ID: 929748321

View in Genome Browser
Species Human (GRCh38)
Location 2:44682872-44682894
Sequence CTGGTAATCAAAAGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929748318_929748321 28 Left 929748318 2:44682821-44682843 CCTAGACACAACAATGTAAAATA 0: 1
1: 0
2: 5
3: 42
4: 430
Right 929748321 2:44682872-44682894 CTGGTAATCAAAAGAATTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 199
929748317_929748321 29 Left 929748317 2:44682820-44682842 CCCTAGACACAACAATGTAAAAT 0: 1
1: 0
2: 2
3: 32
4: 393
Right 929748321 2:44682872-44682894 CTGGTAATCAAAAGAATTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929748321 Original CRISPR CTGGTAATCAAAAGAATTGT TGG Intronic
901957883 1:12799862-12799884 CTGGTAAGCAAAAGAAATAAAGG + Intergenic
902721126 1:18304827-18304849 CTGGTATTTAAAAAAATTGAAGG + Intronic
903880236 1:26503176-26503198 CTTGTAATCATAAGGATTCTGGG - Intergenic
909739534 1:79010478-79010500 CTGGTAATTAAAACATTTTTTGG - Intergenic
909780088 1:79533929-79533951 CATTTAATCAAAAGAAATGTAGG + Intergenic
910509626 1:87989068-87989090 CTGGGAATTAAAAGAGTTATAGG + Intergenic
917104676 1:171480560-171480582 CTGGTAATTAAAATATTTATCGG + Intergenic
917354196 1:174108950-174108972 CTGGTAAGAAAGAGGATTGTGGG + Intergenic
917477574 1:175382120-175382142 CTCATAATCAAAATAATTTTGGG + Intronic
921352579 1:214251149-214251171 CTAGAATTCAAATGAATTGTAGG + Intergenic
924109744 1:240686776-240686798 CTGGAATACAAAAGAATTATAGG + Intergenic
1067733411 10:48830365-48830387 CTGGTATCCAACAGAATTATGGG + Intronic
1067761380 10:49049831-49049853 CTGGCACTCAAAAGTATTGCTGG + Intronic
1068933504 10:62614677-62614699 CAGGTCATAAAAAGACTTGTGGG + Intronic
1069277545 10:66611452-66611474 CTGATAGTAAAAAGAATGGTAGG + Intronic
1069494873 10:68894618-68894640 CTGGTATAGAAAAGACTTGTAGG + Intronic
1070032045 10:72686528-72686550 CTGGTATTCAAAAGAACAGTAGG + Intergenic
1071071445 10:81698421-81698443 CTGGTACTCCAATTAATTGTAGG - Intergenic
1072819282 10:98540134-98540156 CTGGTAACTAAAAGAATGCTAGG + Intronic
1073092101 10:100950938-100950960 ATCGTATTGAAAAGAATTGTTGG + Intronic
1073819749 10:107247997-107248019 CAGGTCATCAAAAGGATTGGAGG - Intergenic
1074003499 10:109394993-109395015 CTGGTATTCCAATTAATTGTAGG - Intergenic
1074295791 10:112187386-112187408 ATGCTAATCAAAAGAAATATAGG + Intronic
1080091530 11:28354397-28354419 CTGCTAATCTATAGAATTCTTGG + Intergenic
1080164739 11:29223582-29223604 CTGGTACTCCAATCAATTGTAGG + Intergenic
1080790524 11:35518734-35518756 CTTGAAATCAAATGAATTGTTGG - Intronic
1081061769 11:38488026-38488048 CAGGTAATCACAATGATTGTGGG + Intergenic
1081275096 11:41138588-41138610 CTGGTAAACAAAATATTTATAGG + Intronic
