ID: 929746236

View in Genome Browser
Species Human (GRCh38)
Location 2:44662024-44662046
Sequence TACAGCTGTCCCAAATCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929746236_929746239 -9 Left 929746236 2:44662024-44662046 CCTCATGATTTGGGACAGCTGTA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 929746239 2:44662038-44662060 ACAGCTGTAATTATTGGGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929746236 Original CRISPR TACAGCTGTCCCAAATCATG AGG (reversed) Intronic
902785902 1:18732569-18732591 TCCAGCTATCCCAAACAATGTGG - Intronic
907387365 1:54134683-54134705 AACAGGTGTCACAAATCAGGAGG + Intronic
908954257 1:69601870-69601892 TTCAGCTGTCCCAAAGCAGCAGG - Intronic
917187583 1:172377727-172377749 TACTGTAGTCCCAAATCATGAGG + Intronic
918873397 1:190006641-190006663 TACAGCTGTCCCCAATTTTTTGG - Intergenic
920493004 1:206432833-206432855 TACAGTTGTGCAAAATCATCTGG + Intronic
923612518 1:235507356-235507378 TACAGCTGTCTCTACTCATGGGG + Intergenic
1067375638 10:45726048-45726070 TACAGCTGCCTCAAATCTTTGGG - Intergenic
1067883350 10:50066737-50066759 TACAGCTGCCTCAAATCTTTGGG - Intergenic
1068908913 10:62357692-62357714 TACAGCTGTCCCTTTTCAGGTGG - Intergenic
1069759074 10:70795450-70795472 TACAGATGTCCCAAACCACCAGG - Intergenic
1070016903 10:72542696-72542718 GGCAGCTGTCCCACATAATGAGG - Intronic
1071673867 10:87637015-87637037 TACAGCTGTCCACATTCAGGTGG + Intergenic
1071984001 10:91032559-91032581 TGCAGCTGTGCCAAGTGATGAGG - Intergenic
1071999884 10:91185024-91185046 TACAGCTGTTCTAAAAAATGTGG - Intronic
1073870580 10:107859153-107859175 TACATCTGTCACAGGTCATGTGG + Intergenic
1074791118 10:116888639-116888661 TCCAGCTTTTCCAAATCCTGGGG - Intronic
1076806468 10:132861604-132861626 TATTTCTGTCCCAGATCATGTGG - Intronic
1078274646 11:9831679-9831701 TACAGCTGTCCCATATTCTGAGG - Intronic
1079093182 11:17494728-17494750 TACAACTTTCCCAAAACATTAGG - Intronic
1081116341 11:39206141-39206163 TAAAGCTGTACCAAATGCTGAGG + Intergenic
1082068213 11:47917874-47917896 AACAGCTGGCCAAAATCAGGCGG + Intergenic
1082160967 11:48887282-48887304 TGTAGCAGTCCCAAATCATAGGG + Intergenic
1082161399 11:48893124-48893146 TGTAGCAGTCCCAAATCATAGGG - Intergenic
1082166986 11:48961573-48961595 TGTAGCAGTCCCAAATCATAGGG - Intergenic
1082236595 11:49825053-49825075 TGTAGCAGTCCCAAATCATAGGG + Intergenic
1082610080 11:55284860-55284882 TGTAGCAGTCCCAAATCATAGGG + Intergenic
1085735598 11:79036372-79036394 ACCAGCTATCCCAAATCTTGAGG - Intronic
1088565705 11:111170484-111170506 TACAGCTGTCCCAGGCCCTGTGG - Intergenic
1088907278 11:114164339-114164361 TCTAGCTGTGCAAAATCATGTGG - Intronic
1090595185 11:128313538-128313560 TACAGTTGTCCCACCTCATCAGG + Intergenic
1091182376 11:133618549-133618571 TAAATCTGACCCAAATCATTAGG + Intergenic
1093385981 12:18554207-18554229 CACAACTATGCCAAATCATGTGG + Intronic
1095939473 12:47716666-47716688 AACAGCTCTTCCAAAACATGAGG - Intronic
1097353282 12:58572468-58572490 TATAGCTGTCCCAAAATTTGAGG + Intronic
1104220585 12:126780687-126780709 AACAACTGTCCCAAATCCAGAGG - Intergenic
