ID: 929751292

View in Genome Browser
Species Human (GRCh38)
Location 2:44716346-44716368
Sequence AGCCAGTGATCTTGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 7, 3: 15, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929751283_929751292 23 Left 929751283 2:44716300-44716322 CCCACAGACTGATTTCTCTTGGA 0: 1
1: 0
2: 0
3: 6
4: 185
Right 929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG 0: 1
1: 0
2: 7
3: 15
4: 149
929751286_929751292 -4 Left 929751286 2:44716327-44716349 CCCACGATACAGCCCCGGCAGCC 0: 1
1: 0
2: 1
3: 4
4: 54
Right 929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG 0: 1
1: 0
2: 7
3: 15
4: 149
929751287_929751292 -5 Left 929751287 2:44716328-44716350 CCACGATACAGCCCCGGCAGCCA 0: 1
1: 0
2: 0
3: 4
4: 94
Right 929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG 0: 1
1: 0
2: 7
3: 15
4: 149
929751284_929751292 22 Left 929751284 2:44716301-44716323 CCACAGACTGATTTCTCTTGGAC 0: 1
1: 0
2: 3
3: 12
4: 188
Right 929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG 0: 1
1: 0
2: 7
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929751292 Original CRISPR AGCCAGTGATCTTGGTGTGC TGG Intronic
904472927 1:30746990-30747012 AGCCACTGACCCTGGCGTGCCGG + Intronic
907240541 1:53078671-53078693 TGCCTGTGATCTGGTTGTGCAGG - Exonic
909584721 1:77277085-77277107 AGGCATTCATGTTGGTGTGCTGG - Intergenic
912675795 1:111679640-111679662 AGCCAGTGATCTTAGCTTGCTGG - Intronic
915496589 1:156286254-156286276 ACCCAGGGATCCTGGTGTACGGG + Exonic
916734100 1:167591787-167591809 AGCCAGTGGTCTTGGCATGCTGG - Intergenic
919847735 1:201652041-201652063 AGCCAATGATGGTGGTGTTCAGG + Intronic
920254009 1:204642095-204642117 AGCCAGTGCTCTTGCTCTCCTGG + Intronic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
1070848146 10:79540622-79540644 AGCCAGTGAGCCAGGAGTGCTGG + Intergenic
1070925631 10:80219547-80219569 AGCCAGTGAGCCAGGAGTGCTGG - Intergenic
1074783083 10:116816158-116816180 AGCCAGTGGTCTTTGCGTGAGGG - Intergenic
1076139741 10:128069597-128069619 ATCCAGTGACCTGGGTGCGCAGG + Intronic
1077719184 11:4609801-4609823 AGCCACTCATCTTGTTGTCCTGG - Intergenic
1079754220 11:24235242-24235264 AGCCAGGGACCTTTGAGTGCAGG - Intergenic
1080013784 11:27483946-27483968 AGCAAATGTACTTGGTGTGCTGG - Intergenic
1082976817 11:59080824-59080846 AGCCCGTGTTTATGGTGTGCAGG - Intergenic
1085817869 11:79760155-79760177 AGCAAGTGTTCTAGGTGAGCGGG + Intergenic
1088642763 11:111889360-111889382 AGCAAGTGTACTTGGTGTGCTGG + Intergenic
1090728587 11:129550474-129550496 CACCAGTTATCTGGGTGTGCTGG + Intergenic
1090948021 11:131448784-131448806 GGCCAGTGATGTTGGTGACCCGG + Intronic
1092194618 12:6541717-6541739 AGCCACTGCTCTTGGCGTGTTGG - Intronic
1094364528 12:29665952-29665974 AGCCAGTGAGCAGGGTGTGGTGG - Intronic
1094708384 12:32936908-32936930 GGCCATGGATCTTGGTGTGGTGG + Intergenic
1101591972 12:106132810-106132832 AGCCCGTCAGTTTGGTGTGCTGG - Intronic
1102512484 12:113425200-113425222 AGCCTGTGCTCTTGGGGTCCAGG + Intronic
1102653886 12:114463618-114463640 GGCAACTGAGCTTGGTGTGCAGG - Intergenic
1104743440 12:131195201-131195223 AGCCCGTGACCTTGGGGTTCTGG + Intergenic
1104790893 12:131481483-131481505 AGCCCGTGACCTTGGGGTTCTGG - Intergenic
