ID: 929742531

View in Genome Browser
Species Human (GRCh38)
Location 2:44618339-44618361
Sequence ATGGATACTGAGCTTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929742529_929742531 -3 Left 929742529 2:44618319-44618341 CCAGGGAGCAAAGCTCAGAGATG 0: 1
1: 0
2: 1
3: 37
4: 246
Right 929742531 2:44618339-44618361 ATGGATACTGAGCTTTTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 148
929742526_929742531 20 Left 929742526 2:44618296-44618318 CCATCAGAGTCATTTTACGACAG 0: 1
1: 0
2: 0
3: 7
4: 66
Right 929742531 2:44618339-44618361 ATGGATACTGAGCTTTTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929742531 Original CRISPR ATGGATACTGAGCTTTTTGC TGG Intronic
901032142 1:6313375-6313397 CTGGCTTCTGAGGTTTTTGCTGG - Intronic
902803207 1:18844117-18844139 AGGGATACAAAGCTTTTTTCAGG + Intronic
904220351 1:28962537-28962559 ATGGGTACAGAGTTTCTTGCTGG - Intronic
905608971 1:39331884-39331906 CTGGAAGCTCAGCTTTTTGCTGG + Intronic
905747726 1:40433556-40433578 ATGGATACCAAGATCTTTGCAGG + Intergenic
907271250 1:53292588-53292610 TTGGATGCTGAGCTTCTTGTGGG - Intronic
911072037 1:93839733-93839755 ATTGATTCTGAGCTTTTTGATGG + Intronic
913001777 1:114587757-114587779 ATGGAAACTCAGATGTTTGCAGG - Exonic
914883761 1:151568304-151568326 ATGTATACTGAACATTTTACAGG - Intronic
914982457 1:152426570-152426592 ATGGAAACTGAGGACTTTGCAGG + Intergenic
915718675 1:157967503-157967525 ATGGGTTCTGAGCTTCTTGCTGG - Intergenic
917951823 1:180046205-180046227 ATGGTTACTGAGTTTCTTTCTGG - Intronic
920930898 1:210386850-210386872 ATGGACACAGAGCTTCTTGGGGG + Intronic
923618605 1:235558491-235558513 CTGGATACTGAGCTATTTGTTGG - Intronic
924050359 1:240074305-240074327 CTGGATACTGAGATGTTTGATGG + Intronic
924162681 1:241250084-241250106 ATTCATAATGAGCTTTTTACAGG + Intronic
924261425 1:242235423-242235445 ATATACACTGAGCTTTCTGCTGG - Intronic
1064506021 10:16030958-16030980 ATGGAGACTCAGATCTTTGCTGG + Intergenic
1065369183 10:24965644-24965666 ATGGATACTCAGTCCTTTGCAGG + Intergenic
1067120929 10:43471518-43471540 GTGGATCCTGAGCTTTTGTCTGG + Intronic
1070363996 10:75718066-75718088 ATGGATACTGATTTTTCTGAAGG + Intronic
1071251364 10:83823050-83823072 ATGGGAGCTGGGCTTTTTGCAGG + Intergenic
1071445572 10:85743157-85743179 AGGGTTACTGTACTTTTTGCGGG - Intronic
1072754099 10:98006567-98006589 ATTGATTTTGAGCTTGTTGCGGG - Intronic
1073622501 10:105063759-105063781 CTGGATTCTGAGCTCTTTGAAGG - Intronic
1075533368 10:123249388-123249410 AAGGATGCAGAGGTTTTTGCTGG + Intergenic
1084267347 11:68011842-68011864 ATGGATACTGAGCACTTCCCGGG + Intronic
1085887959 11:80542790-80542812 GTGGATTCTGAGCTATTTGAGGG + Intergenic
1086482880 11:87262328-87262350 ATGGATACTGCCTTTTTTGGAGG - Intronic
1086493401 11:87377949-87377971 GTGGATCCTGAGCTTTTGTCCGG + Intergenic
1087316112 11:96604675-96604697 GTGGATACTGAGGTCTTTGATGG + Intergenic
1091962533 12:4709889-4709911 ATGGAAACTGGGCTGTTGGCTGG + Intronic
