ID: 929745214

View in Genome Browser
Species Human (GRCh38)
Location 2:44650162-44650184
Sequence TAGGGGTTTCAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 450}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929745214_929745225 24 Left 929745214 2:44650162-44650184 CCATGCTCCATCTGAAACCCCTA 0: 1
1: 0
2: 5
3: 67
4: 450
Right 929745225 2:44650209-44650231 TAGCTTCTGCTGTCAATCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929745214 Original CRISPR TAGGGGTTTCAGATGGAGCA TGG (reversed) Intronic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
902086502 1:13867010-13867032 TAGAGCTTTCGGAGGGAGCATGG - Intergenic
904868943 1:33604516-33604538 AAGGGGTTTGAGTTGGAGCCTGG + Intronic
905389422 1:37626664-37626686 TAGAGGCTCCAGATGGAGGATGG + Intronic
905788888 1:40779663-40779685 TACGTGTTTCAGGTGGAGCAGGG - Intergenic
906064161 1:42968311-42968333 TAGTGGGTTCAGATGGATGATGG - Intergenic
907492416 1:54816567-54816589 AACAGGTTTCAGAGGGAGCACGG - Intronic
907557771 1:55359517-55359539 TACAGGTTTCAGAGGGAACATGG + Intergenic
907580972 1:55572480-55572502 TAGAGTTTTCAGAGGGAACATGG - Intergenic
908239776 1:62179028-62179050 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
908382913 1:63613405-63613427 TAGAGCCTTCAGAGGGAGCATGG - Intronic
908467142 1:64407772-64407794 TGGAGGCTTCAGAGGGAGCATGG - Intergenic
909453319 1:75823048-75823070 TATAGGTTTCAGAGGGAGCATGG - Intronic
909804359 1:79856632-79856654 TAGGGACTTCAGAGGGATCATGG - Intergenic
909892482 1:81025142-81025164 TACAGATTTCAGAGGGAGCATGG - Intergenic
910345085 1:86227450-86227472 TGTGGGTTTCAGAGGGAGCATGG + Intergenic
911095748 1:94053673-94053695 TACAGGTTTCAGAGGGAGCATGG + Intronic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
912094695 1:106123886-106123908 TACAAGTTTCAGAAGGAGCACGG + Intergenic
912245294 1:107955832-107955854 TAGTGGTTCCTGATGGACCATGG - Intronic
913283443 1:117207301-117207323 TAGTGATTTCAGATGAAACAGGG + Intronic
914993554 1:152519130-152519152 TGGGGATTTTAGATGGAGCTAGG + Intronic
915503199 1:156334496-156334518 TAGAGACTTCAGAAGGAGCATGG + Intronic
915707155 1:157855641-157855663 TAGAGGCTTCAGAGAGAGCATGG - Intronic
916852718 1:168719867-168719889 TTCCAGTTTCAGATGGAGCAGGG - Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
917987126 1:180332127-180332149 TACAGGTTTCAGAGGGAGAATGG + Intronic
918359416 1:183740400-183740422 CATGGCTTACAGATGGAGCATGG + Intronic
920636061 1:207705004-207705026 TACAGGATTCAGAGGGAGCATGG - Intronic
920719050 1:208369914-208369936 TAGGGGTTGGGGATGGGGCAGGG + Intergenic
920771753 1:208892992-208893014 GAGGGGTTACAGCTGGAGGACGG + Intergenic
921540759 1:216411756-216411778 TAGAGGTTTCAGAAAGAGCATGG + Intronic
921999593 1:221462441-221462463 TAGGGGTTTGATTTGGAGAAAGG + Intergenic
923714220 1:236411329-236411351 TATGGGTCTCAGAGGGAGAATGG - Intronic
923889521 1:238196971-238196993 TCAGAGTCTCAGATGGAGCATGG + Intergenic
924493324 1:244561567-244561589 TACAGGTTTCAGAGGGAACACGG - Intronic
924874688 1:248089441-248089463 ATGGGGCTTGAGATGGAGCAGGG + Intronic
1062767738 10:78680-78702 TAGTGCCTTCAGAGGGAGCACGG + Intergenic
1063087399 10:2832181-2832203 TGGGGGCTTCAGAGGGAGCATGG - Intergenic
1065849775 10:29778078-29778100 TAGAGCCTTCAGAGGGAGCAGGG + Intergenic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1068128233 10:52867253-52867275 TAAAGGTTTCAGAAGGAGCATGG - Intergenic
1071855540 10:89620722-89620744 TAGGGGTTTCAAAAGGGGAAGGG - Intronic
1072154610 10:92713817-92713839 TAGAGCTTTCAGAGGGAGTATGG - Intergenic
1072516549 10:96188887-96188909 TCCGGGTTTTAGAGGGAGCATGG - Intronic
1074008185 10:109449658-109449680 TAGAGCATTCAGAGGGAGCATGG - Intergenic
1074839092 10:117330289-117330311 TTGGGGTTTTAGAGGTAGCAGGG - Intronic
1074999731 10:118786815-118786837 TAGGGCCTTCAGAGGGAGCGTGG - Intergenic
1075955656 10:126520719-126520741 TAGGGCCTTCAGAGGGAGCACGG - Intronic
1076193131 10:128496938-128496960 TTGGGCATTCAGATGGAGCTGGG - Intergenic
1076228217 10:128797982-128798004 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1076877073 10:133221187-133221209 GAGGGGTTTCAAGGGGAGCAGGG - Intronic
1077586943 11:3461043-3461065 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1079887891 11:26011708-26011730 TAGAGACTTCAGAGGGAGCATGG + Intergenic
1080847772 11:36041380-36041402 TGGGGGTCTCTGATGGAGGAAGG - Intronic
1080942703 11:36937795-36937817 TGTAAGTTTCAGATGGAGCATGG - Intergenic
1081322497 11:41708244-41708266 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
1081754535 11:45535222-45535244 TAGGTGTTTGAGCAGGAGCATGG - Intergenic
1082194076 11:49280750-49280772 TACAGGTTTCACAGGGAGCATGG - Intergenic