1107570000 13:41647181-41647203 AGTCAGTGATCTTCATGTTCTGG - Intronic
1111155260 13:84313349-84313371 AGACAGTAATCCTGGAGTGCTGG + Intergenic
1112349983 13:98624889-98624911 GTCCAGTGATCTGGGAGTGCTGG - Intergenic
1113492131 13:110700408-110700430 AGCCAGTGACCTTGCTCTGAAGG + Intronic
1113572321 13:111367073-111367095 GGACAGTGACCTTGGTGTGGGGG + Intergenic
1117064103 14:51991912-51991934 AGAAAGTTATCTGGGTGTGCTGG + Intronic
1117202961 14:53411334-53411356 AGGCAGTGTTCTGGGTGTGTGGG - Intergenic
1118379780 14:65208189-65208211 AGCCGGTGAGCTGGGAGTGCAGG + Intergenic
1119894692 14:78210074-78210096 AGGCAGTGATCCTTGTGTGGTGG - Intergenic
1120100051 14:80434753-80434775 AGCCGGTGAACTTGGGATGCAGG + Intergenic
1121652486 14:95569554-95569576 AGCCAGAGATCACAGTGTGCTGG + Intergenic
1122689644 14:103526098-103526120 AGACAGGGATCTTGCTGTGTTGG + Intergenic
1128636460 15:69305558-69305580 GGCCACTGACCTTAGTGTGCGGG - Intronic
1129612834 15:77074063-77074085 ATCCAGTGCTCTGGGTGAGCTGG - Intronic
1130316914 15:82803800-82803822 GGGCAGTGATCTTGGGGAGCAGG - Intronic
1130728679 15:86467383-86467405 AGCCAATGATCTTAGCTTGCTGG + Intronic
1134826775 16:17291146-17291168 AGCCAGTTAGCTGGGTGTGGTGG - Intronic
1137541520 16:49365455-49365477 AGTCCGTCATCTTGGTTTGCTGG - Intergenic
1140085662 16:71793860-71793882 AGCCAGTCAGCCTGGTGTGGTGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1145200971 17:20944465-20944487 AGCCAGTGAACTTGGGATGCAGG - Intergenic
1148004254 17:44412803-44412825 AGGCTGTGATTTTGGTATGCAGG - Intronic
1155084872 18:22448388-22448410 AGCCAGTCATCTGGGTTTGCTGG - Intergenic
1155261082 18:24043206-24043228 ACCCAGTGAGCTGGGTGTGGTGG + Intronic
1157018612 18:43750678-43750700 GGCCAGTGATCGTGGGGTGGGGG + Intergenic
1161737922 19:6002876-6002898 AGCCAGGGCTCGTGGTGAGCAGG + Intronic
1162497330 19:11030603-11030625 AGCCAGGGATCTGGGGATGCTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164968756 19:32511859-32511881 AGCCAGGCATGATGGTGTGCTGG - Intergenic
1166326176 19:42052442-42052464 GGCCAGTGATCCTGTTGTGGAGG - Intronic
1166357405 19:42235344-42235366 AGCCAGTGGTTTTGGTGAGGGGG - Intronic
1168057967 19:53874009-53874031 AGCCAGTGATCTCGCCGGGCCGG - Exonic
927037671 2:19196533-19196555 AGACAGTGATCATAGGGTGCAGG + Intergenic
928767896 2:34670285-34670307 AGCCGGTGGACTTGGGGTGCAGG + Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
935162856 2:100544222-100544244 CACCAGTGAGCTTGGTGGGCAGG + Intergenic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
938391798 2:130912473-130912495 AGCCAGTGCTCTTAAGGTGCAGG - Intronic
938571885 2:132568889-132568911 AGCCAGTGGCCTTGCTGGGCAGG + Intronic
940160912 2:150712591-150712613 AGCCAGCGATATTTGTCTGCAGG + Intergenic
941842548 2:170102364-170102386 ATCCAGTGATTTTTGTGTGTTGG + Intergenic
946003122 2:216499362-216499384 AGCAAGTGTACTTGGCGTGCTGG - Exonic
948747466 2:240106965-240106987 AGCCACTGTTCAAGGTGTGCAGG + Intergenic
1168975297 20:1961389-1961411 AGCCAGTGATCTCGGGGAGAAGG - Intergenic
1169094761 20:2887423-2887445 GGCCAGTGATGATGGTGTTCTGG + Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1170311247 20:14994677-14994699 AGTGAGAGATATTGGTGTGCTGG - Intronic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1175243138 20:57564403-57564425 TGCCAGAGGCCTTGGTGTGCCGG + Intronic