1111093730 13:83481553-83481575 TACAGCTCTCCAAAATCATTTGG + Intergenic
1112596421 13:100811874-100811896 TACAGCTGTAACAAGGCATGGGG + Intergenic
1114228007 14:20756238-20756260 TACAGCTGTGCCAGACCTTGTGG + Intergenic
1118473627 14:66097654-66097676 TTCAGCTTTCCCAAAACAAGTGG - Intergenic
1119187946 14:72657460-72657482 AACAGCTTTCCAAAATCTTGTGG + Intronic
1122618531 14:103038480-103038502 TGCAGCTATACCCAATCATGTGG + Intronic
1125663884 15:41415583-41415605 TACCCCTATCCCAAATCCTGGGG + Intronic
1126985937 15:54308156-54308178 GACAGGTGTCCGAAATCATACGG - Intronic
1127954187 15:63838316-63838338 TACAGCTGGACAAAATCATCTGG - Intergenic
1128798756 15:70483479-70483501 CACGGCAGTCCCAAAGCATGAGG - Intergenic
1132195094 15:99908798-99908820 TACAGCTGGACAAAATCATCTGG - Intergenic
1138141386 16:54571612-54571634 TCGACCTGTCCCAATTCATGTGG + Intergenic
1138166349 16:54805282-54805304 TACAGCTGTGCAAAATCGTCTGG + Intergenic
1140920188 16:79530333-79530355 TTCAGCTGTCCCAACACATCAGG + Intergenic
1144026791 17:11284487-11284509 TATTGCTGCCCCAAATAATGTGG + Intronic
1144625448 17:16842112-16842134 TGCAGCTGTCCCAGATCCAGGGG - Intergenic
1145151250 17:20513778-20513800 TGCAGCTGTCCCAGATCCAGGGG - Intergenic
1146162599 17:30568035-30568057 TGCAGCTGTCCCAGATCCAGGGG - Intergenic
1147579599 17:41620808-41620830 TGCAGCTGTCCCAGATCCAGGGG - Exonic
1147640187 17:41992698-41992720 TGCAGCTGTCCCTAGTCATGGGG - Intronic
1148571239 17:48671060-48671082 TACAGTTCTCCCAAATAATCAGG + Intergenic
1151071833 17:71222863-71222885 TACAGCCGTCTCAAAACATTAGG - Intergenic
1151788593 17:76289141-76289163 TTCAGCTGAGCCAAATAATGAGG - Intronic
1154961471 18:21313575-21313597 TATGGCTGTCCTACATCATGGGG - Intronic
1156580881 18:38373701-38373723 CCCAACTGTCCCAAATCATGGGG + Intergenic
1165977087 19:39685658-39685680 TACAGACAGCCCAAATCATGGGG + Intergenic
925007703 2:457180-457202 TAAAACTGTCCCTAACCATGTGG + Intergenic
925107671 2:1306925-1306947 TACAGCTCTCACACAGCATGCGG - Intronic
927241368 2:20922503-20922525 TCCAGCTGTCCCGGATCCTGAGG + Intergenic
929746236 2:44662024-44662046 TACAGCTGTCCCAAATCATGAGG - Intronic
929907452 2:46058653-46058675 TCCAGATGTCCCAAATGCTGTGG + Intronic
930706817 2:54512624-54512646 TTCAACTGTCGCAAAACATGAGG - Intronic
932460199 2:71877132-71877154 TACAGCTGTACTAAAAGATGGGG + Intergenic
935453709 2:103240729-103240751 TACTGCTGGCTAAAATCATGTGG + Intergenic
942309718 2:174644462-174644484 TACAGCTTTCACAAATAATGTGG + Intronic
942887268 2:180940960-180940982 TACAGCTGTTAAAAATAATGAGG - Intergenic
943956549 2:194199242-194199264 TTCACCTGTCTCAAATCAAGGGG - Intergenic
944138987 2:196434351-196434373 TCCAGATGGCCCAAATAATGTGG - Intronic
1170814440 20:19701047-19701069 TAAAGCTGTCCCAAAACTTCAGG - Intronic
1176965308 21:15205929-15205951 TATAGCTGTCTGAAATGATGAGG + Intergenic
1178192237 21:30297661-30297683 GACAACTGTCACAAGTCATGTGG - Intergenic
1181826726 22:25522745-25522767 TACATCAGTCATAAATCATGAGG + Intergenic
1184638633 22:45856643-45856665 TACAGCTGTCCCACTTCAGGTGG + Intergenic
