ID: 929746419

View in Genome Browser
Species Human (GRCh38)
Location 2:44664130-44664152
Sequence GTTTATTAAAAGCAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929746419 Original CRISPR GTTTATTAAAAGCAGCAGAG TGG Intronic
901344150 1:8524074-8524096 TTTTATTAAAAGAAGCAGGAAGG + Intronic
901563169 1:10089375-10089397 GTTTATTATAATCAGCATTGAGG + Intronic
904158147 1:28502044-28502066 GTATAGGAAAAGCAGGAGAGAGG - Intergenic
904248281 1:29203816-29203838 CTTTATTAAACACTGCAGAGAGG - Intronic
904347113 1:29879717-29879739 GTTTAAAAAATGCAGGAGAGTGG + Intergenic
906255226 1:44343944-44343966 GTTTTTTAAAATCAGCTGGGTGG + Intronic
906442743 1:45863400-45863422 AGTTATTCAAAGCAGCAGATGGG + Intronic
906707530 1:47905623-47905645 GTTTATGTAGAGCAGCAGAGTGG - Intronic
906818809 1:48907426-48907448 GTTTCTCAAAAGCAGGAGAGTGG + Intronic
910374958 1:86558505-86558527 CTTTATTAACAGCATAAGAGTGG - Intronic
911426962 1:97728637-97728659 TTTTTTTAAATGCAGCAGATTGG - Intronic
911427952 1:97745062-97745084 GATTATTAAGAGAAGCACAGAGG - Intronic
911904301 1:103547707-103547729 GTTTTGTAAAAGCAAAAGAGAGG + Intronic
912141988 1:106741391-106741413 CTTAATAAAAAGCAGCAGAAAGG + Intergenic
913091921 1:115481986-115482008 TTTTATCAAAAGGAGAAGAGGGG - Intergenic
917124876 1:171678240-171678262 GTTTATGAAGAGCAGCCGTGGGG - Intergenic
917202813 1:172534650-172534672 TTTTATTAAAAACAGGAGACGGG - Intronic
917294419 1:173504086-173504108 GTGATTTGAAAGCAGCAGAGCGG + Intronic
917641505 1:176987452-176987474 GTATATTTTAAGCAGGAGAGGGG - Intronic
918874638 1:190024663-190024685 GTTTATTAAACAGAGAAGAGTGG + Intergenic
919232838 1:194797444-194797466 GTTTATGAAAAGAAGCTGTGTGG - Intergenic
919434217 1:197536426-197536448 GTTTATTTATAAAAGCAGAGCGG - Intronic
919714120 1:200757218-200757240 ATTTATTAAAAGCAATAAAGGGG - Intronic
920060070 1:203221283-203221305 GTTTATAAAACCCTGCAGAGAGG - Intronic
921233226 1:213095542-213095564 GGTTATTAAAAGCTGTGGAGGGG - Intronic
921778447 1:219131165-219131187 GTATATAAAGAGCAGCAGACAGG + Intergenic
923845706 1:237729223-237729245 GTTTCTTAAAAGCACCAGGTTGG - Intronic
924387946 1:243517703-243517725 GTTTCTTATAAGCAGCATATAGG + Intronic
1063052969 10:2473968-2473990 CTTTATTAATAGCATGAGAGCGG - Intergenic
1063411710 10:5841174-5841196 GTTTATTTGCAGCACCAGAGAGG - Intronic
1063668385 10:8080172-8080194 GTTTTTTAAAAGAAGCAGAATGG + Intergenic
1064306203 10:14169022-14169044 GTTTAATAAATGCATCATAGTGG + Intronic
1064749497 10:18512233-18512255 GTTTAACAAAAGAGGCAGAGTGG - Intronic
1065513250 10:26500446-26500468 GTTTTAGAAAAGTAGCAGAGGGG - Intronic
1067859011 10:49825274-49825296 GTGTATTTAAAGCAGGTGAGAGG - Intronic
1068120124 10:52776237-52776259 GTTTATATTAAGCAGGAGAGGGG + Intergenic