1082693043 11:56328405-56328427 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1083473839 11:62902750-62902772 TACGGGTTTCAGAAGGAGCACGG + Intergenic
1083859937 11:65414826-65414848 TATGGGTTGCAGAGGGAGCACGG - Intergenic
1084242942 11:67835075-67835097 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1084592879 11:70100527-70100549 TAGGGCCTTCGGAGGGAGCATGG + Intronic
1084830051 11:71761900-71761922 TAGGGCCTTCATAGGGAGCACGG + Intergenic
1086172548 11:83852083-83852105 TACAGGTTTCAGAGGGACCAGGG + Intronic
1086672077 11:89560291-89560313 TACAGGTTTCACAGGGAGCATGG + Intergenic
1087191289 11:95257241-95257263 TAGAGGTTTCAGAGGGAGCTTGG + Intergenic
1087394929 11:97585371-97585393 TACAGGTTTCAGAGGAAGCATGG - Intergenic
1088605988 11:111532593-111532615 TATAGGTTTCAGAGGGAGCAGGG + Intronic
1089374869 11:117986991-117987013 TGGGGGCTACAGGTGGAGCAAGG - Intronic
1089833254 11:121347754-121347776 CACAGGTTTCAGAGGGAGCACGG + Intergenic
1090781156 11:130007828-130007850 TAGAGGCTTCAGAGGGAACAGGG + Intergenic
1092044439 12:5419990-5420012 TATGGGATTCAGGTGAAGCATGG - Intergenic
1093348768 12:18071223-18071245 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1093573252 12:20693803-20693825 TACAGGTCTCAGAGGGAGCATGG + Intergenic
1093896449 12:24579975-24579997 GAGAAGTTTCAGATGGAGCATGG + Intergenic
1094101653 12:26770891-26770913 TAGAGCTTTCAGAGGGAACATGG - Intronic
1095885736 12:47186691-47186713 TACAGCTTTCAGAAGGAGCATGG + Intronic
1096505391 12:52089286-52089308 TACAGGTTTCAGAGGGAGCATGG - Intergenic
1098766750 12:74499983-74500005 TACAGGTTTCAGAGAGAGCAAGG - Intergenic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1099462171 12:82937242-82937264 TACAGGTTTCAGAGGGAGCATGG - Intronic
1099513535 12:83567749-83567771 TATGGGTTTCAGAAGAAGCATGG + Intergenic
1099561097 12:84174432-84174454 TAGGGATGCCAGATGCAGCAGGG - Intergenic
1099664304 12:85608136-85608158 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1100597051 12:96080799-96080821 TATGGCTTTCAGTGGGAGCATGG + Intergenic
1100616752 12:96236879-96236901 TAGGGCCTTCAGAGGGAGCGGGG - Intronic
1101319758 12:103663343-103663365 TAGAGCCTTCAGAGGGAGCATGG - Intronic
1101425599 12:104585784-104585806 TAGGGCCTTCAGAGGGAACACGG - Intronic
1102940260 12:116934964-116934986 CAGGGGTTAGAGATGGAGCTGGG - Intronic
1103087332 12:118071642-118071664 TGTGGGGATCAGATGGAGCAGGG + Intronic
1103498870 12:121384948-121384970 TAAGGGTTTCAGAATGAGGATGG + Intronic
1103845914 12:123902023-123902045 TAGAGCTTTCAGAGGGAGCATGG - Intronic
1104160644 12:126176948-126176970 TAATGCTTTCAGAGGGAGCATGG - Intergenic
1105540858 13:21315229-21315251 TACAGGTTTCAGAGGGAACATGG + Intergenic
1106082434 13:26511455-26511477 TGGGGGTTTTAGAGGAAGCAAGG + Intergenic
1106465161 13:30006916-30006938 CAGTGCTTTCAGAAGGAGCACGG + Intergenic
1107081224 13:36376876-36376898 TAAAGGCTTCAGGTGGAGCAAGG - Intergenic
1107445177 13:40464178-40464200 TACAGGTTTCACAGGGAGCATGG + Intergenic
1107710111 13:43142982-43143004 TAGGGCTTTCAGAGGGAGCGTGG + Intergenic
1107888906 13:44896918-44896940 TAGAGGTTTCCCAGGGAGCATGG - Intergenic
1108084081 13:46766797-46766819 TTGGGGTTTCGGATGAAGAAAGG - Intergenic
1108564277 13:51679755-51679777 TACAGCTTTCAGAAGGAGCATGG - Intronic
1109649757 13:65310356-65310378 AAGTGGTTCCAGATGGGGCAAGG - Intergenic
1110934931 13:81276131-81276153 TAGGGGTTTCAAAAGGAGAGGGG - Intergenic
1111345247 13:86944688-86944710 AAGTGGTTGCAGGTGGAGCATGG + Intergenic
1111394740 13:87650472-87650494 TTGGGGTTTGAGATGTACCATGG - Intergenic
1111618244 13:90689695-90689717 TAGGGGCTTTAGAGTGAGCACGG - Intergenic
1111801970 13:92992426-92992448 TAGCTGTTTCAGACGGGGCAAGG - Intergenic
1111806398 13:93044116-93044138 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1112201865 13:97284257-97284279 CAGGGGCTTCAGAGGGAGCGTGG - Intronic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1113159348 13:107362381-107362403 TACAGGTTTCAGAGGAAGCATGG - Intronic
1113216657 13:108048767-108048789 TAGAGGCTTCAGAGAGAGCATGG - Intergenic
1113615156 13:111675333-111675355 CAGGGGCTTCCGAGGGAGCAGGG - Intergenic
1113620623 13:111760246-111760268 CAGGGGCTTCCGAGGGAGCAGGG - Intergenic
1114402231 14:22420543-22420565 TACAGGTTTCAGAGGGTGCATGG + Intergenic
1114462124 14:22893092-22893114 TAGAGGGCTCAGATGCAGCACGG - Intergenic
1114473612 14:22980043-22980065 TAGGAGGTTCAGAGGTAGCAGGG - Intronic
1114944318 14:27659958-27659980 TACAGGTTTCAGAGAGAGCATGG + Intergenic
1114950710 14:27749038-27749060 TTCAGGTTTCAGAGGGAGCATGG - Intergenic
1116675135 14:47897216-47897238 TACAGGTTTTAGAGGGAGCATGG - Intergenic
1116751699 14:48894313-48894335 TAGAGCTTTCAGAGAGAGCATGG - Intergenic
1116808032 14:49512246-49512268 TGCAGGTTTCAGAGGGAGCATGG + Intergenic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1118507040 14:66424882-66424904 TAGAACTTTCAGAGGGAGCATGG - Intergenic
