1018950426 6:168375126-168375148 ATGGAGAGTCACTTTGATGGAGG - Intergenic
1019687763 7:2391116-2391138 AAGGGAAGTCACTTGGCTGCAGG - Intergenic
1022525324 7:31033464-31033486 TACAGAAGTCACTTTGAAGCAGG - Intergenic
1024151525 7:46576620-46576642 TATAAAAGTCATTTTGAGGCTGG + Intergenic
1024460926 7:49658671-49658693 TAGGAAAATCCCTTTGAGGAGGG + Intergenic
1026934060 7:74241865-74241887 TAGGAAAATCACTTGAATCCAGG + Intronic
1033578972 7:142714284-142714306 TAGGAAAGTCACCTCAATGTAGG + Intergenic
1033658711 7:143389672-143389694 CAGGAAATTCCCTTTGATGAGGG + Intronic
1035176612 7:157056416-157056438 TCGGAAAGTCACTTTGGAGGAGG - Intergenic
1035736524 8:1891461-1891483 TTGGAAAGTACCCTTGATGCTGG + Intronic
1036108121 8:5864285-5864307 CAGGAGAGTGACTTTGATGAAGG - Intergenic
1037264484 8:17043233-17043255 TAAAAAAATCACTTTGAGGCCGG - Intronic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1041080497 8:54210778-54210800 CAGGAAAGTCACTTGAATGCAGG - Intergenic
1049056787 8:140243152-140243174 TAGCAAAGACACTTTGATGCAGG + Intronic
1049070245 8:140350283-140350305 TATCAAAGTCACCTTGATGGAGG - Intronic
1058760711 9:108128895-108128917 CAGGATAGTCACTTTGCTGCTGG - Intergenic
1059958567 9:119543458-119543480 ATGGAAAGTCACTTTGTGGCTGG + Intergenic
1060346901 9:122825079-122825101 TGTGGAATTCACTTTGATGCAGG - Intronic
1060665202 9:125428493-125428515 TAGTCAAGACACTTTGATGCAGG - Intergenic
1061713387 9:132503123-132503145 TTGGAAAGTCACTTCGGGGCTGG + Intronic
1186320807 X:8422662-8422684 TGGGAGAGTGAATTTGATGCAGG - Intergenic
1187826542 X:23336734-23336756 AAAGAAAACCACTTTGATGCTGG - Intronic
1187845730 X:23534769-23534791 TAAAAAAGACACTTTTATGCTGG + Intergenic
1189240059 X:39517947-39517969 CAGGAAAGTCACTTGAATCCAGG - Intergenic
1192455746 X:71273965-71273987 TAGGAAAGTCACTTGAACCCGGG + Intergenic
1193108130 X:77701971-77701993 TAGGAAAGTCACTTGAACCCAGG + Intronic
1197153872 X:123249022-123249044 AAGGTAAGTCACTTTCATGCAGG + Intronic
1198206930 X:134474972-134474994 TGGGAAAATCACTTTAGTGCAGG - Intronic
1200781003 Y:7215638-7215660 CAGGAAAGTCACTTGAATCCGGG - Intergenic
1200820632 Y:7579140-7579162 TAGGACAGTCCCTTAGATACAGG - Intergenic
1202239675 Y:22753602-22753624 TAGGACAGTCCCTTAGATACAGG + Intergenic
1202392660 Y:24387364-24387386 TAGGACAGTCCCTTAGATACAGG + Intergenic
1202478122 Y:25282753-25282775 TAGGACAGTCCCTTAGATACAGG - Intergenic