1068636194 10:59351035-59351057 CTTTTTTAAAAGCATCAGAAAGG + Intronic
1069453062 10:68532669-68532691 GTTTATGAAAAACAACAAAGAGG - Intergenic
1069529539 10:69206237-69206259 ATTTATTAAACTTAGCAGAGTGG + Intronic
1070692470 10:78537377-78537399 GTTCACTACAAGTAGCAGAGAGG - Intergenic
1072244504 10:93530645-93530667 TTTAATAAAAAGCAACAGAGTGG - Intergenic
1072927863 10:99632275-99632297 GATTATTTAAAGTAGCTGAGAGG + Intergenic
1073861382 10:107746162-107746184 GTTTCTTAAAAACAGCATATAGG - Intergenic
1074385323 10:113012330-113012352 GTTTATGAAACGTAGGAGAGTGG + Intronic
1075273305 10:121071808-121071830 ATTTATTGAAAGCAGAAGAGAGG + Intergenic
1075505160 10:123014788-123014810 TTTTAGGTAAAGCAGCAGAGGGG + Intronic
1076077053 10:127542147-127542169 GCTTATTAAAAGCAGCACCCAGG - Intergenic
1076648211 10:131969208-131969230 GGTTCTGAAAAGCAGCTGAGGGG + Intronic
1079427292 11:20355922-20355944 GTCTATTAACAGCAGGAGAATGG - Intergenic
1079530989 11:21453459-21453481 GTATACTAAAAATAGCAGAGAGG - Intronic
1080607137 11:33872623-33872645 GTTTTTTAAAAGCAGGAAACAGG + Intronic
1083260974 11:61523001-61523023 GTTCCTTAAAAGAAGCAGCGGGG - Intronic
1085660562 11:78361997-78362019 CTTTTTAAAAAGCAGCTGAGTGG - Intronic
1086208267 11:84286271-84286293 AGTTTTTAAAAGCAGCAGAGTGG - Intronic
1088090070 11:106027429-106027451 GTTTATTAAAAGTCTCAGACTGG + Intergenic
1089038231 11:115419440-115419462 GTTTCTTAAAGGCAGGGGAGGGG - Intronic
1090050824 11:123377543-123377565 GAATATCAAAAGCAGCAGATGGG + Intergenic
1090460930 11:126890976-126890998 ATTAAATAAAGGCAGCAGAGTGG - Intronic
1090726201 11:129529514-129529536 GTGTATGAAAGGCAGCATAGAGG - Intergenic
1091761692 12:3091728-3091750 CTTTACTAAAAGCTGCTGAGGGG - Intronic
1092358664 12:7817821-7817843 GTTTACTTACAGCAGCAGAGGGG + Exonic
1092371803 12:7922811-7922833 GTTTACTTACAGCAGCGGAGGGG + Exonic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1094450404 12:30577793-30577815 ATTTGTTAAAAGCATCTGAGGGG + Intergenic
1095633587 12:44405581-44405603 GCTTTTTGCAAGCAGCAGAGTGG + Intergenic
1097490648 12:60265837-60265859 GTTTATTAAGAGAAGCAAAATGG - Intergenic
1097983340 12:65756628-65756650 GTTTAAGAAACGGAGCAGAGAGG + Intergenic
1098553270 12:71788641-71788663 GTGTATTAAAAGCAGTAGGTAGG + Exonic
1100644872 12:96518363-96518385 GTTAATAAAAATGAGCAGAGAGG + Intronic
1102630295 12:114272451-114272473 GTTTCTAAAAATGAGCAGAGGGG + Intergenic
1104913908 12:132254308-132254330 GCATATTAAAAGCAGCGGAGGGG - Intronic
1106623549 13:31395279-31395301 GTAGATTAATATCAGCAGAGAGG - Intergenic
1106945468 13:34823030-34823052 CTCTACTAAAAGCAGCAGAAGGG + Intergenic
1107315621 13:39128286-39128308 GCTTATTAAAAGAAACAGAAAGG - Intergenic
1107706575 13:43113234-43113256 ATATATTGAAAGGAGCAGAGAGG + Exonic