956707760 3:72013980-72014002 TTCAGCAGCCCCAAGTCATGAGG + Intergenic
957106931 3:75901716-75901738 TATAGCTGTTACAAAACATGTGG - Intergenic
963926087 3:150952383-150952405 TACAGCTGAGCCAAATCACCTGG - Intronic
966355703 3:179076360-179076382 TACAGCTGTCCCTCAGTATGTGG - Intergenic
967449015 3:189601415-189601437 TACAGTAGTCCCAAAGCAGGAGG - Intergenic
969626448 4:8308012-8308034 CACAGCTCTCCCAAATCTGGAGG + Intergenic
972457654 4:39270067-39270089 TATAGCTGTGCAGAATCATGAGG - Exonic
974987196 4:69042373-69042395 CACAGCTGTCGCACATCTTGTGG + Intronic
979517144 4:121622547-121622569 TGCAGATGTCCCAAATCATCTGG - Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
993808817 5:92448182-92448204 TACAGCAGTCTCAAAAGATGTGG - Intergenic
997296478 5:132771937-132771959 TATACCTGTCCCAAATCAAGAGG + Intronic
997586652 5:135047565-135047587 GCCAGCTGGCCCAAAGCATGTGG - Intronic
999841012 5:155426502-155426524 TTTAGCTGTCACAAATCAAGGGG - Intergenic
1000974830 5:167753282-167753304 TACAGCTGTCTCAAATATTGTGG + Intronic
1002788727 6:423722-423744 AACAGCCGTCCCAAATGTTGGGG - Intergenic
1003280219 6:4684724-4684746 TACAGCTGCCTGAAACCATGTGG - Intergenic
1005527589 6:26666425-26666447 AACAGCAGTCCCCAATCTTGTGG + Intergenic
1010724305 6:79315379-79315401 CACAGCTGTCCCAAGTGTTGAGG + Intergenic
1013950210 6:115771146-115771168 GACAGCTGCCCCACATGATGAGG - Intergenic
1014298423 6:119649545-119649567 AACATCTGCCCCAAATAATGAGG - Intergenic
1015367497 6:132413286-132413308 TACAGCTTTTCCATAACATGTGG - Intergenic
1022703977 7:32786091-32786113 CACTGCTGTCCCACATCATGGGG + Intergenic
1022875129 7:34520681-34520703 CACAGGTGTCCCACATTATGTGG - Intergenic
1028809439 7:95067763-95067785 TACAGCAGTGCCCAATCAGGTGG + Intronic
1031322122 7:120344048-120344070 TACAGTTCTCCTAAATTATGAGG + Intronic
1031903775 7:127439056-127439078 TACTCCTATCCCAAATTATGCGG - Intergenic
1033050999 7:138004040-138004062 TACAGTTGGACCAAATCATCTGG + Intronic
1033244551 7:139707126-139707148 TACAGCAGCCCAGAATCATGGGG + Intronic
1033377211 7:140773516-140773538 TATATCTTTCCCAAAACATGGGG - Intronic
1036942783 8:13067497-13067519 TTCAGCTGCCCCAGATCATGGGG + Intergenic
1037150591 8:15630814-15630836 TACAGCTGGCTAAAATCACGTGG + Intronic
1038600499 8:28937194-28937216 TACAGATGTCCTAAATCTTTTGG + Intronic
1047001601 8:120578788-120578810 GACAGGTCTCCCAAATCATCTGG + Intronic
1047888659 8:129281723-129281745 TACAGATGTCCCAAATTGAGTGG + Intergenic
1047894751 8:129354157-129354179 TCCAGCTGTCCCATGCCATGAGG - Intergenic
1051246568 9:15117817-15117839 TACAGCTGTACCATAGCATTGGG + Intergenic
1059094089 9:111393869-111393891 TACAGGTGGCCCAAATCACCTGG + Intronic
1186347694 X:8711164-8711186 TAAGACTGTCCCAAATCATCAGG + Intronic
1194640130 X:96393785-96393807 TACAGATGTCTCAAATTATAGGG - Intergenic
1196995261 X:121375561-121375583 TACAGCTGGGCAAAATCATCTGG + Intergenic
1198197302 X:134376425-134376447 TACAGTTTTCCCAAATCAACAGG - Intronic
1198517013 X:137419738-137419760 TACTGCTGTCTCAGAACATGAGG - Intergenic