1119724711 14:76914972-76914994 TGGGGGTGTCAGGTGGAGGAGGG - Intergenic
1120117594 14:80637944-80637966 TAGGGTTTTCAGAGGGAGTCAGG + Intronic
1120238374 14:81919152-81919174 TACAGGTTTCAGAGGGAGAATGG - Intergenic
1120418790 14:84255481-84255503 TAGAGATTTCAGAGGGGGCATGG + Intergenic
1120419000 14:84258752-84258774 TCAGAGTTTCAGAGGGAGCATGG - Intergenic
1120713402 14:87816089-87816111 TAGGGCCTTCAGAAGGAGCTTGG - Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121454448 14:94029393-94029415 TAGCGCCTTCAGAGGGAGCATGG - Intronic
1121827555 14:97022877-97022899 TAGTGCCTTCAGAGGGAGCATGG - Intergenic
1121836357 14:97096083-97096105 TAGGGGTGACAGATGAAGCTGGG + Intergenic
1121961520 14:98264515-98264537 TACAGGTTTCAGAGGAAGCACGG + Intergenic
1122854711 14:104554542-104554564 TAGGCCTTTCAGAGGGAGGAAGG - Intronic
1124733367 15:32219654-32219676 TAGGAACTTCAGAGGGAGCATGG + Intergenic
1126672270 15:51127241-51127263 TAGAGTCTTCAGAGGGAGCACGG - Intergenic
1126922985 15:53548363-53548385 TCGGGCTCTCAGATGCAGCAGGG + Intronic
1127705026 15:61538144-61538166 TAGTGGTTGCTGATGGATCAAGG + Intergenic
1128355156 15:66921184-66921206 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1130302456 15:82690121-82690143 TATGGGTTTCAGAGGGAGCATGG + Intronic
1130877294 15:88025647-88025669 TATAGGTTTCAGAGGGAGGATGG + Intronic
1130981634 15:88815945-88815967 CATAGGTTTCAGAGGGAGCATGG - Intronic
1130986204 15:88846205-88846227 TTGGGGTGTCTGATGGGGCAAGG - Intronic
1131839293 15:96418346-96418368 TGGGGGTTGCAGGTGGAGAAAGG - Intergenic
1202954746 15_KI270727v1_random:69252-69274 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1132456684 16:27819-27841 TAGTGCCTTCAGAGGGAGCATGG + Intergenic
1133334446 16:4997739-4997761 TAGAACTTTCAGAGGGAGCACGG - Intronic
1133354386 16:5125285-5125307 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1133381779 16:5336933-5336955 TAGGGCTGTCAGATGCAGCCAGG - Intergenic
1133416791 16:5613126-5613148 GAGGGGCCTCAGTTGGAGCAGGG + Intergenic
1133623058 16:7544624-7544646 GAGAGCCTTCAGATGGAGCATGG + Intronic
1133884219 16:9810674-9810696 TAGAGCCTTCAGAGGGAGCAAGG + Intronic
1133955043 16:10435267-10435289 TTGAGGTTTCATAAGGAGCATGG + Intronic
1134020478 16:10918087-10918109 TGTGGGCTTCACATGGAGCAGGG - Intronic
1134328064 16:13225242-13225264 CAGAGCCTTCAGATGGAGCATGG + Intronic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1136709287 16:32222024-32222046 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136758623 16:32707395-32707417 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1136809485 16:33162984-33163006 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136815961 16:33273064-33273086 TAGGGTCTTCAGAGGGAGTATGG - Intronic
1137421632 16:48339914-48339936 CAGGGGTTTCAGAGGTAGCATGG + Intronic
1137631369 16:49948126-49948148 CATGGGTTTCAGATGGAGCATGG + Intergenic
1137759572 16:50929235-50929257 TAGAGTCTTCAGACGGAGCATGG - Intergenic
1138717015 16:59035428-59035450 TAGGGCCTCCAGATGGAGCACGG - Intergenic
1140120719 16:72080991-72081013 TGGGGGTTGCAGATGGGGAAGGG - Intronic
1140644813 16:77017963-77017985 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1141518159 16:84560034-84560056 TAGAGCTTCCAGAGGGAGCATGG - Intergenic
1141812878 16:86387840-86387862 TGGAGGCTTCAGAGGGAGCAGGG - Intergenic
1141867796 16:86762651-86762673 TAGGGGTTTGAGCTGGAGCTGGG - Intergenic
1203060777 16_KI270728v1_random:967723-967745 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1143352636 17:6299848-6299870 TACTGGTTCCAGAGGGAGCATGG - Intergenic
1143844978 17:9767178-9767200 TACAGGTTCCAGAGGGAGCAGGG - Intergenic
1145981936 17:29018007-29018029 ATGGGGTTTCAGAAAGAGCAGGG - Intronic
1148479901 17:47953255-47953277 TGGGGCTTTCTGCTGGAGCAGGG + Exonic
1148563325 17:48618721-48618743 AGGGAGTTTCACATGGAGCAAGG + Intronic
1150164071 17:62924716-62924738 TCCAGGTTTCAGAGGGAGCATGG + Intergenic
1150684423 17:67309135-67309157 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
1150976510 17:70093301-70093323 TAGAGGCTTCAGAAGGAGCAAGG - Intronic
1151588852 17:75029923-75029945 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1152108759 17:78345435-78345457 TGGGGGCTTCAGAGGGAGCACGG + Intergenic
1152307300 17:79528796-79528818 TAGAGTTTTCAGAGGGAGCACGG + Intergenic
1152960573 18:78014-78036 TAGTGCCTTCAGAGGGAGCATGG + Intergenic
1153642113 18:7166107-7166129 TATGGGTTTCAGCAGGAGCGTGG + Intergenic
1153748632 18:8207006-8207028 TACAGGTTTCAGAGGGGGCATGG + Intronic
1154447520 18:14447706-14447728 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1155047718 18:22117573-22117595 TAGAGCTCTCAGTTGGAGCATGG - Intergenic