1083209972 11:61177391-61177413 TTGGTAATTAAAAGAAAAGTTGG - Intergenic
1086186420 11:84022320-84022342 CTGTTCATAAAAAGATTTGTAGG + Intronic
1087032782 11:93722558-93722580 CTGCTTCTCAAAAGTATTGTTGG - Intronic
1087815930 11:102659046-102659068 ATGGCAATCATAAGACTTGTAGG - Intergenic
1088084302 11:105959238-105959260 CTGGTACTCAAATCAATCGTAGG + Intronic
1088499170 11:110465374-110465396 CTTCTAATGAAAAGAATAGTTGG - Intergenic
1090318172 11:125816504-125816526 CTGGTAATAAAGAGAATTCTGGG - Intergenic
1093132354 12:15407362-15407384 CTGGTGATCAAATGAATTGGGGG - Intronic
1093354101 12:18141795-18141817 CTTGTCATGAAAATAATTGTGGG - Intronic
1093916962 12:24814554-24814576 ATCTTAGTCAAAAGAATTGTTGG - Intronic
1095254780 12:40022164-40022186 CTGGAAAGCAAGAGTATTGTAGG - Intronic
1095809343 12:46355446-46355468 CAGGTACTCAATATAATTGTTGG - Intergenic
1096823134 12:54253053-54253075 ATGGGAATCAAGAGAATTTTGGG + Intronic
1097775721 12:63642305-63642327 CAGTTCCTCAAAAGAATTGTAGG - Intronic
1100532116 12:95470405-95470427 CTGGAGATCAAAAGAATAGTTGG - Intergenic
1102089656 12:110174648-110174670 CAGGAACTCAAAAGAATTATTGG - Intronic
1104256240 12:127141927-127141949 CTGGTACTCCAATCAATTGTAGG + Intergenic
1106137602 13:26985390-26985412 CTAGTATTAAAAACAATTGTGGG + Intergenic
1106365521 13:29075673-29075695 CTGGTAATCAATAGGATTCTAGG - Intronic
1106908491 13:34436001-34436023 CTGGTAATAAAAATCATTTTGGG - Intergenic
1107721347 13:43251804-43251826 CTGGTATTCAGAAAAAATGTTGG - Intronic
1111865138 13:93758905-93758927 CTGGGATTCAAAAGAAATGCAGG - Intronic
1112901379 13:104362331-104362353 CTTGTAATCCCAAGAATTCTTGG - Intergenic
1113722083 13:112566040-112566062 TTGTTAATCAAATGAATTGGTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116560769 14:46376221-46376243 CTGGTACTCCAATCAATTGTAGG + Intergenic
1120514594 14:85455488-85455510 CTTGTATTTAAAAAAATTGTTGG + Intergenic
1120534013 14:85670180-85670202 ATGGTATTCAAAAGAAGTGCAGG + Intergenic
1120714307 14:87823633-87823655 TTGGTAATCAAAAGACTATTTGG - Intergenic
1122966464 14:105129870-105129892 CTGGTTATCTAAAAACTTGTGGG - Intergenic
1125473606 15:40028404-40028426 CTGGGAAGCAAAATCATTGTTGG - Intronic
1128118957 15:65132195-65132217 CTTGTAAACAAAAGAATCCTAGG + Intronic
1128494926 15:68192190-68192212 CTGGAGCTCAAAAGAACTGTGGG + Exonic
1128723379 15:69969753-69969775 CCGGTAATGAAAAGGATTGCTGG + Intergenic
1130154072 15:81334569-81334591 CTGGTACTAAAAAGAAATGGAGG - Intronic
1133309218 16:4832192-4832214 CTTGTCATCAGAAGAATTGTGGG + Exonic
1135712769 16:24731472-24731494 CTGTTACTCAAAATAATTATGGG + Intronic
1140231133 16:73118163-73118185 CTGGCAATAGAAAGAATTCTTGG - Intergenic