1176721959 21:10400787-10400809 AGCCAGTGAGGTGGGTGGGCAGG - Intergenic
1179410715 21:41160900-41160922 GGACAGTGTTCTTGGTGCGCTGG + Intergenic
1180303150 22:11053564-11053586 AGCCAGTGAGGTGGGTGGGCAGG - Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1182996168 22:34814497-34814519 AGGCAGTGAGCTTGCTGTGAAGG + Intergenic
1183834433 22:40440631-40440653 AGCAAGTGCTCTTGGTGCACTGG + Intronic
1183961763 22:41415495-41415517 AACCAGTCATCCTGGTTTGCTGG + Intergenic
950347325 3:12308449-12308471 AGGCAGAGACCGTGGTGTGCTGG + Intronic
950428595 3:12938114-12938136 AGCCAGGCCTCTTGGGGTGCTGG + Intronic
950466337 3:13157244-13157266 AGGCAGAGATATTGGTGTGGGGG - Intergenic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG + Intronic
956254763 3:67272084-67272106 AGGCACTGATCTTGCTTTGCAGG + Intergenic
958148113 3:89653739-89653761 AGCCAGTGATTGAGGTGTGCGGG + Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959495652 3:107048413-107048435 AGCCATTCATCTAGTTGTGCAGG + Intergenic
960001526 3:112736542-112736564 AGCCAGTGAGCCAGGAGTGCTGG + Intergenic
960840970 3:121958198-121958220 AGCCAGTGGACTTGGGGGGCAGG + Intergenic
961172670 3:124809279-124809301 AGCCAGTGAGCTTGGTTCCCTGG + Intronic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
968326643 3:197823439-197823461 GGCCATTGAAATTGGTGTGCAGG - Intronic
968703363 4:2067019-2067041 AGCCACGGGTCTTGCTGTGCTGG + Exonic
969166919 4:5323789-5323811 AGCCAGTGAACTCTGAGTGCAGG - Intronic
969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG + Intronic
972247856 4:37264457-37264479 AGCCAGTAAACTCGGTGTTCTGG + Intronic
972918759 4:43911127-43911149 GGCCAGTGATCTAGGTGTGGGGG - Intergenic
975494856 4:75026619-75026641 AGCCAGGGATCATGGTGTTTGGG - Intronic
977260236 4:94788516-94788538 AGCCAGTGCTCTGGGTGGTCTGG - Intronic
978803832 4:112779933-112779955 AGCCAGTGAGCCAGGTGTGGTGG + Intergenic
979512220 4:121567535-121567557 AGCCAGGGATCTTAGCTTGCTGG - Intergenic
980154927 4:129093154-129093176 AGACAGAGAGCTTGCTGTGCGGG + Exonic
982091950 4:151887965-151887987 AGTCAGTGGTGTTGGTGTGTTGG + Intergenic
989106056 5:37864210-37864232 AGCTACAGATCATGGTGTGCTGG - Intergenic
990852645 5:60224517-60224539 TGCCAGTCATCTTGGTGAGATGG + Intronic
991363557 5:65845159-65845181 AGCCAGTTAGCTCGGTGTGGTGG - Intronic
992763204 5:79970081-79970103 AGGCACTGTTCTTGGTGTTCAGG - Intergenic
995695736 5:114876449-114876471 AGCCAGTGATCTTAGCTTGCTGG - Intergenic
996543395 5:124652960-124652982 AGCCAGTGAGCTAGGTGTTGGGG + Intronic
999195710 5:149780187-149780209 AGCCTGTGCTCTGGGTGTGTGGG - Intronic
1005673423 6:28130182-28130204 AACCATTGATCTTGGGCTGCAGG - Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1008315112 6:50030353-50030375 AGCCAGGGACCTTTGTGTGCGGG + Intergenic
1008598972 6:53070690-53070712 ACCCAGGGATTTTGGTGTCCTGG + Intronic
1011838174 6:91459468-91459490 AGACAGTGGCCTTGGTGTTCAGG + Intergenic
1012113308 6:95262459-95262481 TGCCAGACATCTTGCTGTGCAGG + Intergenic
1012171367 6:96020759-96020781 AACCAGTGATCTTGCACTGCTGG + Intronic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017928287 6:158929601-158929623 TGCCAGTGGACTTGGTGTGTGGG + Intergenic