1155598589 18:27516826-27516848 TATAAGGTTCAGATGGAGCAGGG + Intergenic
1155610593 18:27663035-27663057 TAGGAGTTTCAGAAGGGACAGGG - Intergenic
1155910703 18:31501513-31501535 AACTGGTTTCAGAGGGAGCATGG - Intronic
1156032676 18:32731039-32731061 TAAGTGTTTCCGATGGAGCAAGG - Intronic
1156080268 18:33326122-33326144 TAGGGGTTTCAGCTGGGGACAGG + Intronic
1156127309 18:33921663-33921685 TAGAGGTTTTTGAGGGAGCAGGG + Intronic
1156311366 18:35925314-35925336 TAGGGGTATAAAATGGAGCCAGG + Intergenic
1158218976 18:55130088-55130110 TAGAGATTTCAGAAGGAGTACGG + Intergenic
1158866574 18:61643515-61643537 TACAGGTGTCAGAGGGAGCATGG + Intergenic
1158963990 18:62607911-62607933 TACAGGTTTCAGAGGGAGCATGG - Intergenic
1159146607 18:64462509-64462531 TACTGGTTTCAGAGGGAGTATGG + Intergenic
1159438204 18:68445337-68445359 TAGAGCTTCCAGAGGGAGCACGG - Intergenic
1159674296 18:71262318-71262340 TACAGGTTTCAAAGGGAGCATGG + Intergenic
1159692446 18:71505668-71505690 TACTGCTTTCAAATGGAGCAAGG - Intergenic
1159910640 18:74142505-74142527 TAGAGCCTTCAGAGGGAGCACGG - Intronic
1159978645 18:74749088-74749110 TAGGGGTGGCAGATGAGGCAGGG + Intronic
1160037960 18:75318954-75318976 TAGAGGCTTCAGAGGGAGCATGG - Intergenic
1160038073 18:75319745-75319767 TAGAGGCTTTAGAGGGAGCATGG - Intergenic
1160929521 19:1563605-1563627 TTGGGGTCTCAGCAGGAGCAGGG + Intronic
1161454303 19:4362478-4362500 TTGGCGGTCCAGATGGAGCACGG + Intronic
1163496673 19:17649979-17650001 TACAGATTTCAGAGGGAGCATGG + Intronic
1163962592 19:20711216-20711238 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1164322948 19:24167048-24167070 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1164577805 19:29416299-29416321 TAGAGCTTTCAGAGGGAGCGTGG - Intergenic
1164976162 19:32574267-32574289 TACAGGTTTCAGAGGGAGTATGG - Intergenic
1165643925 19:37417185-37417207 TACAGGTTTCAGAGGGAGTATGG + Intronic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
1166172823 19:41043780-41043802 TACAGGTTTCAGAAAGAGCATGG + Intergenic
1166359900 19:42248719-42248741 TAGGGGGTGCAGGTGGGGCACGG + Exonic
1166811071 19:45515045-45515067 TAGGCATTTCAGGTGGATCAGGG - Intronic
1167565752 19:50255578-50255600 AAGGGGTTTCACATGGTGAACGG - Intronic
1167769899 19:51508582-51508604 TGGGGGTAGCAGAAGGAGCAGGG - Intergenic
1168137038 19:54359086-54359108 GAGGGGGTCCGGATGGAGCACGG + Intronic
1168161043 19:54510043-54510065 GAGGGGGTCCGGATGGAGCACGG - Intronic
1168271874 19:55254557-55254579 AAGGGGTGACAGATGAAGCATGG - Intronic
925264679 2:2558802-2558824 TAGGGCCTTCAGAGAGAGCATGG - Intergenic
925718950 2:6809968-6809990 CATGGGTTTGAGAAGGAGCATGG - Intergenic
926433774 2:12817530-12817552 CACAGGTTTCAGAGGGAGCATGG + Intergenic
927206461 2:20614217-20614239 TAGAGATTTCAGAGGGACCATGG + Intronic
927399677 2:22696520-22696542 TAGAGGACTCAGAGGGAGCATGG + Intergenic
929462069 2:42109769-42109791 TAGAGGTTACAGCTAGAGCAAGG - Intergenic
929745214 2:44650162-44650184 TAGGGGTTTCAGATGGAGCATGG - Intronic
930103404 2:47619947-47619969 TACAGGTTTCTGAGGGAGCATGG + Intergenic
931229285 2:60360450-60360472 AAGGAGTTTCACATCGAGCATGG + Intergenic
931446806 2:62333698-62333720 GAGGGATTTCATAGGGAGCATGG - Intergenic
932132409 2:69199853-69199875 TTGGGGTTTCTGAAGGAACATGG - Intronic
932226923 2:70048761-70048783 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
932312037 2:70750646-70750668 TAGAGCCTTCAGAGGGAGCACGG + Intronic
932999220 2:76901195-76901217 TAGGGGTTTGGGATGGGGGAGGG - Intronic
933445660 2:82377163-82377185 AAGTGGTTTCAGATGGAGATGGG + Intergenic
933461404 2:82591762-82591784 TAGGGGTTTTAGGTAGGGCAGGG + Intergenic
933698609 2:85238310-85238332 TAGGAGCTTCAGCTGGGGCAGGG + Intronic
934054311 2:88239332-88239354 TAGAGGTTTCGGAGGGAGCGTGG - Intergenic
934486629 2:94720456-94720478 TTCAGGTTTCAGAGGGAGCATGG + Intergenic
934578541 2:95419092-95419114 TAGAGCCTTCAGAGGGAGCAAGG + Intergenic
934600903 2:95657617-95657639 TAGAGCCTTCAGAGGGAGCAAGG - Intergenic
934662808 2:96152328-96152350 GAGGGGCATGAGATGGAGCAGGG + Intergenic
934724656 2:96608033-96608055 TACAGGTTTCAGATGAAGCTGGG - Intronic
935008148 2:99102122-99102144 TAGGGGTTACAAATCGATCATGG + Intronic
935233212 2:101117167-101117189 TACAGGTTTCAGAGGGAGCATGG + Intronic
935502597 2:103859405-103859427 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
936534277 2:113299768-113299790 TAGAGCCTTCAGAGGGAGCAAGG - Intergenic
936629247 2:114183242-114183264 TAGAGGCTTCAGAGGGAACACGG - Intergenic
937287430 2:120762182-120762204 TAGGGGTTTCTACTGGGGCAGGG + Intronic
937942586 2:127297461-127297483 TATGGGTGTCAGAAGGAGCATGG + Intergenic
938507467 2:131901432-131901454 TAAGGGTTTCAAAAGGAGAAGGG + Intergenic
938712335 2:133986147-133986169 TTGGGCCTTCAGAGGGAGCACGG - Intergenic