1144320253 17:14110384-14110406 CTGGTAAATCAAAGAAATGTTGG + Intronic
1147839270 17:43359402-43359424 CTGGGAACCAAAAGCATTGGAGG - Intergenic
1150532620 17:66000451-66000473 CTAGTAATCCAAAGAAGTGAAGG - Intronic
1155061281 18:22231104-22231126 CTGGTAAGCAGGAGAATTGCTGG + Intergenic
1156136152 18:34040981-34041003 CTGATAATCAAAAATATTCTAGG + Intronic
1157448948 18:47771422-47771444 CTGGTCAGAAATAGAATTGTTGG - Intergenic
1157641994 18:49225046-49225068 TTACTAATGAAAAGAATTGTTGG - Intronic
1158129553 18:54137910-54137932 CTGGTAATCACAATCTTTGTGGG - Intergenic
1161612235 19:5249774-5249796 CTTATACTCAAAGGAATTGTTGG + Intronic
925447340 2:3939498-3939520 CTGGTACTCCAATCAATTGTAGG + Intergenic
929748321 2:44682872-44682894 CTGGTAATCAAAAGAATTGTTGG + Intronic
930719888 2:54628829-54628851 CTGGTAATCATAAGAATATGGGG + Intronic
931341740 2:61408543-61408565 CTGTTAATCAGAAGAATTGTAGG - Intronic
933026522 2:77266735-77266757 CTGCAAATCAACAGAACTGTTGG + Intronic
933150392 2:78908130-78908152 GTGGTTATCAAAAGAGTTGGAGG - Intergenic
933616529 2:84487535-84487557 CTGGAAATAACAAGCATTGTTGG - Intergenic
933763413 2:85691092-85691114 CTGGTACTCTTAAGCATTGTTGG - Intronic
935245446 2:101215288-101215310 CTGTTAATCACAAGAAATGTAGG - Intronic
936570165 2:113606206-113606228 CTGGCAATGAAAAGAGTTCTTGG - Intergenic
937130613 2:119509628-119509650 CAGTTAAAAAAAAGAATTGTTGG - Intronic
939169099 2:138673586-138673608 CTGATGTTCAAAAGCATTGTAGG - Intronic
939391287 2:141571944-141571966 CTGGTACTCAAATCAATCGTCGG - Intronic
940462542 2:153985135-153985157 CTGATAATAAAAATAATAGTTGG - Intronic
941503372 2:166309262-166309284 ATTTTAATAAAAAGAATTGTTGG + Intronic
942274431 2:174309422-174309444 TTGGTTATAAAAATAATTGTTGG - Intergenic
942777813 2:179606081-179606103 CTGGCAGTCAAAAAATTTGTAGG + Intronic
942821457 2:180120697-180120719 CTGGTCATCAGAAGTATGGTAGG - Intergenic
943635731 2:190304755-190304777 TTGGAAATCAAAACAAATGTTGG - Intronic
944657989 2:201895812-201895834 CTGGCAATCAAATGAATGCTTGG - Intergenic
945002593 2:205367460-205367482 ATGGTTATCAAAAGAAGTTTTGG + Intronic
945417462 2:209591704-209591726 ATGGTAATCAGAAGAACTCTTGG - Intronic
1169585711 20:7082258-7082280 CTTGTCATCAAAAGAATTTTGGG + Intergenic
1169715183 20:8608019-8608041 CTAGTCATTAAAAAAATTGTTGG - Intronic
1174210465 20:48874253-48874275 CTGTAAATCAAAAGAATTTTTGG - Intergenic
1174332256 20:49829736-49829758 CTTGTCATCAGCAGAATTGTGGG - Intronic
1174957788 20:55119668-55119690 CTAGTATTCAAAAGCATAGTAGG - Intergenic
1177522980 21:22254243-22254265 CTGGTACTTAAAAGATTTGAAGG - Intergenic
1177912578 21:27050905-27050927 CTGGTACTCCAATCAATTGTAGG + Intergenic