1093575346 12:20721399-20721421 GTGAATAGTGATCTTTTTGCTGG - Intronic
1095515799 12:43003898-43003920 CTGGATACTGAGCTTAATACCGG + Intergenic
1097673947 12:62576340-62576362 ATGGGTACAGATCTTTTTGGGGG + Intronic
1100758604 12:97780230-97780252 GTGGATAATGATGTTTTTGCTGG - Intergenic
1104070530 12:125341419-125341441 ATATATACTAAGCATTTTGCAGG - Intronic
1105511552 13:21056081-21056103 ATGTGTACTGAGCATTGTGCTGG + Intronic
1107473745 13:40715069-40715091 CTGGATCCTGTGCTTTTTTCTGG + Intergenic
1107740282 13:43443420-43443442 AAGGATTCTGAGCTTTTGGAAGG - Intronic
1107868420 13:44725906-44725928 ATGTAAACTTAGCTTTTGGCTGG - Intergenic
1111949475 13:94699390-94699412 ATTGATGCTGAACTTATTGCAGG + Intergenic
1112818164 13:103298159-103298181 GTGGATACAGAGCTTTCTTCTGG + Intergenic
1114753291 14:25229765-25229787 AGGGAAAGTGAGCTTTATGCAGG + Intergenic
1115626212 14:35194741-35194763 GAGGCTACTGAGCTGTTTGCTGG - Intronic
1115890623 14:38023836-38023858 AGGGATAATGACCTTTTTGTGGG - Intronic
1117387571 14:55231392-55231414 CTGGGAACTGAGCTTTCTGCAGG + Intergenic
1117561850 14:56948434-56948456 TCAGATACTGAGCTTTGTGCTGG - Intergenic
1117840704 14:59857784-59857806 ATGGATTCTGGGATCTTTGCAGG - Intronic
1119030889 14:71191878-71191900 ATGGGTACAGAGTTTTTTTCAGG - Intergenic
1120177485 14:81310547-81310569 CTGGATACTCAGCTATTTGGAGG - Intronic
1122223358 14:100256711-100256733 ATGGGTATAGAGTTTTTTGCGGG + Intronic
1125604077 15:40930218-40930240 ATGCATCCTGGGCTTTTTGGGGG - Intronic
1126857854 15:52856322-52856344 AAGGATACTGAGCTTCTTTATGG + Intergenic
1129470354 15:75750334-75750356 ATGGATACAGGGCTTATGGCAGG + Intergenic
1130713726 15:86310954-86310976 TTGGACACTTAGCTTTATGCAGG + Intronic
1130875600 15:88011280-88011302 CTGGAGACTGAGCTTTCTGTTGG - Intronic
1133779848 16:8929449-8929471 ATGGAGGCTGAACTTTTGGCAGG + Intronic
1134421064 16:14090455-14090477 ATACATACTGAGCACTTTGCAGG + Intronic
1139685658 16:68601415-68601437 ATGGACACGAAGCTTTTTGGGGG + Intergenic
1141039984 16:80664800-80664822 ATGGAAACTGAGGTATATGCAGG - Intronic
1141295086 16:82760304-82760326 ATGAATTCTTATCTTTTTGCTGG + Intronic
1145036073 17:19541438-19541460 TTGGATAATGAGCTTATTTCTGG - Intronic
1145952195 17:28827398-28827420 CTGGATTGTGAGCTTTTTGTAGG - Intronic
1146198417 17:30832608-30832630 TTGGATTCTGAGATATTTGCGGG + Intronic
1146667442 17:34714616-34714638 AAGGAGACTGAGCTTTTCTCAGG - Intergenic
1146812364 17:35914243-35914265 CTGGATACTGAGCTTGGTCCTGG + Intergenic
1147214940 17:38893578-38893600 AAGGGTACTGCCCTTTTTGCAGG + Intronic
1147518531 17:41145250-41145272 TTGTATACTGAGAATTTTGCTGG + Intergenic
1151112060 17:71690106-71690128 AATGATACTGAGCTTTCTGGTGG + Intergenic
1152027325 17:77819480-77819502 ATGGGTGCTGAGCTGTTTCCAGG - Intergenic
1154996227 18:21642684-21642706 ATGGTTATTGAGCTTTTTGGAGG + Intergenic
1158784879 18:60698758-60698780 TTGTATACTGTGCTTTTTGGAGG + Intergenic