938842580 2:135177324-135177346 TAAGGGTTTCAAAAGGAGAAGGG + Intronic
940037302 2:149324266-149324288 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
940053159 2:149485377-149485399 AAAGGGTTGCAGATAGAGCAAGG + Intergenic
941857587 2:170246636-170246658 CAGAGGCTTCAGAGGGAGCATGG + Intronic
942115559 2:172726030-172726052 TACAGGTTTCAGAGGGAGCATGG - Intergenic
942487332 2:176453137-176453159 TGGGGGTGAGAGATGGAGCAAGG + Intergenic
942893460 2:181020210-181020232 TACAGATTTCAGAGGGAGCACGG - Intronic
943299518 2:186180354-186180376 TACGAGTTTCAGAGGGATCATGG - Intergenic
944395385 2:199260669-199260691 TCCGGGTTTCAGAGGCAGCAGGG + Intergenic
945132932 2:206594368-206594390 CAAGGCTTTCAGATGTAGCATGG - Intronic
945335551 2:208588619-208588641 TAGAGGTTTCAGAGGGAGCATGG + Intronic
946316027 2:218913157-218913179 TGGGGCCTTCAGAGGGAGCATGG + Intergenic
946701488 2:222418791-222418813 TACAGGTTTCAGAGGGAGCATGG - Intergenic
947069439 2:226270560-226270582 TAGTGGTTTCAAAGGGAGCATGG + Intergenic
947945623 2:234099447-234099469 TACAGGTTTCAGAGGAAGCACGG + Intergenic
947959345 2:234221911-234221933 TAGAGGTGTCAGAGGGAGTATGG - Intergenic
1168815359 20:733050-733072 TAGGGCTTTCAGAGAGAGCATGG + Intergenic
1169497955 20:6132916-6132938 TACAGGTTTCAGAGGGAGCAGGG + Intergenic
1170091793 20:12597215-12597237 TATCGGTTTCAGAGAGAGCATGG - Intergenic
1170161151 20:13312705-13312727 TAGGTGTTTCAGCTGGAGGTGGG - Intergenic
1170743937 20:19081670-19081692 TAAGGGGGTCAGATGGTGCAGGG - Intergenic
1172407802 20:34702490-34702512 TGGGGGTTTCAGATGAGGCTGGG + Intronic
1172839296 20:37892551-37892573 TAGGGGCTTCAGAGGGATGAGGG + Intergenic
1173414060 20:42840096-42840118 TATAGGTTTCAGAGGGAACATGG - Intronic
1173481150 20:43400477-43400499 TCCAGGTTTCAGAGGGAGCATGG - Intergenic
1173944259 20:46937887-46937909 CAGGGGTTTCAAAGAGAGCATGG + Intronic
1174727543 20:52878603-52878625 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1175373104 20:58505994-58506016 TACAGGCTTCAGAGGGAGCATGG + Intronic
1177006280 21:15676188-15676210 CAGGAGTTTCAGAGGCAGCATGG - Intergenic
1177864721 21:26499401-26499423 TAGGGATTCCAGAGGGAGTATGG + Intronic
1177943904 21:27443958-27443980 TACAGGTTTCAGAGAGAGCATGG + Intergenic
1178114368 21:29402096-29402118 TACAGATTTCAGAGGGAGCATGG + Intronic
1178734666 21:35138067-35138089 TACAGTTTTCAGAGGGAGCATGG - Intronic
1178738574 21:35175404-35175426 TAGAGGTTTCAGAGAGAGTATGG + Intronic
1179147281 21:38779193-38779215 TTGAGATTTCAGATGGAGAAAGG - Intergenic
1179588737 21:42390927-42390949 TATGGGTTTAAGAGGGAGTATGG + Intronic
1181089061 22:20459590-20459612 TTGGGGGTTCTGATGGATCATGG + Intronic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1181812866 22:25414798-25414820 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1181973600 22:26712447-26712469 TACAGGCTTCAGAGGGAGCATGG + Intergenic
1182053839 22:27334211-27334233 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1182491613 22:30676003-30676025 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1183269959 22:36855361-36855383 TGGAGGTTTCAGATGGATCCGGG - Intergenic
1183678098 22:39311007-39311029 TAGGGGTTTTGGATTGGGCAGGG - Intergenic
1184993342 22:48185063-48185085 TGGAGGTTTCAGAGGGAGCGTGG + Intergenic
949220647 3:1629722-1629744 TATAGGTTTGAGAGGGAGCATGG + Intergenic
949416395 3:3819443-3819465 TACAGGTTTCAGAGGGAGCATGG - Intronic
951348794 3:21579732-21579754 TACAGGTTTCAGAGGAAGCATGG - Intronic
952391342 3:32883388-32883410 GAGGGCCTTCAGAGGGAGCATGG - Intronic
953461773 3:43087132-43087154 TAGAGCCTTCAGAGGGAGCATGG + Intronic
953974976 3:47375590-47375612 GAGGGGTTGCAGATGGAGTGGGG - Intergenic
954089704 3:48274439-48274461 TAGGGGTATTAGGTGGAGGATGG - Intronic
955193169 3:56781198-56781220 TGCAGGTTTCAGAGGGAGCATGG + Intronic
956520209 3:70095458-70095480 AAAGGATTTGAGATGGAGCAGGG - Intergenic
957682877 3:83460289-83460311 TAGAGGTTTCACAGGGAGTATGG + Intergenic
958799995 3:98744184-98744206 TACAGTTTTCAGAGGGAGCATGG + Intronic
959620993 3:108398339-108398361 TACAGGTTTCAGAGGGAGCATGG + Intronic
960765670 3:121127408-121127430 TAGAGTCTTCAGAGGGAGCACGG - Intronic
962625786 3:137224545-137224567 TACAGGTTTCAGAGAGAGCATGG - Intergenic
962654714 3:137531508-137531530 TAGAGGCTTCAAATGGACCATGG - Intergenic
963422525 3:145078288-145078310 TAGAACTTTCAGAGGGAGCATGG - Intergenic
963464902 3:145666968-145666990 TTGGGGTTTCAAATGCAGAAGGG - Intergenic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
963941981 3:151104757-151104779 TAGAGGCTTCAGAGGGAGGATGG - Intronic
965044418 3:163557352-163557374 TAGTGTCTTCAGATGGAGCATGG - Intergenic
965075892 3:163975209-163975231 TAGGTGTTTCACTGGGAGCATGG + Intergenic
965458700 3:168933863-168933885 TACAGGTTTCAGAGGGAACATGG - Intergenic