1019162760 6:170080236-170080258 AGCCAGAGATCTCGGTGTTTGGG - Intergenic
1021531541 7:21651827-21651849 AGGCAGTGATTTTTGTGGGCTGG - Intronic
1023134919 7:37041775-37041797 AGCCAGTGTTCCTGGGGTGGGGG - Intronic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1024410271 7:49032437-49032459 AGCCAGTGTACTTGATATGCTGG - Intergenic
1024537905 7:50453465-50453487 TGCCAGTTCTCTTGGTGTGAGGG + Intronic
1024984078 7:55180833-55180855 AGCCAGCGTTCCTGATGTGCAGG + Intronic
1025836689 7:65101033-65101055 AGGCTGTGATATTCGTGTGCAGG - Intergenic
1025906464 7:65790470-65790492 AGGCTGTGATATTCGTGTGCAGG - Intergenic
1026128614 7:67601766-67601788 AGCCAGTGATCTTGAGTTGGTGG - Intergenic
1026769435 7:73185530-73185552 AGGCTGTGATATTTGTGTGCAGG - Intergenic
1026775008 7:73225965-73225987 AGCGGGAGATCTTGGTGGGCAGG - Intergenic
1027010304 7:74738914-74738936 AGGCTGTGATATTTGTGTGCAGG - Intronic
1027015864 7:74779336-74779358 AGCGGGAGATCTTGGTGGGCAGG - Exonic
1027072165 7:75166601-75166623 AGCGGGAGATCTTGGTGGGCAGG + Intergenic
1027077738 7:75207125-75207147 AGGCTGTGATATTTGTGTGCAGG + Intergenic
1027901034 7:84115149-84115171 AGCCAGTTATTTTGGTATGTAGG + Intronic
1028638986 7:93022218-93022240 AGCCAGTCATCAGGGTGTGAGGG + Intergenic
1028972501 7:96875072-96875094 AGCCAGTGGACTTGGATTGCAGG + Intergenic
1029338020 7:99919072-99919094 GGCCAGTGTGCCTGGTGTGCAGG - Exonic
1032259438 7:130323050-130323072 AGCCAGTGACCTTGCTCTGGTGG + Exonic
1032417438 7:131747248-131747270 AGCCAGGAATCTTGGTGAGCAGG + Intergenic
1032529687 7:132609860-132609882 AGCCAGTGCTCATGGAGTGTTGG - Intronic
1032778204 7:135137837-135137859 GGGCAGTCATCTTGGTTTGCAGG + Intronic
1035492494 7:159292520-159292542 AGCAAATCACCTTGGTGTGCTGG - Intergenic
1036398498 8:8387581-8387603 AGCCAGGGATCTGGGGGTGGGGG - Intergenic
1038982924 8:32778900-32778922 AGCCAGTCATGGTGGTGTGATGG + Intergenic
1041656735 8:60359760-60359782 AGACAGTGATCTGGCTGTGATGG - Intergenic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1044026235 8:87175750-87175772 AGCCAGCGAGCTTGGGGGGCAGG - Intronic
1046917207 8:119690625-119690647 AACCAGTGATATTGGTGGGAAGG + Intergenic
1048955807 8:139535001-139535023 AGCCAGGTGTCTTGGAGTGCAGG + Intergenic
1048975501 8:139670703-139670725 AGCCATTGATTTTGGAGGGCAGG + Intronic
1050429341 9:5546235-5546257 AGAAACTGATCTTGGTGTCCTGG - Intronic
1054869467 9:70036131-70036153 TGCCACTGATCTTGGTCTTCTGG - Intergenic
1055026331 9:71726132-71726154 AGTCAGTGATCTCTGCGTGCTGG - Intronic
1056561109 9:87730412-87730434 AGACATGGATCATGGTGTGCTGG + Exonic
1057315325 9:93964767-93964789 ACACAGTGAGCGTGGTGTGCGGG - Intergenic
1060279964 9:122209188-122209210 AGCCAGTGACCTTGGTCAACTGG - Intronic
1187070997 X:15888244-15888266 AGCCTGTGCTCTGGGTGTCCAGG - Intergenic
1192528258 X:71866602-71866624 AGGAAGAGATCTTGGCGTGCAGG + Intergenic
1197647130 X:129030262-129030284 AGCCAGAGATTTAGGTGTGGAGG + Intergenic
1198327315 X:135586594-135586616 AGCCAGGGGTCCTGGGGTGCCGG - Intergenic
1198506569 X:137307203-137307225 AGCCAGTAACCTTAGTGTGAAGG - Intergenic
1201515186 Y:14812748-14812770 ACCCAGTGATTTAGGTGTGCAGG + Intronic