1107777157 13:43856754-43856776 GTTTATAAAAATCAGAATAGTGG + Intronic
1107890902 13:44913449-44913471 GATGATTTAAACCAGCAGAGTGG + Intergenic
1108045476 13:46380028-46380050 TTGTAATAAAAGCAGCAGAAAGG + Intronic
1109291753 13:60484178-60484200 GTTCATTAAAAACATTAGAGGGG + Intronic
1109699247 13:66004512-66004534 GTTTAATAAAAGCATCAGCCTGG - Intergenic
1111179115 13:84638413-84638435 GTCTCTTAAAGACAGCAGAGGGG - Intergenic
1113052928 13:106234806-106234828 GATTTTTAAAAGCACCAGAGAGG - Intergenic
1113242955 13:108360197-108360219 GTTTATTTAAAGAAGCTCAGTGG + Intergenic
1113334153 13:109362285-109362307 CTTTATTAAAACTAGCACAGGGG - Intergenic
1114062258 14:19028310-19028332 GTATTTTAAAAGAAGCAGAAGGG + Intergenic
1114100001 14:19371683-19371705 GTATTTTAAAAGAAGCAGAAGGG - Intergenic
1115257327 14:31417114-31417136 GTTTATCATAAGCAGCAGTAAGG - Intronic
1118296464 14:64574493-64574515 GTGAATTAGAAGCAGCACAGAGG + Exonic
1118359464 14:65043879-65043901 GTTTATTAAAAGCAGATAAATGG - Intronic
1118827967 14:69401053-69401075 GTTTGTTAGAATCAGAAGAGAGG + Intronic
1119453480 14:74733460-74733482 TTTTATAAAAAGTGGCAGAGTGG - Intronic
1120970953 14:90206585-90206607 GGGCATTAGAAGCAGCAGAGTGG - Intergenic
1122011010 14:98747009-98747031 ATTTACTAAAAGCAGCATTGAGG + Intergenic
1122042918 14:99002029-99002051 TTTTGTTAAAATGAGCAGAGGGG - Intergenic
1122116795 14:99531690-99531712 GTTGGTGAAAAGCAGGAGAGAGG - Intronic
1202844641 14_GL000009v2_random:157100-157122 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
1202914035 14_GL000194v1_random:147340-147362 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
1202878629 14_KI270722v1_random:35350-35372 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
1125035606 15:35120836-35120858 TTTTACTAAAACCAGCAGTGAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1130327489 15:82892655-82892677 GAGTATTAAAATCAGCTGAGGGG + Intronic
1130667252 15:85880131-85880153 GATTATTACAAGCGGCAGCGAGG - Intergenic
1131129824 15:89890784-89890806 GTTATTTAAAAGAAACAGAGAGG + Intronic
1131866919 15:96721216-96721238 GTTTATTAAAAACTGCAGAAAGG - Intergenic
1132179017 15:99737623-99737645 CTTTATTCCAGGCAGCAGAGAGG - Intergenic
1133866239 16:9646200-9646222 ATTTAATAAAAGCAACTGAGTGG - Intergenic
1135691136 16:24539129-24539151 GTTTATTGGAAGCAGCAGCTAGG + Intronic
1137855789 16:51793299-51793321 CTTTATAAAAAGCAACAGTGTGG + Intergenic
1138726924 16:59150376-59150398 TATCATTAAATGCAGCAGAGAGG - Intergenic
1140200742 16:72892807-72892829 ATTTTTTAAAAGCAGCTCAGAGG - Intronic
1142470825 17:162406-162428 GGTTCTTAAAAGCAGAAGAATGG + Intronic
1143360562 17:6365881-6365903 GTTTAAGGAAAGCAGCAGAGGGG - Intergenic
1147165589 17:38591520-38591542 CTTTAGTAACAGAAGCAGAGAGG - Intronic