1179213860 21:39349440-39349462 CAGGTATCCAGAAGAATTGTGGG - Intronic
1179218658 21:39388070-39388092 TTGGTATTCAAAAGAATCTTGGG + Intronic
1185129374 22:49029240-49029262 CTGGTAACACAAAGAACTGTCGG - Intergenic
949697246 3:6713197-6713219 CTGGGAAAAAAAAGTATTGTAGG + Intergenic
950959783 3:17093554-17093576 CTGGAATTCAGAAGAATGGTTGG - Intergenic
951493910 3:23303681-23303703 CTTGAAATCTGAAGAATTGTTGG + Intronic
952270555 3:31826912-31826934 CTGGTAATGGAGAGAATTTTAGG - Intronic
955215917 3:56984955-56984977 CTGGAAATCTAAAGTATTATGGG + Intronic
957109189 3:75930819-75930841 CTGGAAATCAAAATAAGTGGAGG - Intronic
957217543 3:77341066-77341088 TTGGTGTTCAAAAGTATTGTTGG + Intronic
957268732 3:78002150-78002172 CTGGTACTCCAATCAATTGTAGG + Intergenic
957394879 3:79623710-79623732 CTGGTACTCCAATCAATTGTAGG - Intronic
957683106 3:83464463-83464485 CTGGTAATCAAGAGAGATATTGG + Intergenic
958073094 3:88640017-88640039 CTGGTACTCCAATCAATTGTAGG + Intergenic
960186575 3:114647757-114647779 CTAGTAATCATGACAATTGTGGG + Intronic
960477114 3:118143909-118143931 CTGGTACTCCAATCAATTGTAGG + Intergenic
960605561 3:119500868-119500890 CTGGTGATCTAAAGAAATTTGGG + Intronic
961162005 3:124735486-124735508 CTGGTAAAAAAAAAAAATGTTGG - Intronic
961266037 3:125643730-125643752 CTGGTAATGAAAATATTTGCCGG + Intergenic
961425004 3:126838136-126838158 CTGGTAATAAAAGGAAATGGGGG + Intronic
963283433 3:143409813-143409835 TTGGGAATCAAAAGAATTGCTGG - Intronic
964096379 3:152936010-152936032 CTAGTAATAGAAAGAATTGGAGG - Intergenic
964610663 3:158611763-158611785 ATGGTGAGCAAAAGTATTGTGGG - Intergenic
968420672 4:481852-481874 CTGGAACTCAAAAGAATATTTGG + Intronic
968824388 4:2883210-2883232 CAGGTAACCAAAAGAACTGAAGG - Intronic
970404366 4:15748215-15748237 TTGTTAACCAAAAGAATTGTAGG - Intergenic
970666344 4:18341871-18341893 CTGGTATTCCAATAAATTGTAGG + Intergenic
970892639 4:21065428-21065450 CTGTAAATCAAACCAATTGTAGG - Intronic
972091515 4:35291943-35291965 CTGGAAATTAAAAGAAAGGTAGG - Intergenic
972197318 4:36669861-36669883 CTGATCATCAACAAAATTGTTGG - Intergenic
972327097 4:38026950-38026972 CTGGTATGCAAGAGAAATGTGGG + Intronic
974115773 4:57577582-57577604 CAGGTCTTCAAAATAATTGTGGG - Intergenic
976116994 4:81738525-81738547 CTGGAAACGAAAAGAATTGAAGG - Intronic
976409975 4:84702386-84702408 CTGGTAAATAAAAGAACTCTGGG + Exonic
976807263 4:89062400-89062422 CTGGTACTCAAATCAATTGTAGG + Intronic
979735201 4:124074096-124074118 CTGGTACTCCAATCAATTGTAGG - Intergenic
980392773 4:132168547-132168569 CTGGTACTCCAATCAATTGTAGG + Intergenic
981450381 4:144890238-144890260 ATGATAAATAAAAGAATTGTGGG + Intergenic