965665294 3:171087398-171087420 TCGGGGTTCCAGCTGGAGAATGG + Exonic
966924847 3:184637706-184637728 GTGGGGTTGCAGGTGGAGCAAGG + Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967852568 3:194093339-194093361 TAGGGCTCTCGGGTGGAGCAAGG + Intergenic
968660437 4:1796607-1796629 GAGGGGCTTATGATGGAGCAAGG + Intronic
969002125 4:3990852-3990874 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
969079338 4:4606448-4606470 TGGAGGTTTCAGGGGGAGCACGG - Intergenic
969250894 4:5968054-5968076 TGGGTGTTTCTGATGGGGCAGGG + Intronic
969280772 4:6169473-6169495 TAGAGCTTTCAGAGAGAGCATGG + Intronic
969912634 4:10459785-10459807 TAGAGGGTTCAGAGGGAGCATGG + Intergenic
969995693 4:11310234-11310256 TATGGCTTTCAGATGGTTCATGG + Intergenic
970016274 4:11516129-11516151 TAGTGGTTTCAAAGGTAGCATGG - Intergenic
970307733 4:14750659-14750681 TAGGAGCTTCAGAGGTAGCATGG - Intergenic
970438789 4:16061759-16061781 TAGAGGCTTCAGAAGGACCATGG - Intronic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
970551526 4:17186388-17186410 TAGGTGGACCAGATGGAGCAGGG + Intergenic
970564252 4:17315969-17315991 TCGAGCTTTCAGAGGGAGCACGG - Intergenic
970638873 4:18041250-18041272 TACAGGTTTCAGAGGGAGAATGG - Intergenic
970858500 4:20675372-20675394 TAGAGCCTCCAGATGGAGCATGG + Intergenic
970992259 4:22225867-22225889 TACAGGTTTCAGAGGGAACATGG + Intergenic
971056142 4:22914956-22914978 TATAGGTTTCACAGGGAGCATGG + Intergenic
971561606 4:28085014-28085036 AGGGGGTTTCAGATGGAGATGGG - Intergenic
971751479 4:30655327-30655349 TACATGTTTCAGAGGGAGCATGG - Intergenic
973878998 4:55249867-55249889 CAGGGCCTTCAGAGGGAGCACGG + Intergenic
973973258 4:56236318-56236340 TAGGGCCTTCAGAGGGAACACGG + Intronic
974325680 4:60412238-60412260 TACAGGCTTCAGAAGGAGCATGG - Intergenic
974435213 4:61848313-61848335 TAGAGGCTTCAGAGGGAACATGG - Intronic
975928275 4:79486564-79486586 TAGAGGCTTCAGAGGGAACATGG + Intergenic
976647731 4:87402749-87402771 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
978483080 4:109216680-109216702 TAGAGGCTTCAGAGGGAGCATGG + Intronic
978995711 4:115149284-115149306 TAAGGATTTCAGAGGGAGTATGG + Intergenic
979162638 4:117483101-117483123 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
979163645 4:117497008-117497030 TAAAGTTTTCAGAGGGAGCATGG + Intergenic
979504316 4:121478534-121478556 TATGGCCTTCAGAGGGAGCATGG + Intergenic
980703947 4:136468146-136468168 TAGAGGTTTTGGAGGGAGCATGG - Intergenic
980845968 4:138325482-138325504 TACAGGGTTCAGAGGGAGCATGG - Intergenic
980971546 4:139572091-139572113 TATGGGTTTCAGTGGGAGCATGG - Intronic
981521596 4:145668094-145668116 TATAGGTTTCAGAGGGAGCATGG + Intergenic
982449200 4:155531936-155531958 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
982928122 4:161365957-161365979 TACAGGTTTCAGAGGCAGCATGG - Intergenic
983078463 4:163355138-163355160 TTCAGGTTTCGGATGGAGCATGG - Intergenic
983129415 4:163996879-163996901 TAGTGCTTTCAGAGTGAGCATGG + Intronic
983166235 4:164480421-164480443 TACAGGTTTTAGAGGGAGCAGGG + Intergenic
984213661 4:176880935-176880957 GAAGGGTTTCAGAGGAAGCATGG - Intergenic
984787372 4:183580795-183580817 TAGGGGGTTGGGAGGGAGCAGGG - Intergenic
984938383 4:184909721-184909743 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
985121705 4:186649665-186649687 TAGCGCTTTCAGAGGGAGCCAGG + Intronic
986847803 5:11776040-11776062 TAGAGCCTTCAGAGGGAGCATGG + Intronic
987071739 5:14343411-14343433 CAGGGGTTAGAGATGGAGCAGGG - Intronic
987363594 5:17128639-17128661 AAGGGGTTTCTGATGGGACAAGG - Intronic
987956494 5:24748216-24748238 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988173182 5:27685436-27685458 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
988456867 5:31394514-31394536 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
990151968 5:52828793-52828815 TAGAGGCTTCAGAAGGAGTATGG - Intronic
990660396 5:58007562-58007584 TACAGGTTTCAGAGGGAGTATGG + Intergenic
991032370 5:62096069-62096091 TACAGGTTTCAGAGGCAGCACGG - Intergenic
991897157 5:71415496-71415518 TAGGGTTTAAAGATGGAGCGGGG - Intergenic
991939609 5:71838088-71838110 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
993091379 5:83430675-83430697 TAGGAGTGTCAGGTGGAGGAAGG - Intergenic
993349984 5:86838233-86838255 TACAGGTTTCAGAGAGAGCATGG - Intergenic
993509883 5:88758006-88758028 AAGGTGTTACAGATGGAGCCAGG - Intronic
993841750 5:92889045-92889067 TAGAGCATTTAGATGGAGCATGG + Intergenic
995492113 5:112704539-112704561 TACAGGTTTCAGAGGGAACATGG - Intergenic
997799466 5:136845222-136845244 CAGAGGCTTCAGAGGGAGCATGG + Intergenic
998545579 5:143024499-143024521 TAGGGGTTAAAGATGTAGCCAGG - Intronic
998945240 5:147331904-147331926 GAGAAGTTTCAGAGGGAGCATGG + Intronic