1148596963 17:48864400-48864422 TTTTTTTAAAAGGAGCAGTGTGG + Intronic
1149808814 17:59646290-59646312 GTTTATAAAAAGAAGCCAAGGGG - Intronic
1149850784 17:60032416-60032438 GGTTCTTAAAAGCAGAAGAAAGG - Intergenic
1149859382 17:60114108-60114130 GGTTCTTAAAAGCAGAAGAAAGG + Intergenic
1150180871 17:63119712-63119734 TTTTATTAACAGTAGCAAAGAGG + Intronic
1154108326 18:11544681-11544703 CTTTATAAAAAGCACCAAAGGGG - Intergenic
1155823845 18:30413619-30413641 GTATATTACAAACAGAAGAGAGG + Intergenic
1155974819 18:32117394-32117416 GTCTACTGAAAGCAGGAGAGAGG + Intronic
1156966082 18:43094344-43094366 GATGATTAAAAGCAAGAGAGAGG - Intronic
1157925846 18:51765376-51765398 TTTTGTTAAAAGCTGCTGAGAGG + Intergenic
1158086538 18:53657770-53657792 GTTTAAGAAGAGCAGAAGAGGGG - Intergenic
1159019637 18:63132827-63132849 ATGTATTAAAAGCAACAAAGAGG + Intronic
1159392133 18:67806973-67806995 CTTTATTAAAAACAGCAATGTGG + Intergenic
1160218998 18:76958795-76958817 GTGTAATGAAAGCAGCAGGGTGG - Intronic
1160471601 18:79140069-79140091 GGTTATTAAAAGCTTCACAGAGG + Intronic
1163974239 19:20834251-20834273 GTTTGTCAAAAGCTGGAGAGAGG + Intronic
1163985256 19:20940666-20940688 GTTTGTCAAGAGCACCAGAGAGG - Intronic
1164033313 19:21431195-21431217 GTTTATAAAAAGCATCAAAGGGG - Intronic
1164814840 19:31189151-31189173 GTTAATTAAAAACAGAAGAGGGG - Intergenic
1167600811 19:50453839-50453861 CTTCATTAAAAGCACCAGACTGG - Intronic
1202654250 1_KI270708v1_random:4398-4420 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
925997808 2:9306412-9306434 CTTTCTTAAAGGCAGAAGAGCGG + Intronic
927390265 2:22587213-22587235 GGTTATTAAAAGTAGAACAGTGG - Intergenic
927870033 2:26617606-26617628 GTTAATGAAAAGCAGCAGATTGG - Intronic
928539844 2:32274514-32274536 ATTGATTACAAGCAGAAGAGTGG + Intergenic
929746419 2:44664130-44664152 GTTTATTAAAAGCAGCAGAGTGG + Intronic
931515416 2:63048201-63048223 GTTTCTTGAAAGCAGCGCAGAGG - Intergenic
931782252 2:65588816-65588838 CTATCTTCAAAGCAGCAGAGTGG + Intergenic
934718830 2:96558781-96558803 GTTTCTGGAAAGCAGCAGAAGGG + Intergenic
935945163 2:108279602-108279624 CTTTATTCTAAACAGCAGAGTGG + Intergenic
938479621 2:131648495-131648517 GTATTTTAAAAGAAGCAGAAGGG + Intergenic
939588887 2:144039289-144039311 CTTTAATAAAAGGAGCAGGGGGG - Intronic
939906296 2:147920152-147920174 TTTTATTGAAAGCAGAAAAGGGG - Intronic
940697087 2:156993208-156993230 GTTTATTACAGGCAGGAGAGGGG + Intergenic
940875354 2:158892544-158892566 GTTTTTTAAAAGCTGCACATTGG - Intergenic
941190148 2:162371504-162371526 GTTTAGTAAAAGCAGTAAATAGG + Exonic
941546018 2:166852678-166852700 TTATATTCAAAGCAGCAGAGTGG + Intergenic
941957108 2:171216169-171216191 GTTTTTTTAAGGCAGCATAGTGG - Intronic
942258585 2:174133713-174133735 GTTTCTTGTAAGCAGCAGAGAGG + Intronic
