ID: 929743965

View in Genome Browser
Species Human (GRCh38)
Location 2:44636176-44636198
Sequence CTATCCAAAAAGCTGGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929743960_929743965 8 Left 929743960 2:44636145-44636167 CCTGGAAGTGGAGAAATAAAGGT 0: 1
1: 0
2: 5
3: 23
4: 243
Right 929743965 2:44636176-44636198 CTATCCAAAAAGCTGGACTAAGG 0: 1
1: 0
2: 0
3: 7
4: 74
929743958_929743965 18 Left 929743958 2:44636135-44636157 CCATATTATACCTGGAAGTGGAG 0: 1
1: 0
2: 1
3: 9
4: 118
Right 929743965 2:44636176-44636198 CTATCCAAAAAGCTGGACTAAGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929743965 Original CRISPR CTATCCAAAAAGCTGGACTA AGG Intronic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
909133560 1:71768843-71768865 CTATCATAAGAGCAGGACTAGGG - Intronic
910309977 1:85812359-85812381 CTATCCAAAAATCAGGCCTGAGG - Intronic
912147572 1:106811739-106811761 CAATCCAATAAGCCTGACTATGG + Intergenic
917265910 1:173220703-173220725 CTATCTACAAATCTGGACGAAGG + Intergenic
918099894 1:181364258-181364280 CTATGGAAAAAGCTGGACAAAGG - Intergenic
923507078 1:234613233-234613255 CTATCAGAAAAGCAGGAATAAGG + Intergenic
1065118359 10:22504202-22504224 CTATCCACAAAGGTGGACGCTGG - Intergenic
1068959830 10:62855434-62855456 CTATGCAAAAATATGGAATAAGG - Intronic
1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG + Intergenic
1070417152 10:76201506-76201528 ATACCCAACAAGCTGGACAACGG - Intronic
1076222127 10:128742535-128742557 CTATCCAAATGGGTGGACAATGG + Intergenic
1078807807 11:14724092-14724114 CAAACAAAAAAGATGGACTAAGG + Intronic
1080203110 11:29696955-29696977 CTATCAAAACATCTGGAATATGG - Intergenic
1081630362 11:44685357-44685379 CTATCCCTAAACCTGGACTGTGG + Intergenic
1090893176 11:130945687-130945709 CGAACCAAAAAGATGGACTTTGG - Intergenic
1091792082 12:3277759-3277781 CCATCCAATAAGCTGGCCTCTGG - Intronic
1098858383 12:75680176-75680198 CTATCCAAAGAGAAGGACTAAGG + Intergenic
1109493431 13:63133744-63133766 ATATCCAACAAGCTAGACTTTGG - Intergenic
1112418457 13:99225971-99225993 CTATGAAAAAAGCAGGACAAAGG + Intronic
1113579284 13:111417477-111417499 CTGTCCAGACAGCTGGACTCCGG - Intergenic
1116668310 14:47807461-47807483 CTATCAAAATAACTGGTCTATGG + Intergenic
1118158972 14:63269977-63269999 CTATCCAAGAAATTGGGCTACGG - Intronic
1119538587 14:75423392-75423414 CTTCCCAAATAGCTGGACTATGG + Intergenic
1120881623 14:89418342-89418364 CTAGCCAAAAGGAGGGACTAAGG + Intronic
1121469092 14:94138142-94138164 TAATCCTAAAAGCTGGACTCAGG - Intergenic
1125615106 15:41004165-41004187 CTATCCACACAGCTGCACGAGGG + Intronic
1126431876 15:48594451-48594473 CTATCCTGAAATCTGCACTAAGG - Intronic
1138159076 16:54736466-54736488 CTTTCCAAACAGGTAGACTATGG - Intergenic
1149687599 17:58545682-58545704 CTATCCAATCAGCCGGACTCCGG + Intergenic
1153663823 18:7350438-7350460 CTATCCAAAAAGAAGGCCTCCGG - Intergenic
1155915832 18:31556351-31556373 CTATCAAAAATGCTGCACTTTGG + Intergenic
1156389853 18:36640098-36640120 ATACCCAAGAAGCTGGACTATGG - Intronic
1156964401 18:43073113-43073135 CTTTTCAGAAAGCTGGACTGTGG - Intronic
1158351399 18:56567974-56567996 CTATCTAAAAACCTGAACTTTGG + Intergenic
1164325964 19:24192053-24192075 CCATCCTGAAAGCAGGACTAAGG + Intergenic