999359827 5:150974143-150974165 TAGAGCTTTCAGGGGGAGCATGG - Intergenic
1000393319 5:160747651-160747673 TAGAGGCTTCAGAGGGGGCATGG + Intronic
1003412038 6:5874120-5874142 TACAGATTTCAGAGGGAGCATGG - Intergenic
1004567170 6:16808679-16808701 TGGAGGCTTCAGAGGGAGCATGG - Intergenic
1007307064 6:40915193-40915215 TAGGGTCTTCAGAGAGAGCATGG - Intergenic
1007413822 6:41680389-41680411 ATGGGCTTTGAGATGGAGCACGG + Intergenic
1007545584 6:42691383-42691405 TTGGGTTTTAAGATCGAGCAAGG + Exonic
1007790824 6:44307189-44307211 TGGGGGTCTCAGGTGGAGGAGGG - Intronic
1008010862 6:46466273-46466295 TTTGGTTTTCAGATGGGGCATGG + Intronic
1008642173 6:53475258-53475280 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1008664203 6:53699926-53699948 TAGGGGTCTAAGATGGGGAAGGG + Intergenic
1009516566 6:64626686-64626708 TAGAGTTTTCAGAGGGAACATGG + Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009969926 6:70615382-70615404 TTCAGGTTTCAGAGGGAGCATGG - Intergenic
1010275282 6:73961967-73961989 TAGAGGGTTCAGAGTGAGCATGG + Intergenic
1010686264 6:78858065-78858087 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1010794248 6:80100979-80101001 TACAGGTTTCAGAGGGCGCATGG + Intergenic
1010977214 6:82329412-82329434 TACAGGTTTCAGAGGGAGCATGG + Intergenic
1011278896 6:85657113-85657135 GAAAGGTTTCAGAGGGAGCATGG - Intergenic
1011555298 6:88566753-88566775 AAAGGGATTCTGATGGAGCATGG - Intergenic
1011591561 6:88975043-88975065 TAGAGCTGTCAGAGGGAGCACGG + Intergenic
1013041497 6:106438439-106438461 TAGAGCCTTCAGAAGGAGCACGG - Intergenic
1013398578 6:109768923-109768945 CTGGGTTTTCAGAGGGAGCATGG - Intronic
1014723656 6:124950048-124950070 TACAGGTTTCAGAGGGAGCCTGG + Intergenic
1014760308 6:125348920-125348942 TAGAGCCTTCAGAGGGAGCAAGG + Intergenic
1014813623 6:125911588-125911610 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1014913027 6:127116961-127116983 TAGGGATTACAAATGGAGGAAGG + Intergenic
1015286627 6:131492600-131492622 TATGAGTTTCAGAGGGAACATGG + Intergenic
1015568839 6:134601370-134601392 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1016697797 6:147018026-147018048 TCCAGGTTTCAGAGGGAGCATGG - Intergenic
1016861060 6:148719250-148719272 TAGAGGTTACAGGTGGAGAAGGG + Intergenic
1016942099 6:149490973-149490995 TAGAGGCTTCAGAGCGAGCATGG + Intergenic
1018003468 6:159599749-159599771 TAGAGGATTCAGAGGGAGCATGG - Intergenic
1018041175 6:159923335-159923357 TAGTGCTTTCAGAATGAGCATGG + Intergenic
1018691194 6:166345460-166345482 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1019272207 7:156638-156660 CAGAGGGTACAGATGGAGCAGGG - Intergenic
1019455308 7:1123729-1123751 GAGGGTTTTCAGATGGAGTGTGG - Intronic
1020508297 7:9020414-9020436 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1020847707 7:13307842-13307864 TAGACCATTCAGATGGAGCATGG + Intergenic
1021642698 7:22755438-22755460 TATAGGTTTCAGAGGGAGCATGG + Intergenic
1022060187 7:26785741-26785763 TTTGGGTATCAGATGGAGCCAGG - Intronic
1022304098 7:29130001-29130023 TACAGGTTTCAGGAGGAGCATGG + Intronic
1022454352 7:30545553-30545575 TAGGGGTTGCAGAAGGATGAAGG - Intronic
1022499876 7:30876115-30876137 TATGGGTTTCAGAGGGAGCATGG - Intronic
1023082883 7:36542279-36542301 TGGAGCTTTCAGAGGGAGCATGG + Intronic
1023170645 7:37387312-37387334 TAGTGCTTTCAGAGGGAGCAGGG - Intronic
1024556053 7:50604495-50604517 TGGGGTCTTCAGATGGGGCAAGG - Intronic
1026708470 7:72715845-72715867 TAGGGGTTCCTCATGGAGCTTGG + Intronic
1027225552 7:76241401-76241423 CAGGGGTCTCAGATGGAAAAGGG + Intronic
1028135192 7:87217806-87217828 AATGGGTTTCAAATGGATCATGG + Intronic
1028954071 7:96669024-96669046 CACAGGTTTCAGAGGGAGCATGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030393187 7:108952571-108952593 TGCAGGTTTCAGAGGGAGCATGG + Intergenic
1030883663 7:114913164-114913186 TAGGGCCTCCAGATGGAGGATGG - Intergenic
1031653352 7:124319889-124319911 TCGGGGTTTAATAGGGAGCAGGG + Intergenic
1031923745 7:127619676-127619698 TAGGGGTATCAGGGGGAGCAGGG + Intergenic
1032365243 7:131292668-131292690 TGCAGGTTTCAGAGGGAGCATGG + Intronic
1032757104 7:134901671-134901693 TACAGGTTTCAGAGGGAGCATGG - Intronic
1032797148 7:135287132-135287154 TAGGTGTTTCAGGTTGAGCTGGG + Intergenic
1033086317 7:138345267-138345289 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1033947298 7:146736221-146736243 CTGGAGTTTCATATGGAGCAGGG + Intronic
1034175235 7:149094428-149094450 TAGGGGTTACAGATATAGGAAGG - Intergenic
1034404745 7:150895982-150896004 TAGAGGTTGCAGAAGGAGCGTGG + Intergenic
1034842878 7:154415843-154415865 CAGGGATTTCAGATGAAGCAAGG + Intronic
1034950024 7:155290789-155290811 TAGGGCTCTCACAGGGAGCAGGG - Intergenic
1036179770 8:6574256-6574278 TATAGGTTTCAGAGGGAGCATGG - Intronic