942785473 2:179696595-179696617 GTGTATTAAAAGTAGCCTAGGGG - Intronic
943169360 2:184377143-184377165 ATTTTTTAAAAGCTGCAGACTGG + Intergenic
945904858 2:215580406-215580428 GTGTATTCAAAGAAACAGAGAGG - Intergenic
946087325 2:217187022-217187044 GGTTTTTGGAAGCAGCAGAGGGG + Intergenic
946302730 2:218833904-218833926 GTTTACTAACAGCAGAAGAAGGG - Intergenic
947070958 2:226287633-226287655 GTTTACAGGAAGCAGCAGAGGGG + Intergenic
947234732 2:227928570-227928592 GTTTATATAAAGCAGCAGAAGGG + Intergenic
948393726 2:237629770-237629792 TTTTATAAAAACCAGCAGATAGG - Intronic
948672916 2:239579942-239579964 CTTTAGTAAAAGCAGCAAATAGG - Intronic
1169045634 20:2532733-2532755 TAATATTAAAAGCAGCAGAGCGG - Intergenic
1170602254 20:17849764-17849786 TTCTACTAAATGCAGCAGAGGGG + Intergenic
1171100878 20:22382972-22382994 GTTTATTAAAAGAAAGAAAGAGG - Intergenic
1171287182 20:23950633-23950655 GTTTTTTAGGAACAGCAGAGTGG + Intergenic
1173325252 20:42027053-42027075 ATTGTTTAAAAGAAGCAGAGAGG - Intergenic
1176074713 20:63243213-63243235 GTTTAGGATCAGCAGCAGAGTGG + Intronic
1176633390 21:9162014-9162036 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
1176639936 21:9292797-9292819 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
1177226481 21:18263927-18263949 GTTTATAAAAAGCACAAAAGTGG - Intronic
1177283400 21:19014785-19014807 GTTTATTTAAAGCATCAGCTGGG + Intergenic
1177758862 21:25380073-25380095 ATTCATTAGAAGCAGCAGAATGG - Intergenic
1179086676 21:38224568-38224590 ATTTATAAAAAGCATCAAAGGGG - Intronic
1180348950 22:11782170-11782192 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
1180373238 22:12065624-12065646 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
1180389249 22:12210026-12210048 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
1180416693 22:12724450-12724472 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
1180423982 22:12900262-12900284 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
1180480750 22:15750936-15750958 GTATTTTAAAAGAAGCAGAAGGG + Intergenic
1180639292 22:17285308-17285330 GTTTAGTGATAGCAGCAAAGAGG - Intergenic
1181370818 22:22415367-22415389 CTTTACTAAAATTAGCAGAGTGG + Intergenic
1182352119 22:29704951-29704973 GTATATTGACAGCAGGAGAGGGG + Intergenic
1184044151 22:41961992-41962014 GTATAGTAAAAGCAACACAGTGG + Intergenic
1185211173 22:49571373-49571395 GTTTTTAAAAAGCAGGAGGGTGG + Intronic
952270945 3:31830665-31830687 GTGGAATAAGAGCAGCAGAGAGG - Intronic
955327330 3:58019318-58019340 GGTTTTTAAAAGCAAAAGAGGGG - Intronic
955798296 3:62660673-62660695 GGTTATTAGAAACAGCAGGGAGG - Intronic
956122957 3:65984463-65984485 GTGTTTTAAAAGAAGGAGAGGGG - Intronic
956474630 3:69607310-69607332 GTCTATTTAAAAGAGCAGAGGGG - Intergenic