1160513899 18:79468024-79468046 ATGGTGAATGAGCTTTGTGCTGG + Intronic
1162959596 19:14118028-14118050 ATTGACACTGAGCGTTCTGCTGG - Intronic
1163223971 19:15942083-15942105 AAGGATATAGAGCTTTTGGCAGG - Intergenic
1165866729 19:38943980-38944002 ATGGATGCAGAGTTTTTTCCTGG - Intronic
1165950583 19:39472193-39472215 ATGGAGAGTGAGCATTTTGGGGG + Intronic
929709477 2:44251645-44251667 GTGAATCCTAAGCTTTTTGCTGG - Intergenic
929742531 2:44618339-44618361 ATGGATACTGAGCTTTTTGCTGG + Intronic
934589300 2:95531781-95531803 AAGGACACTGGGCTTTGTGCTGG + Intergenic
935009820 2:99123654-99123676 ATGGGTACAGAGTTTTTTGGGGG - Intronic
938594649 2:132775721-132775743 ATGGAAACTGAGGTGTTTGGGGG - Intronic
939161681 2:138597437-138597459 ATAGATACTGAACTTTCTCCTGG - Intergenic
941485079 2:166070266-166070288 ATGCACACGAAGCTTTTTGCAGG - Intronic
941827075 2:169911522-169911544 ATGCATACTGACTTTTTTGGGGG + Intronic
942594750 2:177582410-177582432 TTGGATACTCTGCTCTTTGCTGG - Intergenic
943253156 2:185556710-185556732 TTGGATCCTGAGCTATTTGGGGG - Intergenic
947005915 2:225510904-225510926 ATGGAGCCTGAACTTTTTCCCGG - Intronic
948110720 2:235453455-235453477 ATGGAAATTCAGCTCTTTGCTGG - Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1169420421 20:5454535-5454557 CTGGATCCTGAACTTTTTCCTGG - Intergenic
1169497424 20:6128833-6128855 AAGCATACTGAACTATTTGCTGG - Intergenic
1172720468 20:36996177-36996199 ATGGATACAGAGTTTTTTGGGGG - Intergenic
1174757228 20:53171649-53171671 ATTGATTCTGAGCTATATGCAGG + Intronic
1183139873 22:35927201-35927223 ATGGATACTTAGGATTCTGCTGG + Intronic
949913056 3:8930427-8930449 ATGGATACTGGGCTCTTTTCAGG + Intronic
951350712 3:21603726-21603748 ATGGATACTTAGCTAGTTGATGG + Intronic
954732745 3:52678411-52678433 TTGGAAATTGAGCTTTTTGTTGG - Intronic
954903831 3:54042927-54042949 AAGGATGCTGAGCTGTATGCAGG - Intergenic
955014438 3:55056048-55056070 TTGGATACTGACCCTTTTTCTGG - Intronic
955034253 3:55250859-55250881 ATGGATTCTCACCTTTTTCCAGG - Intergenic
956677168 3:71746750-71746772 ATGGGTCCAGAGCTTTTTGGGGG - Intronic
956978690 3:74612699-74612721 GTGGATACTGATCATTTTGGGGG + Intergenic
957447691 3:80336749-80336771 GTGGATATTGCCCTTTTTGCAGG + Intergenic
959671191 3:108979140-108979162 TTGGATACTGAACTTATTGAGGG - Intronic
961432868 3:126895670-126895692 ATGGAAACAGAGCTGGTTGCAGG + Intronic
963969187 3:151410423-151410445 ATGGATAATGAACTTCTAGCAGG - Intronic
971093029 4:23367374-23367396 TTGATTACTGAGCTTTTTGGAGG - Intergenic
971099989 4:23455559-23455581 ATGCAAGCTTAGCTTTTTGCAGG - Intergenic
975271014 4:72433225-72433247 ATGACTACTGAGCTTCTAGCTGG - Intronic
975871406 4:78782803-78782825 TTGGATGCTGAGCTTTTTGGGGG + Intronic
976690180 4:87860446-87860468 CTGGATACAGATCTTTTTTCTGG + Intergenic
979024675 4:115553846-115553868 ATGGATACTGGGCCATTTTCAGG + Intergenic
983394275 4:167173681-167173703 ATGGGTACTGTGCTTAATGCTGG + Intronic
983541770 4:168918957-168918979 ATGCATACTGAGCTATATGGGGG + Intronic