982680357 4:158420374-158420396 CTGGGCATCAAAAAATTTGTTGG + Intronic
983840079 4:172447010-172447032 CTGGTAACCCAAAGATTAGTGGG + Intronic
984183317 4:176512147-176512169 CTGGTCATCAAAATACGTGTTGG + Intergenic
984718357 4:182947195-182947217 CTGATAATGAAAAGAAATGAAGG - Intergenic
985060906 4:186077810-186077832 CTGGTGCTCTAAAGCATTGTAGG - Intronic
988016453 5:25566090-25566112 CTTCTATTCAAAAGAATAGTGGG + Intergenic
988350181 5:30094356-30094378 TTGTTAATCAAAAGCATTGTGGG - Intergenic
988482657 5:31642639-31642661 TTGGTAAACAAAAGAGATGTGGG + Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988708654 5:33751817-33751839 CTGTGAACCTAAAGAATTGTAGG - Intronic
990493582 5:56324945-56324967 CCTGTCATCAAAAGAAATGTTGG - Intergenic
992694025 5:79266651-79266673 CTGGTATTCAACAGTATAGTAGG - Intronic
992930375 5:81637282-81637304 GTGGTTATCAAAAAAATTGGAGG - Intronic
993830093 5:92745514-92745536 GGGGGAATCAAAAAAATTGTGGG - Intergenic
993952279 5:94191506-94191528 CTGCTCATCAAAAGACTTTTAGG + Intronic
997832788 5:137165277-137165299 CTGCTAATCCAGAGAATTCTGGG + Intronic
997902629 5:137781322-137781344 ATTGTTTTCAAAAGAATTGTAGG - Intergenic
998828239 5:146128411-146128433 AATGTAATCAAAAGAATTGGGGG - Intronic
1005098454 6:22143948-22143970 TTGGAAATGAAAAAAATTGTGGG - Intergenic
1010171890 6:72984852-72984874 CTGTTATTAAAAAAAATTGTTGG - Intronic
1012377271 6:98577612-98577634 CTGGTAATCAGTGGAATTGGAGG - Intergenic
1013379771 6:109556633-109556655 CTGGTACTCTAATCAATTGTAGG + Intronic
1013515927 6:110885952-110885974 CTGGTTAACAAAAGATTTGCCGG + Intronic
1015001109 6:128216946-128216968 CTGTTATTCAAAAGCATTCTAGG + Intronic
1017538267 6:155372040-155372062 TTGGAAATCAAAACAAATGTTGG + Intergenic
1018526822 6:164721019-164721041 CTGGAGATCAAAAAAATTTTTGG - Intergenic
1020378505 7:7515151-7515173 CTGATAATAACAAGAACTGTGGG + Intronic
1021546720 7:21821774-21821796 CTAGTATTCAATAGAATAGTAGG - Intronic
1022383166 7:29879599-29879621 CTGCTAACCCACAGAATTGTAGG - Intronic
1023114242 7:36845825-36845847 CTGGTATGCAGAAGAATTGATGG + Intergenic
1024068380 7:45764603-45764625 CTGTTAATGAAAAATATTGTTGG - Intergenic
1024322211 7:48082668-48082690 CTGGAAATCAAGACAACTGTAGG + Intergenic
1024631300 7:51249677-51249699 CTGATCAACAGAAGAATTGTAGG - Intronic
1027329069 7:77072320-77072342 CTAGTAATTAAAATAAATGTTGG + Intergenic
1029786699 7:102799047-102799069 CTAGTAATTAAAATAAATGTTGG - Intronic
1030531999 7:110722782-110722804 CTGGTAATTATAGGAATGGTGGG - Intronic
1030701415 7:112645717-112645739 CTGGTACTCTAATCAATTGTAGG + Intergenic
1033380070 7:140807650-140807672 CTGTTAATCTAAACAAATGTTGG + Intronic