957027278 3:75196117-75196139 ATTTTTTAAAAGCAGCCGAAGGG + Intergenic
958658095 3:97029336-97029358 ATTTATTAAAAACATCACAGGGG - Intronic
958809576 3:98845205-98845227 GATCATTAAAAATAGCAGAGGGG + Intronic
959334235 3:105043978-105044000 GTTTATTAATAGCACAGGAGAGG + Intergenic
959450122 3:106488133-106488155 GTTTATTAAAATAACCAAAGAGG - Intergenic
961600090 3:128053670-128053692 GTCCATTAAAAGCAGCACATGGG - Intronic
964037734 3:152218776-152218798 GTTTATTAAAAGTGACAAAGAGG + Intergenic
965730392 3:171765557-171765579 TATTATAAAGAGCAGCAGAGGGG + Intronic
966317543 3:178665258-178665280 GTTTATTAACAAGAGAAGAGAGG + Intronic
967999325 3:195192806-195192828 ATTAATTAAAAGCATCAGATTGG + Intronic
1202746958 3_GL000221v1_random:112234-112256 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
970324091 4:14904997-14905019 GTTAATTATAATCAGCAGAAAGG - Intergenic
971425997 4:26516076-26516098 CATTCTCAAAAGCAGCAGAGAGG + Intergenic
972467401 4:39370497-39370519 GTAAATTAATACCAGCAGAGTGG + Intergenic
972480299 4:39490210-39490232 ATTTATAAAAAGCATCAAAGGGG + Intergenic
972565192 4:40263289-40263311 GTTTCTTAAAAGCAGGAGATGGG + Intergenic
972607525 4:40627829-40627851 TTTAATTTAAAGCAGCACAGTGG + Intronic
972654731 4:41053482-41053504 ATTTCTTAAAAGCAGCAGCTTGG + Intronic
973280677 4:48357853-48357875 GTTTTTTAAAAACATCAGTGGGG - Intronic
973668834 4:53192537-53192559 GTTTATTTAAAAAATCAGAGGGG + Intronic
975038781 4:69718180-69718202 GTCTATTCAAAGCAGCCTAGTGG - Intergenic
975185384 4:71396265-71396287 CTTGATGAAATGCAGCAGAGTGG + Intronic
975188527 4:71432129-71432151 GTTTATAAAAAGCAGACGTGAGG + Intronic
975640723 4:76497554-76497576 GTTTTTTAAAATCAGAAAAGAGG + Intronic
977523962 4:98122163-98122185 GTTTATTCAAATAAGAAGAGAGG - Intronic
977564246 4:98565699-98565721 CTTTATCACAAGCAGCTGAGAGG + Intronic
978879431 4:113683400-113683422 GTTGAATGAAATCAGCAGAGGGG + Intronic
979058168 4:116020067-116020089 ATTTATAAAAAGCATCAAAGGGG + Intergenic
979230606 4:118345201-118345223 TTTTATTAGGATCAGCAGAGGGG - Intronic
980292337 4:130859600-130859622 GTAAATTGATAGCAGCAGAGTGG + Intergenic
982352964 4:154436011-154436033 ATTTAGCAAAAGAAGCAGAGAGG - Intronic
984785012 4:183559737-183559759 GTTTATATAGAACAGCAGAGAGG - Intergenic
1202754830 4_GL000008v2_random:51189-51211 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
985720929 5:1488625-1488647 CTTTAATAAAACCAGCAGAGCGG - Intronic
988870264 5:35382039-35382061 GTTTTTTAAAAGCAGAAATGTGG + Intergenic
994632899 5:102308097-102308119 GTTTATTATAAGCAGCCATGTGG + Intergenic
996038012 5:118780434-118780456 GTCTTTTAAATGCAGCAGAGTGG + Intergenic
996197523 5:120627699-120627721 TTTTGTAAAAAGCAGCAGGGTGG - Intronic