1036375086 8:8193088-8193110 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1036854455 8:12230060-12230082 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1036875815 8:12472560-12472582 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1038417635 8:27408927-27408949 TATGGACTTCAGAGGGAGCAGGG - Intronic
1039004969 8:33025864-33025886 TTGGGGATTCAGATGGATAAAGG - Intergenic
1039328628 8:36512541-36512563 TAGAGGCTCCAGAGGGAGCACGG + Intergenic
1039518438 8:38152044-38152066 TAGGGGTCTGTGCTGGAGCAAGG + Intergenic
1039566862 8:38558118-38558140 AAGGGGTTTCATAGGGAGAAAGG + Intergenic
1039575167 8:38617594-38617616 TAGAGGCTTCAGAGGGAACATGG - Intergenic
1041324796 8:56652742-56652764 TGTGGGTTTCAGATGGAGCTTGG + Intergenic
1042101605 8:65280681-65280703 TAGAAACTTCAGATGGAGCATGG - Intergenic
1042168461 8:65970007-65970029 CAGAGGTTTCAGCGGGAGCATGG + Intergenic
1042469212 8:69163879-69163901 TACAAGTTTCAGAAGGAGCATGG + Intergenic
1043832697 8:85008907-85008929 TGCAGGTTTCAGAGGGAGCATGG + Intergenic
1044785611 8:95789192-95789214 TAGAGGCTTCAAAGGGAGCATGG + Intergenic
1045270008 8:100653599-100653621 TAGAGCTTTCAGAGAGAGCACGG + Intronic
1045531501 8:102989418-102989440 TAGGGGTGTGAGATGGGGGATGG - Intergenic
1046259793 8:111752442-111752464 TAGGTGTGTCAGATAGAGCATGG + Intergenic
1046688105 8:117249599-117249621 AAGAGCTTTCAGATGGACCATGG - Intergenic
1047221738 8:122924198-122924220 TAGAGGCTTCAGAGGGAGCACGG - Intronic
1047388016 8:124427385-124427407 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1048018044 8:130514833-130514855 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1048048361 8:130794150-130794172 TAGAGCCTTCAGAGGGAGCAGGG + Intronic
1048253148 8:132883923-132883945 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1048512612 8:135076355-135076377 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1049343226 8:142124861-142124883 TGGGAGCTTCAGAGGGAGCAAGG + Intergenic
1050831597 9:10020657-10020679 AAGAGTTTTCAGATGAAGCAAGG - Intronic
1050831694 9:10021781-10021803 AAGAGTTTTCAGATGAAGCAAGG - Intronic
1051218457 9:14823541-14823563 ACAGGGTTTCAGAAGGAGCATGG + Intronic
1051621751 9:19057408-19057430 TAGTGGCTTCAGAGGGAACATGG + Intronic
1052041277 9:23741775-23741797 TAGGGCTTTCAAAGGGAGAAAGG - Intronic
1052528786 9:29655743-29655765 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1053001712 9:34580372-34580394 AAGGGGCTTAAGATGGAGCTGGG - Intronic
1053079562 9:35162986-35163008 TTGGGGTTTAAGATGAGGCATGG + Intronic
1053180722 9:35966780-35966802 CAGGGGTTACAGATGGGGAAGGG - Intergenic
1053671164 9:40363836-40363858 TTCAGGTTTCAGAGGGAGCATGG - Intergenic
1053920975 9:42990216-42990238 TTCAGGTTTCAGAGGGAGCATGG - Intergenic
1054382281 9:64503910-64503932 TTCAGGTTTCAGAGGGAGCATGG - Intergenic
1054513450 9:66012464-66012486 TTCAGGTTTCAGAGGGAGCATGG + Intergenic
1055820428 9:80255023-80255045 TAGGGCCTCCAGATGGAGCATGG + Intergenic
1055847945 9:80590494-80590516 TAACAGTTTCAGATGCAGCAAGG + Intergenic
1056343581 9:85665383-85665405 TCCAGGTTTCAGAGGGAGCATGG + Intronic
1057055621 9:91958385-91958407 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1058651438 9:107178821-107178843 TAGAGGTGTCAGAGGGAGCATGG - Intergenic
1058729240 9:107834122-107834144 TAGAGGATCCAGATAGAGCATGG - Intergenic
1060521724 9:124297868-124297890 TAGGGGGTTCAGATGCAGAAAGG - Intronic
1061224215 9:129271354-129271376 TAGAGGTTTCAGAGGAGGCACGG - Intergenic
1062737521 9:138145691-138145713 TAGTGCCTTCAGAGGGAGCATGG - Intergenic
1186373695 X:8974036-8974058 TAAGAGTTTCAGATAGAGGATGG + Intergenic
1186375711 X:8997485-8997507 TACAGGTTTCTGAGGGAGCAAGG + Intergenic
1186666169 X:11719868-11719890 TAGGTGCTTCGGAAGGAGCATGG + Intergenic
1186782734 X:12929668-12929690 TATAGGTTTCAGAGGGAGCGTGG - Intergenic
1188946007 X:36303121-36303143 TACAGGTTTCAGAAGGAGCATGG - Intronic
1190047105 X:47121235-47121257 GACAGGTTTCAGAGGGAGCACGG - Intergenic
1190372218 X:49753604-49753626 TAGAGATTTCAGAGGGAGCATGG + Intergenic
1190746443 X:53325759-53325781 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1191026385 X:55918593-55918615 TAGAGGTTTTCGATGGAGCATGG - Intergenic
1191997882 X:67115930-67115952 TACGTGTTTCAAAGGGAGCATGG - Intergenic
1193199608 X:78673087-78673109 TAGAGCTTTCAGAGGGAACATGG + Intergenic
1194305867 X:92247562-92247584 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1194979757 X:100428309-100428331 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1198176763 X:134164071-134164093 TAGAGCTTTCAGAGGGAACATGG + Intergenic
1198344542 X:135746803-135746825 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1199519699 X:148721767-148721789 TAGGGGCTTCAAATGGACCATGG - Intronic
1200399678 X:156011904-156011926 TAGTGCCTTCAGAGGGAGCATGG - Intergenic