1033395413 7:140969743-140969765 TTGGTAAACAAAAATATTGTTGG - Intergenic
1035491843 7:159286038-159286060 CTGGTACTCCAATCAATTGTAGG - Intergenic
1035875206 8:3181310-3181332 CTGGTAATCAGACAAACTGTAGG - Intronic
1035876161 8:3191698-3191720 CTGTTTATCAAAAGGAATGTGGG + Intronic
1036570506 8:9976071-9976093 CTGGTAATCAAAAGTATCCTTGG + Intergenic
1037143759 8:15549014-15549036 GTGTGAATCAAAAAAATTGTAGG + Intronic
1037643301 8:20768436-20768458 CTGTTAAGCAAAAGAATTTAAGG + Intergenic
1038243182 8:25829786-25829808 CTCGTACTCAAATCAATTGTAGG + Intergenic
1038322964 8:26546162-26546184 TTGTTCATCAAAAAAATTGTAGG + Intronic
1039277593 8:35950827-35950849 CTTGTAATGAAAACAGTTGTGGG - Intergenic
1042093894 8:65190799-65190821 CTGGAAATAAAAATAATTGAGGG + Intergenic
1043028877 8:75106343-75106365 CTGGAAATTAAAAGAGTTCTAGG + Intergenic
1043406688 8:79942631-79942653 CTGGTATTCATAAGAACTGTTGG - Intronic
1043959536 8:86400837-86400859 CTGATTTTCAAAAGATTTGTTGG + Intronic
1044411033 8:91883372-91883394 AGGGTAATCATAATAATTGTTGG - Intergenic
1050920265 9:11191939-11191961 TTTGTAATGAAATGAATTGTTGG - Intergenic
1051509839 9:17865442-17865464 CTAGGAAGCAAAAGAAATGTAGG + Intergenic
1051737673 9:20218359-20218381 CTAGAAATCCAAAGGATTGTAGG - Intergenic
1052461836 9:28774793-28774815 GTGGGAATCAACAAAATTGTGGG + Intergenic
1055205623 9:73727054-73727076 CTGGTCATCATAAGAACTGAAGG - Intergenic
1057706240 9:97396945-97396967 CTGGTAAGAAAAAGAAGGGTTGG - Intergenic
1059746066 9:117202962-117202984 CTGGTACTCCAATCAATTGTAGG + Intronic
1060549577 9:124478556-124478578 CTGGTAATAAATAGGACTGTTGG + Exonic
1186086100 X:5992436-5992458 CAGTTAATTAAAAAAATTGTAGG - Intronic
1186272664 X:7906179-7906201 TTGCTAATCAAGAGCATTGTTGG - Intronic
1188034430 X:25301116-25301138 ATGGAAATCAAAACAAGTGTGGG - Intergenic
1190529831 X:51363126-51363148 CTGGTACTCCAATCAATTGTAGG - Intergenic
1191918963 X:66233381-66233403 CTGGTAATGACAACAATTCTGGG + Intronic
1193976058 X:88120250-88120272 AGAGTAATCAACAGAATTGTTGG - Intergenic
1194012568 X:88581187-88581209 TTAGAAATCAGAAGAATTGTGGG - Intergenic
1195023712 X:100854700-100854722 TTGGTTATAAAAATAATTGTTGG - Intronic
1195493932 X:105507813-105507835 CCAGAAATCAAAATAATTGTAGG + Intronic
1196283705 X:113854893-113854915 CTGGAAACAAAAAGAATTTTAGG + Intergenic
1196857072 X:119994321-119994343 ATAGTAATCAAAAAAATTGGGGG - Intergenic
1197996752 X:132384876-132384898 CAGGTAATCAAAATAATTCTTGG + Intronic
1198296779 X:135295189-135295211 CAGGTATTCAAAAAAATGGTTGG + Intronic
1201651498 Y:16293592-16293614 ATGGTAAAAAAAAGATTTGTAGG + Intergenic
1202191040 Y:22244968-22244990 TTGTTAATCAAATGAAGTGTTGG - Intergenic