996854644 5:127991614-127991636 TTTTATTCAAAACAGCAGATGGG + Intergenic
997201987 5:132015976-132015998 GTTTTTAAAAAGCAGCATAAGGG - Intergenic
997348606 5:133212547-133212569 GTTTATTAGAAACAGAAGATAGG + Intronic
997653830 5:135540964-135540986 GTTTCTGATAACCAGCAGAGAGG - Intergenic
1001749324 5:174116871-174116893 GTTTATTTAAAGCGGCGGGGGGG - Intronic
1003731491 6:8829603-8829625 GCTTTTTAAAAGCAAAAGAGGGG + Intergenic
1006112900 6:31759549-31759571 GTTTAAAAAAAGCAGCAGCCAGG + Intronic
1006348180 6:33500222-33500244 GATGATTAGAAGTAGCAGAGAGG - Intergenic
1006737860 6:36287444-36287466 GGTTATTAGAAGCAGCACCGCGG - Intronic
1006885619 6:37379858-37379880 GTTTTATAAAAGCATCAGATTGG + Intronic
1008173902 6:48242678-48242700 GTTTATTAATAGCATGAGAATGG + Intergenic
1009646293 6:66406970-66406992 AGTTATTAAAAGAAGCAGAAAGG - Intergenic
1011157928 6:84354559-84354581 ATTTATTAAAAGCAGTAAAGTGG + Intergenic
1012240236 6:96862876-96862898 GTTTGTGAAAAGAAGCAGAATGG - Intergenic
1013408564 6:109864272-109864294 ATTTATTACAAGGAGCAGGGTGG - Intergenic
1013637768 6:112045277-112045299 GTTTATTAAAAGTTGGACAGGGG + Intergenic
1014344202 6:120247039-120247061 ATTTATTTAAAGCAGCATATTGG - Intergenic
1014455363 6:121627384-121627406 TTTGATTAAAAGAAGCAGAAAGG - Intergenic
1014650175 6:124026581-124026603 GTCTCTTAAAAGCAGGAGAGGGG - Intronic
1015525440 6:134171515-134171537 GCTTATCAAAAGCAGCTAAGAGG - Intronic
1015944570 6:138486850-138486872 GTGTATCATAAGCAGCAGAATGG + Intronic
1016493762 6:144635843-144635865 TTTTTTTAAAGGCAGCAGGGGGG - Intronic
1017876962 6:158532802-158532824 GGATATTAAAAGCATCATAGTGG + Intergenic
1018227024 6:161638433-161638455 GTTTAAGAAAATCAGCAGTGTGG - Intronic
1019332230 7:466147-466169 GCTGATGAAAAGCAGGAGAGCGG + Intergenic
1022446733 7:30477231-30477253 GTTTAAAACAAACAGCAGAGTGG - Intronic
1022917399 7:34971997-34972019 GGTACTTAAAAGCAGAAGAGAGG + Intronic
1023324275 7:39035807-39035829 ATTTATTAAAAGAAGATGAGAGG + Intronic
1023352602 7:39335212-39335234 TGTTATTATAAGCAACAGAGTGG - Intronic
1024139292 7:46445721-46445743 ATTAATTAAAACCAGCACAGAGG - Intergenic
1024440138 7:49407521-49407543 GTTTTTTAAAAGCAAAAAAGGGG - Intergenic
1024611482 7:51068123-51068145 GTTTACCAAAAGTAGCTGAGAGG - Intronic
1025738720 7:64178514-64178536 GTTTATTCCAAGGGGCAGAGTGG - Intronic
1026586057 7:71657065-71657087 GTTTCTCAAAAGCAGCAGGAAGG - Intronic
1028220341 7:88189587-88189609 CTTAATTAAAAGTAGCAGAGTGG + Intronic
1032497462 7:132373435-132373457 GGTTAGTGAAACCAGCAGAGTGG + Intronic
1034099628 7:148439630-148439652 GTTTATTAGAAACTACAGAGTGG - Intergenic
1034155845 7:148955491-148955513 TTAGAATAAAAGCAGCAGAGTGG - Intergenic
1034346847 7:150390843-150390865 GTTTATTAAAATTAGAAGTGTGG - Intronic
1035659589 8:1336766-1336788 GTTTATTAAAAGAGGGTGAGAGG - Intergenic