1165286024 19:34842240-34842262 GAATCCAGAAAGCTGGTCTAGGG - Intergenic
1168237047 19:55070080-55070102 CCACCCATAAAGCTGGATTAGGG + Intronic
927641533 2:24848688-24848710 CTGTAGGAAAAGCTGGACTATGG - Intronic
929743965 2:44636176-44636198 CTATCCAAAAAGCTGGACTAAGG + Intronic
935916414 2:107956269-107956291 CTATGCAAAAATCTTGACAAAGG + Intergenic
941199743 2:162493159-162493181 CTCTCCAAGAAGCAGGGCTAGGG - Intronic
942829392 2:180221777-180221799 CTATTAAAAAAACTTGACTAGGG + Intergenic
945425468 2:209695258-209695280 CCATCCAAAAAGGTGGAACAAGG + Exonic
1168786339 20:543404-543426 CTCTGCAATAAGCTGGACTCCGG + Intronic
1169551780 20:6708459-6708481 CTCCCCAAAAAGCTGTACTTTGG - Intergenic
1172331762 20:34080318-34080340 CCAACCAAAAAGCTGGTCTAGGG + Intronic
1181044997 22:20210273-20210295 CCATCCAGCAAGCTGGACCATGG - Intergenic
951361579 3:21730880-21730902 GCATCCAAAATGCTGGAATAGGG - Intronic
953230022 3:41056199-41056221 CTACCTAAAAAGCTTGTCTAAGG - Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
957548435 3:81670908-81670930 CCATACAAAAAACTGGATTATGG - Exonic
960255170 3:115503976-115503998 TTCTCCAAAAAGCTGGACAGTGG + Intergenic
960830329 3:121840067-121840089 CCTTCCAAGAAGCTGGATTACGG - Intronic
975376757 4:73655063-73655085 GTATCCAAAAAGTTGTACTGAGG + Intergenic
976136188 4:81938497-81938519 ATATCCAAAATGCTGGAGTAGGG + Intronic
984195774 4:176657163-176657185 GTGACCCAAAAGCTGGACTAAGG + Intergenic
984511887 4:180688964-180688986 CTGTTCAAAAAGCTGGGCTGAGG + Intergenic
988587295 5:32518390-32518412 CTATCTAAAAAGCTTGACAAAGG + Intergenic
989135242 5:38147664-38147686 CTATTTAAGAAGCTGGACAATGG - Intergenic
989756934 5:44966510-44966532 ATAAGCAAGAAGCTGGACTATGG + Intergenic
991134782 5:63168538-63168560 CAATCCAAAAACCCAGACTATGG - Intergenic
996868406 5:128156790-128156812 CTTTCCAGAAAGCTAGACTGTGG - Intronic
998274002 5:140734586-140734608 CTGTCCAAGATGCTGGACCAGGG + Intergenic
1000878189 5:166666573-166666595 CCATCCAAAAGGCTGGAATGTGG - Intergenic
1002257101 5:177966056-177966078 CTAACCAGAAAGCTGGAGTCAGG - Intergenic
1008754471 6:54777741-54777763 CTACACAAAAAGATGGACCATGG - Intergenic
1017546991 6:155463011-155463033 CTCTCCAAAAGCCTGGAGTATGG + Intergenic
1020765761 7:12318600-12318622 ATTTCCAAAAAGCTGCATTAAGG + Intergenic
1028044455 7:86098413-86098435 CTATCCAAAAAATTAGATTATGG + Intergenic
1033257424 7:139814327-139814349 AGATTCAAAAAGCTGGACTCTGG + Intronic
1033786490 7:144737360-144737382 GAATCCAAAATGCTGGGCTAGGG + Intronic
1036518829 8:9471644-9471666 CTATCCAAAATAATGGTCTATGG - Intergenic
1039740015 8:40373970-40373992 GTATCCAAAAAGCAACACTATGG + Intergenic
1053415769 9:37945932-37945954 CTATCCAGAATTCTGGACAATGG + Intronic
1056376093 9:86012637-86012659 ATAGCCATAAAGCTTGACTATGG - Intronic
1189311820 X:40024476-40024498 TTCACCAAAAAGCTGCACTATGG + Intergenic
1195703165 X:107720133-107720155 TTTTCCTAAAAGCTGGAATAGGG - Intronic
1196711943 X:118771552-118771574 CTATCTGAAAAACTGGACTCAGG - Intronic
1197868896 X:131047029-131047051 CTTTCCCAAAAGCTGGACAGAGG + Intergenic
1198212203 X:134526795-134526817 CTCCCCAAATATCTGGACTATGG + Intergenic
1199698269 X:150359114-150359136 CTAAACAAAAAGCTGGGCTTAGG - Intergenic