983817676 4:172152402-172152424 ATGTAGACTGAGCTTTCTCCAGG + Intronic
986734250 5:10656460-10656482 AGGGACACTGGGCTTTGTGCTGG + Intergenic
989770134 5:45135054-45135076 ATGGTTAATGAGCTTATTGTAGG + Intergenic
991431714 5:66554809-66554831 ATGAATACAGAGCTTGTTACTGG - Intergenic
1000640296 5:163694441-163694463 ATGGATACTAAGCTTAATGCTGG + Intergenic
1005145603 6:22686550-22686572 TTGGATAGTGAGCTCTTGGCTGG - Intergenic
1012767231 6:103383549-103383571 ATGAGTACTGAGCTTTTTTGGGG + Intergenic
1014941503 6:127445462-127445484 ATGAAAACTGATATTTTTGCAGG + Intronic
1015084365 6:129270770-129270792 ATGGATGCTGAGCTTATTCATGG - Intronic
1015925370 6:138304370-138304392 ATGGGTACTGCGTTTTTTGAGGG + Intronic
1017640372 6:156487830-156487852 ATGGCAACTGAGTTTTTTGTTGG + Intergenic
1020356224 7:7278503-7278525 AGGAATACTGAGTTTTTTCCAGG + Intergenic
1023411071 7:39889867-39889889 ATGCATACTGAGGTATTTGTGGG + Intergenic
1023728184 7:43165378-43165400 AAGGACACTGGGCTTTTGGCGGG + Intronic
1024808545 7:53179680-53179702 ATGCATACTGAGATTTTAGTTGG - Intergenic
1024928553 7:54644690-54644712 ATGAATAATTAGCTTTCTGCTGG + Intergenic
1027804878 7:82805787-82805809 GTGGACACAGAGCTTTCTGCAGG + Exonic
1030742384 7:113125352-113125374 ATGCAAACTGAGCTTTATGTTGG - Intergenic
1031500830 7:122513778-122513800 ATGGAGACTGAGATTGGTGCAGG - Intronic
1032232426 7:130086748-130086770 ATGGATATTTAGCTTGTTTCTGG + Intronic
1033939971 7:146640674-146640696 ATGGATACTGACTCTTTTACAGG - Intronic
1037606449 8:20441738-20441760 CTGGATACTCAGCTTATGGCAGG + Intergenic
1039105076 8:33981474-33981496 ATGGATGATGCGGTTTTTGCTGG - Intergenic
1039138051 8:34349747-34349769 AAAGATACTGAGCTTTTTTTTGG + Intergenic
1039500083 8:38009744-38009766 ATGGATGCTGGGCTTTGTACCGG - Intergenic
1042909895 8:73815807-73815829 ATGGATACCAAGGTTTTTCCAGG + Intronic
1044829624 8:96234578-96234600 ATTGACATTGAGCTTTTTGGGGG - Intronic
1046209621 8:111052442-111052464 ATGGGTACAGAGTTTTTTTCTGG - Intergenic
1047667989 8:127113428-127113450 ATGGACTCTGAGCTTCTTGAGGG + Intergenic
1049919092 9:346640-346662 ATGGATAATTAGCTGTTTTCAGG + Intronic
1051243100 9:15080879-15080901 AAGAAAACTGAGCTTTTTCCTGG - Intergenic
1053132510 9:35624659-35624681 ACAGATACTGAGTTTTTTACAGG + Intronic
1055798349 9:80001327-80001349 ATGCATAGAGAGTTTTTTGCTGG - Intergenic
1055849210 9:80605232-80605254 AAGGCTACTGAGCTTTGTCCTGG - Intergenic
1056920374 9:90782629-90782651 ATGTCTACTGAGCATTATGCAGG - Intergenic
1058825806 9:108774986-108775008 AAGGATACAGAGGTTCTTGCGGG - Intergenic
1188127977 X:26394438-26394460 ATCTATACTGTGCTTTATGCTGG - Intergenic
1188131528 X:26439769-26439791 ATGGATACTTAGCTTTTCATTGG + Intergenic
1195250286 X:103037316-103037338 ATAAATACAGAGCTTTTTGGTGG + Intergenic
1195915871 X:109934950-109934972 ATGGATACTGACCCTTTCCCAGG - Intergenic
1197976327 X:132169528-132169550 ATGAATAATGATTTTTTTGCAGG + Intergenic