1037904948 8:22710782-22710804 ATGAATTAAAAGCAGAAGAGGGG + Intergenic
1039856438 8:41418885-41418907 GGTTATAAAAAGCAGCAGCAGGG + Intergenic
1041726296 8:61020818-61020840 GATTATTGATAACAGCAGAGAGG - Intergenic
1042023429 8:64396747-64396769 GTTTATTTAAAGCATCCGAAAGG - Intergenic
1043971687 8:86536320-86536342 GTTAAGTAAAAGAAGCAAAGTGG - Intronic
1046486691 8:114896367-114896389 GTTTACTTAAAGGACCAGAGGGG + Intergenic
1046720805 8:117616926-117616948 CTTTTTTTAAAGCATCAGAGAGG + Intergenic
1047925192 8:129675928-129675950 TATTATTGAAAGCAGCAGTGGGG - Intergenic
1048190516 8:132284107-132284129 GTATATTATTAACAGCAGAGTGG - Intronic
1050364589 9:4862535-4862557 GATTACTATAAGCAGTAGAGGGG + Intronic
1051421968 9:16897712-16897734 CTTTATTAGAAGCAGGAGAATGG - Intergenic
1052863169 9:33449171-33449193 TGTTATTAAAAGCAGCATAGAGG - Intergenic
1053309462 9:37007314-37007336 GTTACTTAAAATAAGCAGAGTGG - Intronic
1057555443 9:96083965-96083987 GGTTATTAAAGGGAGCCGAGAGG + Intergenic
1057687066 9:97244227-97244249 GTTTTTAAAAAGCAACAGAATGG + Intergenic
1058389232 9:104475967-104475989 GTTTTTTAAAAGAGGAAGAGAGG - Intergenic
1058443287 9:105030352-105030374 GTTTAGCAAAAGCAGCAAACAGG - Intergenic
1203756230 Un_GL000218v1:129642-129664 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
1203715594 Un_KI270742v1:142321-142343 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
1203535624 Un_KI270743v1:35910-35932 ATTTTTTAAAAGCAGAGGAGTGG - Intergenic
1203649846 Un_KI270751v1:105882-105904 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
1186849452 X:13566308-13566330 GTTCATTAGAATCACCAGAGGGG + Intergenic
1187788597 X:22922161-22922183 GATTATGAAAACCAGCAGACAGG + Intergenic
1189080186 X:37962806-37962828 CTTTATTAAAAGAGGAAGAGGGG - Intronic
1189622329 X:42855395-42855417 GTTTATTAAAAGAAAAAGAAGGG + Intergenic
1191220499 X:57983305-57983327 GTTTAATAAAGGCAGAAAAGTGG + Intergenic
1191741467 X:64439702-64439724 TTTTATTAAAAGAGGCAGTGTGG - Intergenic
1193242035 X:79181783-79181805 GTCTGTTAAAGCCAGCAGAGAGG + Intergenic
1194451965 X:94054636-94054658 GTTTATTTAAAGCAGAAGCCTGG + Intergenic
1195362047 X:104092152-104092174 ATTTATTCAAAGCAGAAAAGAGG - Intergenic
1196076427 X:111582238-111582260 GTTTACTAAAGGTAGCAGATTGG + Intergenic
1196974495 X:121143176-121143198 GTTTATTCAGAGCAGAAGAAGGG - Intergenic
1198379595 X:136071339-136071361 GTTTATTTGAAGCAGATGAGAGG + Intergenic
1198803399 X:140470223-140470245 GTCTGTTCAAGGCAGCAGAGTGG - Intergenic
1199640732 X:149858578-149858600 GTTTGATAACTGCAGCAGAGTGG + Intergenic
1201169824 Y:11247264-11247286 ATTTTTTAAAAGCAGAGGAGTGG + Intergenic
1201401912 Y:13612588-13612610 GTCTATTGAAGGCAACAGAGAGG - Intergenic